Next Article in Journal
Soil Inversion with Subsoiling Increases Cotton Yield Through Improving Soil Properties and Root Growth
Previous Article in Journal
Precision Nutrient and Soil Tillage Management for Sustainable Winter Barley Production (Hordeum vulgare L.) and Tillage Impact on Soil CO2 Emission
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Structure of Endangered Species Anagallis foemina Mill. and Abundant Weed Anagalis arvensis L. Occurring in Segetal Habitats in South-Eastern Poland

by
Ewa Kwiecińska-Poppe
1,
Sylwia Sowa
2,
Joanna Lech
2,
Małgorzata Haliniarz
1 and
Edyta Paczos-Grzęda
2,*
1
Department of Herbology and Plant Cultivation Techniques, University of Life Sciences in Lublin, Akademicka Str. 13, 20-950 Lublin, Poland
2
Institute of Plant Genetics, Breeding and Biotechnology, University of Life Sciences in Lublin, Akademicka Str. 15, 20-950 Lublin, Poland
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(1), 3; https://doi.org/10.3390/agronomy15010003
Submission received: 24 November 2024 / Revised: 16 December 2024 / Accepted: 18 December 2024 / Published: 24 December 2024
(This article belongs to the Section Innovative Cropping Systems)

Abstract

In Poland, two species of the genus Anagallis can be found in segetal communities: scarlet pimpernel (Anagallis arvensis L.) and blue pimpernel (Anagallis foemina Mill.). A. arvensis usually has brick-red flowers and is a common weed in arable crops. Meanwhile, A. foemina, with blue flowers, is considered a species at risk of extinction in Poland. Flower colour is not a determinant of species affiliation, as there is a form of Anagallis arvensis f. azurea with blue flowers; thus, it is very difficult to specify the species identity of plants with blue flowers based on the negligible differences in morphology. Therefore, for the determination of species affiliation, the presence of two deletions within the intron of the chloroplastic gene trnL in A. arvensis and their absence in A. foemina were confirmed. The genetic similarity and population structure were established based on DNA polymorphism markers identified via the ISSR (inter simple sequence repeat) and SRAP (sequence-related amplified polymorphism) methods. UPGMA (unweighted pair group method with arithmetic mean) analyses revealed that red-flowered (A. arvensis) and blue-flowered (A. foemina) plants were grouped into two separate groups. Within the A. foemina group, two subgroups were distinguished: the first subgroup included genotypes from the Lublin Upland (LU) and Volhynian Polesie (VP), while the second subgroup consisted of genotypes from Western Volhynian Upland (VU). The within-group genetic diversity of A. arvensis was greater than the diversity within the A. foemina subpopulations. Principal coordinate analysis (PCoA) and STRUCTURE were also used to group samples according to species affiliation and collection site. The results obtained confirm that A. foemina populations in the study area are fragmented and isolated, which may lead to a decrease in their adaptability to environmental changes, reduced reproductive rates, and increased mortality.

1. Introduction

The genus Anagallis L. (synonym: Lysimachia (L.)) belongs to the family Primulaceae. Linnaeus [1] described four species of Anagallis: A. arvensis, A. monelli, A. latifolia, and A. capensis. Tutin et al. [2] listed six species in this genus: A. minima, A. tenella, A. crassifolia, A. monellin, A. arvensis, and A. foemina. They further indicated that the taxa intermingle and it is difficult to recognise them. Mabberley [3] identified A. tenella (L.) L., A. monelli L. A. arvensis L., and A. arvensis ssp. caerulea (Schreb.) Baumg. Based on plant morphology and karyotype observation, Moneim et al. [4] indicated that A. arvensis and A. foemina should be considered as at least two separate subspecies. Mirek et al. [5] have listed two species of pimpernel occurring in Poland: A. arvensis L. and A. foemina Mill. The former usually has red flowers, while those of the latter are blue. However, according to Moneim et al. [4] and Manns and Andeberg [6], flower colour is not an indicator of species affiliation, as there is a form of A. arvensis with blue flowers—namely, A. arvensis f. azurea Hyl.—the occurrence of which in Poland has been reported by Kornaś [7]. Due to their high morphological similarity, determining the species affiliation of plants with blue flowers is difficult. A. arvensis f. azurea and A. foemina can be distinguished from each other only on the basis of minor differences in the arrangement and termination of the corolla petals, the length of the stalks during flowering, and the shape of the leaves [8]. For this reason, the blue form of A. arvensis has been a source of confusion in the nomenclature of this taxon. Habitats of A. arvensis f. azurea are found in central Poland, in the South Podlasie Lowlands and neighbouring areas [9,10]. Śliwiński and Dajdok [8] have reported that, before 1945, A. foemina occurred in 19 localities in Lower Silesia; however, after verification of herbarium collections, it turned out that the vast majority of them represented A. arvensis f. azurea, while blue pimpernel was confirmed only in two localities. Similarly, Manns and Anderberg [6] and Brütting et al. [11] found that the reported frequency of A. foemina in the literature is overestimated due to this species being confused with the blue-flowered A. arvensis f. azurea. Furthermore, these species may form hybrids, Anagallis arvensis × foemina = Anagallis × doerfleri Ronn., with a crown colour similar to that of A. arvensis [12,13]. However, Haliniarz and Kapeluszny [14] have reported the occurrence of only A. foemina, and not A. arvensis f. azurea, when documenting the localities of rare species of calciphilous segetal flora in Lublin Province.
Both A. arvensis L. and A. foemina Mill. are archaeophytes in Polish flora, occurring in segetal and ruderal habitats. They grow on nutrient-rich soils, but A. foemina is more often observed on dry, calcium-rich, heavy, chalky rendzina soils [7,15]. Populations of A. foemina are constantly decreasing [16,17], and it has been reported as a species at risk of extinction in many European countries [18,19,20,21]. The chromosome number of A. foemina is usually 2n = 40, but polyploidy occurs in some populations [22]. Its fertility is estimated at 200 to 300 seeds per plant, with the weight of 1000 seeds ranging from 0.6 to 0.7 g. The chromosome number of A. arvensis is 2n = 22, 28, 40; one plant produces 200 to 450 seeds and the weight of 1000 seeds is about 0.4 g [18,23,24]. The corolla petals of A. foemina have few or no marginal hairs and have elongated terminal cells, whereas, in A. arvensis, there are numerous, glandular-ended hairs on the margins of the petals. There are also minor differences in the arrangement and termination of the corolla petals, the length of the stalks, and the shape of the leaves. Both species are considered insect-pollinated and self-pollinated, with self-pollination dominating given the declining pollinator population [25]. Moreover, Gibbs and Talavera [26] have shown that A. arvensis self-pollinates in the evening and during petal closure on cloudy days. Busch et al. [27] found that self-pollinated plants lose considerable genetic variation within just nine generations. These changes can have a detrimental effect on the ability of plants to adapt to changes in their environment.
At present, molecular markers are far more suitable and effective tools for genetic diversity analysis than morphological and biochemical characteristics, as they are not affected by the environment, they segregate as a single gene, and they enable species identification without specialist botanical knowledge [28]. A vast array of molecular markers, including amplified fragment length polymorphism (AFLP), sequence-related amplified polymorphism (SRAP), inter simple sequence repeats (ISSRs) and microsatellites or simple sequence repeats (SSRs), have been used to assess genetic diversity in plant species [29]. ISSRs are segments of DNA that are flanked on both sides by microsatellite sequences, that is, tandemly repeated 2–5-nucleotide long DNA motifs. 3′ anchored primers amplify the sequences located between microsatellites, which are thought to be adjacent to coding sequences. ISSRs are cost-effective, very efficient, and highly reproducible [30]. SRAP markers are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have been proven to be robust and highly variable. SRAP markers have been used primarily for assessing the genetic diversity of large germplasm collections, as well as in plant systematics, biogeography, conservation, ecology, and more [31]. ISSRs and SRAPs are both molecular tools based on the PCR amplification of multilocus sequences which have been found to be useful in the analysis of genetic variation below the species level—mainly in studying population structure and differentiation [32].
The aim of this study was to determine the species affiliation of blue- and red-flowered Anagallis L. plants collected from segetal communities in south-eastern Poland. Additionally, the study aimed to perform genetic profiling of the collected Anagallis genotypes to assess their genetic similarity and population structure based on DNA polymorphisms identified using the ISSR and SRAP methods. To the best of our knowledge, this is the first survey regarding the assessment of the genetic structure of Anagallis species occurring in this geographic region using a combination of two methods for DNA polymorphism assessment and species identification through sequencing the discriminating DNA fragment of the trnL gene.

2. Materials and Methods

2.1. Plant Material

Leaf fragments for genetic analysis were collected in 2017–2021 (from June to August) from sites located in fields in south-eastern Poland; namely, in the Chełm, Zamość, Hrubieszów, Tomaszów, Włodawa, and Opole districts of the Lublin Upland (Figure 1, Table 1). From each site, leaves were collected from a minimum of 3 randomly selected plants, separately from specimens with blue flowers and those with red flowers. The exact geographical location of the sites was determined using a GPS device (Table 1). The points of occurrence of the studied species are presented based on the ATPOL grid [33].

2.2. DNA Extraction

For molecular analysis, genomic DNA was extracted from the 30 frozen leaf material tissues (Table 1) using the GeneMATRIX Plant and Fungi DNA Purification Kit (EURx, Gdańsk, Poland) and purified with the Anti-Inhibitor Kit (A&A Biotechnology, Gdańsk, Poland). DNA integrity and quality were evaluated via electrophoresis on 1.5% agarose gel. The DNA concentration was determined through NanoDrop2000 (Thermo Fisher Scientific, Waltham, MA, USA) spectrophotometry and normalised to 100 ng·μL−1.

2.3. Amplification of trnL-F Intergenic Spacer

For trnL-F intergenic spacer amplification, a PCR mixture was used at a final volume of 10 µL containing 25 ng of template DNA, 1 × DreamTaq™ Buffer, 2 mM of MgCl2, 0.5 U DreamTaq™ DNA polymerase (Thermo Fisher Scientific), 0.2 mM of each dNTP, and 0.5 µM of forward (5′ GGGCAATCCTGAGCCAAATC 3′) and reverse (5′ GAATTGATTCGCAACGATTCTTC 3′) primers. Primers were designed based on the sequences EF437060.1 A. foemina and EF437060.1 A. arvensis with NCBI primer blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 1 May 2024), as well as the Primer3 (v.0.4.0) software [34]. The PCR amplification protocol was as follows: 94 °C for 4 min (initial denaturation); 35 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 40 s; and a final extension of 72 °C for 7 min. The primers were designed to identify two deletions in A. arvensis and amplify the 260 bp long fragment in A. foemina and 246 bp long fragment in A. arvensis. These deletions were detected in the trnL-F intergenic spacer by Manns and Anderberg [6] and can be used for the discrimination of species within the Anagallis genus. Products amplified in four randomly chosen pairs of red- and blue-flowered genotypes from the same region were subjected to Sanger sequencing at Genomed (Warsaw, Poland). Sequences were analysed using the BioEdit sequence alignment editor v. 7.0.5.3 [35] and visualised with Genedoc v.2.7 [36].

2.4. ISSR Genotyping

PCR reactions were performed according to the ISSR (inter simple sequence repeat) method described by Zietkiewicz et al. [37], with modifications. The reaction mixture of 12 µL contained 20 ng of template DNA, 1× PCR Master Mix buffer (0.5 U Taq DNA polymerase, 2 mM of MgCl2, 0.4 mM of each dNTP; Thermo Fisher Scientific, Waltham, MA, USA) and 0.6 µM of primer (Table 2). The amplification protocol was as follows: 95 °C for 7 min (pre-denaturation); 3 cycles of 95 °C for 30 s, 54 °C for 45 s, and 72 °C for 2 min; 3 cycles of 95 °C for 30 s, 53 °C for 45 s, and 72 °C for 2 min; 32 cycles of 95 °C for 30 s, 52 °C for 45 s, and 72 °C for 2 min; and a final extension of 72 °C for 7 min.

2.5. SRAP Genotyping

For the SRAP (sequence-related amplified polymorphism) assay, 9 SRAP primers were used in 12 primer combinations (Table 2). The PCR mix of 12 µL contained 1× PCR Master Mix buffer (0.5 U Taq DNA polymerase, 2 mM of MgCl2, 0.4 mM of each dNTP; Thermo Fisher Scientific), 0.4 μM of each primer, and 20 ng of template DNA. The PCR was completed using the Biometra T1 Professional Basic thermocycler programmed for 3 min at 94 °C for initial denaturation, followed by 5 cycles of 94 °C for 1 min, 35 °C for 1 min, and 72 °C for 1 min; 36 cycles of 94 °C for 1 min, 50 °C for 1 min, and 72 °C for 1 min; and a final extension of 72 °C for 7 min [38].

2.6. Separation of PCR Products

The amplification products were separated on 1.5% agarose gel containing 5 μg/mL of EtBr in 1x TBE Buffer (90 mM Tris-borate, 2 mM EDTA, pH 8.0). To establish the molecular weight of the products, Gene RulerTM 100 bp Plus DNA Ladder was used (Thermo Fisher Scientific). Fragments were visualised under a UV transilluminator and photographed using the Uvitec (Cambridge, UK).

2.7. Molecular Data Mining and Analysis

ISSR and SRAP fragments were transformed into a 0/1 matrix through coding the presence of the fragment as 1 and its absence as 0. Marker informativeness was calculated for each primer/primer pair by counting the TNF (total number of fragments) and NPF (number of polymorphic fragments). The PIC (polymorphism information content) value was calculated as the mean of all the PIC values for all the amplified fragments, according to the following formula:
P I C = 2 f i ( 1 f i ) ,
where fi is the frequency of the amplified allele (band present) and (1 − fi) is the frequency of the null allele (band absent) [39,40].
Unbiased expected heterozygosity (He) and the percentage of polymorphic products and private bands were estimated using GenAlex 6.502 [41]. The genetic distance was calculated based on Nei’s formula [42]. The Mantel test statistic [43] was calculated with 999 permutations to assess the correlation between genetic distance matrices, evaluated according to ISSR and SRAP markers. An analysis of molecular variance within and between groups of individuals (divided based on phenotype and place of gathering) was carried out with 999 permutations.
The relationships among all the examined genotypes were assessed by performing a UPGMA (unweighted pair group method with arithmetic mean) cluster analysis on Dice [44] similarity values with 1000 bootstraps, as well as a principal coordinate analysis (PCoA) in PAST 3.25 [45].
The population structure was estimated using a Bayesian approach, implemented in the STRUCTURE 2.3.4 programme [46]. The admixture model and correlated allele frequencies between populations were chosen. The number of clusters (K) was set from 2 to 6, with 10 independent runs for each k (10,000 burn-ins and 100,000 Markov Chain Monte Carlo replications). A web-based software, Structure Selector [47], integrating the Clumpak programme [48] was used to select and visualise the optimal number of clusters.

3. Results

3.1. Sequence Analysis of trnL-F Intergenic Spacer

The relationships between Anagallis arvensis and A. foemina were analysed using nuclear and plastid molecular data by Manns and Anderberg [6]. The existence of two distinct cpDNA haplotypes was revealed, based on which it was possible to distinguish individuals representing both species. An analysis of the results from Manns and Anderberg [6] and comparison with the trnL-F intergenic spacer sequences available in the NCBI repository confirmed the existence of two deletions in this sequence in individuals representing A. arvensis but not in A. foemina. To identify these deletions, primers amplifying a 260 bp long fragment in A. foemina and a 246 bp long fragment in A. arvensis were designed based on the sequences EF437060.1 A. foemina and EF437060.1 A. arvensis. The short product was amplified in all 17 red-flowered genotypes, indicating their affiliation to A. arvensis, whereas the 260 bp product was detected in 13 blue-flowered genotypes. Products amplified in four randomly selected red-flowered and four blue-flowered pairs of genotypes from the same region were subjected to Sanger sequencing, and the alignment results revealed, as expected, the presence of two deletions in the A. arvensis representatives at positions 134–141 and 178–183 (Figure 2).

3.2. ISSR Amplification

For the 30 analysed genotypes, 174 amplification fragments were obtained using six ISSR primers (Table 3), of which 168 were polymorphic. On average, a single ISSR generated 29 fragments (range: 23–34). The ISSR primers sr37 and sr31 were the most efficient, producing 32 and 34 polymorphic bands, respectively. The rates of informative polymorphic bands from ISSR amplifications varied from 90% to 100%, with PIC scores ranging from 0.281 to 0.403. The average PIC for the ISSR method was 0.360.

3.3. SRAP Amplification

Nine SRAP primers in 12 combinations amplified 257 DNA fragments, of which 240 were polymorphic. On average, a single SRAP pair generated 21 fragments (range: 11–27) (Table 4). SRAP primers Me3-Em2 and Fsrap17_ep-Em2 generated the highest number of polymorphic bands (27), whereas Me2-Em2 amplified the lowest number of polymorphic bands (8). The primer sets Fsrap17_ep-Em5, Fsrap13_ep-Em5, Me4-Em2, Me4-Em2, Me1-Em1, Fsrap17_ep-Em2, and Me3-Em2 produced the highest percentage of polymorphic bands (100%). The PIC scores for the SRAP primer pairs ranged from 0.135 to 0.394, with an average of 0.317.
The Mantel test of the genetic distance matrices based on Nei’s formula, evaluated according to the ISSR and SRAP markers, demonstrated that they were highly correlated (r = 0.86, p = 0.01).

3.4. Genetic Diversity

Both the ISSR and SRAP amplification results were used to determine the level of genetic diversity within the 30 Anagallis L. genotypes collected in Poland.
A percentage of polymorphic loci of about 25% was observed for Anagallis with red flowers, while a much lower value of about 11.5% was observed for Anagallis with blue flowers. The largest number of bands unique to the group (39 bands) was observed for genotypes with blue flowers collected in West Volhynian Upland (VU). The number of private bands for Anagallis with red flowers gathered in three localizations ranged from 1 to 5. The average unbiased expected heterozygosity (uHe) of distinguished groups was 0.075. The AMOVA study, performed to determine the genetic diversity among and within all Anagallis L. genotypes, indicated that 74% of the variation existed among groups and 26% existed within groups (Φpt = 0.74, p = 0.001; Table 5, Figure 3).
UPGMA analyses based on all marker types grouped samples into two clearly separated clusters (Figure 4). The first encompassed all Anagallis genotypes with red flowers. The second cluster was composed of Anagallis genotypes with blue flowers, within which two subgroups with a similarity of 0.45 could be distinguished. The first subgroup contained genotypes from the West Volhynian Upland (VU), while the second was composed of samples from the Lublin Upland (LU) and Volhynian Polesie (VP). Principal coordinate analysis based on both ISSRs and SRAPs (Figure 5), as well as either ISSRs or SRAPs yielded congruent results, confirming the cluster analyses. The two first coordinates explained 85% of the variance.

3.5. Genetic Structure

The genetic structure of the Anagallis L. genotypes was estimated via model-based Bayesian clustering using the STRUCTURE 2.3.4 software. The Δ statistical test showed that k = 3 was optimal in this analysis (Figure 6). Genotypes with red flowers represented the first group, the second group was composed of genotypes with blue flowers collected in the West Volhynian Upland (VU), and the third group included genotypes with blue flowers from the Lublin Upland (LU) and Volhynian Polesie (VP) (Figure 7).

4. Discussion

Knowledge on the genetic structure and diversity of plant species is an extremely important attribute for assessing the spread and extinction of declining species [49,50,51]. Reduced genetic diversity has consequences not only at the population level but also at the species level [52,53]. In Europe, segetal communities play an important role in protecting and increasing biodiversity [54], as they provide a habitat for a huge number of living organisms; however, due to agricultural intensification, they are among the most threatened territories [55,56,57,58]. Changes in the structure of agrophytocoenoses are being increasingly observed, including the rarer occurrence of certain weed species. As such, segetal flora are under increasing threat, and the process of species extinction is becoming more intense. Typical multi-species communities in arable fields are gradually disappearing, being replaced by impoverished and fragmented communities [14,59]. It is very difficult to clearly identify which agricultural practices are more or less harmful to segetal weeds. Nevertheless, most studies have proven that an ecological and extensive farming system favours the biodiversity preservation of agrophytocenoses, including the conservation of rare weed species [19,60,61].
The Anagallis genus comprises both the globally widespread species A. arvensis and the very rare and endangered (in many European countries) species A. foemina. The aim of the present study was the comparative genetic profiling of Anagallis L. genotypes collected in south-eastern Poland. The Anagallis L. genotypes studied formed two groups on the dendrogram, where the first group included all genotypes with red flowers and the second group consisted of genotypes with blue flowers. The Dice similarity index between these groups was 0.375. Such a low similarity indicates that they represent two separate species. Both our research and that conducted by Manns and Anderberg [6,13] confirm that A. arvensis and A. foemina are two separate species and that A. foemina is not a subspecies of A. arvensis, as has been claimed by Marsden-Jones and Weiss [12] and Taylor [62]. Moreover, our results were supported by the sequencing analysis of the intergenic region of the trnL-F gene, which indicated differences between red- and blue-flowered plants. The observed deletions, which were specific for A. arvensis but absent in A. foemina, allowed the species affiliation of the studied genotypes to be determined, which was confirmed through genetic diversity studies based on ISSR and SRAP marker polymorphism.
One of the reasons for the decline in species populations is the deterioration of edaphic conditions, especially when combined with the relatively small habitat area in which the species occurs [63]. Changing abiotic conditions may lead to the extinction of stenotopic species with narrow ecological niches, such as A. foemina, which occurs only on soils with a high calcium carbonate content (so-called rendzina soils). The small area of rendzina soils in the study area, their high fragmentation, and the strict edaphic requirements of A. foemina have resulted in the fragmented populations of this species. The populations analysed were located in the western Volhynian Upland (VU), the Lublin Upland (LU), and the Volhynian Polesie (VP), which are areas that are separated from each other. In addition, the relatively low seed production of A. foemina species, compared to other segetal weeds, renders them particularly sensitive to the effects of population fragmentation [64]. The isolation of a population affects its size and leads to the erosion of genetic variability and, thus, an increase in genetic diversity between populations. This theory is supported by the research carried out as well as by our previous studies on the genetic diversity of A. foemina [65], both of which demonstrated the low genetic similarity between populations and high similarity within populations derived from the same site. The isolation of a small population in a given area leads to a reduction in its internal genetic variability and may contribute to a decrease in its adaptability to environmental changes, reduced reproductive rates, and increased mortality, which become reasons for the extinction of the local population [18,66]. In a study by Brütting et al. [67], it was found that A. foemina plants within the population showed little genetic diversity (variation the was 16%). In this study, A. foemina populations from different sites—especially the Volhynian Polesie (VP) and Western Volhynian Upland sites—showed a low degree of intrapopulation genetic diversity, whereas the diversity between geographically isolated populations was high, indicating a very low gene flow at present. This may be a factor contributing to the decline in this species in Poland. The high fragmentation of the population necessitates the enforcement of biodiversity preservation through the conservation of populations from regional clusters [68]. Simultaneously, in this research, the molecular analysis revealed that the studied A. arvensis genotypes were characterised by higher genetic diversity, and, moreover, their genetic similarity was not as closely related to locality as for the populations of A. foemina. This suggests that A. arvensis populations are better adapted to changing environmental conditions and are not at risk of extinction like A. foemina.
Genetic variability within plant populations that reproduce continuously by self-pollination is much lower than that within plant populations where cross-pollination occurs [69,70,71]. Self-pollination has the potential to deprive populations of the genome-wide variation necessary for adaptation to environmental challenges [72]. In their study, Gibbs and Talavera [26] found that self-pollination in A. arvensis is common; however, it is difficult to conclude how quickly this leads to a reduction in genetic diversity. The authors observed A. arvensis flowers and did not report insect pollinators; instead, the flowers automatically self-pollinated when the petals closed at the end of the day. In their study, both species showed low genetic diversity—especially A. arvensis—which may be due to the dominance of self-pollination. Despite this, A. arvensis is currently a common species in south-eastern Poland, and no decline in its abundance has been observed.
The decline in A. foemina populations is associated with the attachment of this species to arable fields located on rendzina soils and the intensification of agricultural production. Due to their spatial isolation, gene flow between populations in fragmented habitats is limited [73]. The fragmentation of A. foemina populations affects the low genetic diversity within populations, which may even contribute to the extinction of the species [23,74]. Similar observations have also been made in relation to the population of Centaurea cyanus in central–eastern France [74].
A. foemina is only found in communities with high species biodiversity (according to our own unpublished studies); therefore, in order to protect it, it is recommended to use a diversified crop rotation, which can significantly reduce the occurrence of expansive and cosmopolitan species displacing other species from the community, including rare species. To increase the population of A. foemina, which is sensitive to herbicides, it is advisable to reduce the amount of herbicides used and to introduce non-chemical weed control methods into agricultural technology. Many rare weed species occur on the edges of field margins, and intensive agricultural practices are eliminating these habitats, further reducing the ability of these species to survive. Therefore, to protect them, it would be advisable to leave field margins without intensive protection [75]. In addition, increasing the area used for organic crops could also help to improve the status of the endangered species A. foemina. The EU has already taken steps to increase the biodiversity of agroecosystems through introducing the European Green Deal programme, which recommends a 50% reduction in the amount of active substances used and a 25% increase in the area under organic farming. If A. foemina populations increase in a given location, it is likely that agricultural machinery can transport seeds and, thus, facilitate gene flow and prevent fragmentation effects [76].

5. Conclusions

This study focused on the molecular characterisation of 30 Anagallis genotypes collected from segetal habitats in south-eastern Poland based on DNA polymorphisms identified according to ISSR and SRAP analyses. The main objectives were to determine the species affiliation, genetic variability, and population structure of the genotypes studied. The results of this study highlight the importance of DNA markers in research on species identification and genetic diversity. The population genetic analysis clearly separated the individuals into two distinct populations (A. foemina and A. arvensis). The genetic variation was high between the geographically separated populations of blue-flowered A. foemina plants but low within populations from the same region. In contrast, the populations of red-flowered A. arvensis showed greater genetic variation in a manner unrelated to their place of origin. Preserving and understanding genetic diversity play a key role in maintaining the evolutionary potential of species and their adaptability to changing environmental conditions.

Author Contributions

Conceptualization and methodology, E.P.-G., E.K.-P. and S.S.; investigation, E.P.-G., E.K.-P., S.S. and J.L.; resources, M.H.; writing—original draft preparation, E.K.-P.; writing—review and editing, E.P.-G., E.K.-P., M.H. and S.S; visualisation, S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Linnaeus, C. Species Plantarum; Laurentius Salvius: Stockholm, Sweden, 1753; Volume 1, pp. 148–149. [Google Scholar] [CrossRef]
  2. Tutin, T.G.; Heywood, V.H.; Burges, N.A.; Moore, D.M.; Valentin, D.H.; Walters, S.M.; Webb, D.A. Flora Europaea; Diapensiaceae to Myoporaceae; Cambridge University Press: Cambridge, UK, 1972; Volume 3. [Google Scholar]
  3. Mabberley, D.J. The Plant Book a Portable Dictionary of the Vascular Plants; Cambridge University Press: Cambridge, UK, 1997; p. 35. [Google Scholar]
  4. Moneim, A.; Atta, I.I.; Shehata, A.A. On the Delimitation of Anagallis arvensis L. (Primulaceae) 1. Evidence Based on Macromorphological Characters, Palynological Features and Karyological Studies. Pak. J. Biol. Sci. 2003, 6, 29–35. [Google Scholar] [CrossRef][Green Version]
  5. Mirek, Z.; Piękoś-Mirkowa, H.; Zając, A.; Zając, M. Flowering Plants and Pteridophytes of Poland—A checklist. In Biodiversity of Poland; W. Szafer Institute of Botany, Polish Academy of Sciences: Kraków, Poland, 2002; Volume 1. [Google Scholar]
  6. Manns, U.; Anderberg, A.A. Relationships of Anagallis foemina and A. arvensis (Myrsinaceae): New insights inferred from DNA sequence data. Mol. Phylogenet. Evol. 2007, 45, 971–980. [Google Scholar] [CrossRef]
  7. Kornaś, J. Rodzaj Anagallis L. w Polsce—Genus Anagallis L. w Polsce. Fragm. Flor. Geobot. 1962, 8, 131–138. [Google Scholar]
  8. Śliwiński, M.; Dajdok, Z. Anagallis foemina (Primulaceae) na Dolnym Śląsku—Występowanie i problemy jego identyfikacji. Acta Bot. Sil. Suppl. 2011, 1, 42–44. [Google Scholar]
  9. Warcholińska, A.U. Nowe stanowiska Anagallis arvensis L. for. azurea Hyl. w środkowej Polsce. Fragm. Flor. Geobot. Pol. 1981, 27, 159–161. [Google Scholar]
  10. Ciosek, M.T.; Skrzyczyńska, J. Rare species of field weeds of the South Podlasie Lowland and the neighbouring regions. Acta Univ. Lodz. Folia Bot. 1998, 13, 113–130. [Google Scholar]
  11. Brütting, C.; Wesche, K.; Meyer, S.; Hensen, I. Genetic diversity of six arable plants in relation to their Red List status. Biodivers. Conserv. 2012, 21, 745–761. [Google Scholar] [CrossRef]
  12. Marsden-Jones, E.M.; Weiss, F.E. The essential differences between Anagallis arvensis Linn. and Anagallis foemina Mill. Proc. Linn. Soc. Lond. 1938, 150, 146–155. [Google Scholar] [CrossRef]
  13. Manns, U.; Anderberg, A.A. Character Evolution in Anagallis (Myrsinaceae) Inferred from Morphological and Molecular Data. Syst. Bot. 2007, 32, 166–179. [Google Scholar] [CrossRef]
  14. Haliniarz, M.; Kapeluszny, J. Rare species of calcicole flora in the segetal communities in the Lublin region. Ann. UMCS 2014, 69, 11–22. [Google Scholar] [CrossRef]
  15. Fijałkowski, D. Synantropy roślinne Lubelszczyzny; PWN: Warszawa-Łódź, Poland, 1978. [Google Scholar]
  16. Siciński, J.; Sieradzki, J. Protection of segetal flora and vegetation in Poland. Plant Breed. Seed Sci. 2010, 61, 123–131. [Google Scholar] [CrossRef]
  17. Węgrzynek, B.; Nowak, T. Rare and endangered segetal weed species in the Silesian Upland (s Poland) recorded in the last twenty years. Plant Breed. Seed Sci. 2010, 61, 75–84. [Google Scholar] [CrossRef]
  18. Brütting, C. Genetic Diversity and Population Structure of Arable Plants In Situ and Ex Situ—How Sustainable is Long Term Cultivation in Botanical Gardens Compared to In Situ Conditions? Ph.D. Thesis, University Halle-Wittenberg, Halle, Germany, October 2013. [Google Scholar]
  19. Kolárová, M.; Tyšer, L.; Soukup, J. Impact of site conditions and farming practices on the occurrence of rare and endangered weeds on arable land in the Czech Republic. Weed Res. 2013, 53, 489–498. [Google Scholar] [CrossRef]
  20. Cwener, A.; Michalczuk, W.; Krawczyk, R. Red list of vascular plants of Lublin Region. Ann. UMCS 2016, 71, 7–26. [Google Scholar] [CrossRef]
  21. Kaźmierczakowa, R.; Bloch-Orłowska, J.; Celka, Z.; Cwener, A.; Dajdok, Z.; Michalska-Hejduk, D.; Pawlikowski, P.; Szczęśniak, E.; Ziarnek, K. Polish Red List of Pteridophytes and Flowering Plants; Instytut Ochrony Przyrody Polskiej Akademii Nauk: Kraków, Poland, 2016. [Google Scholar]
  22. Clapham, A.R.; Tutin, T.G.; Moore, D.M. Flora of the British Isles, 3rd ed.; Cambridge University Press: Cambridge, UK, 1987. [Google Scholar]
  23. Brütting, C.; Meyer, S.; Kühne, P.; Hensen, I.; Wesche, K. Spatial Genetic Structure and Low Diversity of the Rare Arable Plant Bupleurum rotundifolium L. Indicate Fragmentation in Central Europe. Agric. Ecosyst. Environ. 2012, 161, 70–77. [Google Scholar] [CrossRef]
  24. Ortiz, P.L.; Berjano, R.; Talavera, M.; Rodríguez-Zayas, L.; Arista, M. Flower colour polymorphism in Lysimachia arvensis: How is the red morph maintained in Mediterranean environments? Perspect. Plant Ecol. Evol. Syst. 2015, 17, 142–150. [Google Scholar] [CrossRef]
  25. Thomann, M.; Imbert, E.; Devaux, C.; Cheptou, P.O. Flowering plants under global pollinator decline. Trends Plant Sci. 2013, 18, 353–359. [Google Scholar] [CrossRef] [PubMed]
  26. Gibbs, P.E.; Talavera, S. Breeding System Studies with Three Species of Anagallis (Primulaceae): Self-incompatibility and Reduced Female Fertility in A. monelli L. Ann. Bot. 2001, 88, 139–144. [Google Scholar] [CrossRef][Green Version]
  27. Busch, J.W.; Bodbyl-Roels, S.; Tusuubira, S.; Kelly, J.K. Pollinator loss causes rapid adaptive evolution of selfing and dramatically reduces genome-wide genetic variability. Evolution 2022, 76, 2130–2144. [Google Scholar] [CrossRef]
  28. Kumar, P.; Gupta, V.K.; Misra, A.K.; Modi, D.R.; Pandey, B.K. Potential of molecular markers in plant biotechnology. Plant Omics 2009, 2, 141. [Google Scholar]
  29. Mouhaddab, J.; Msanda, F.; Filali-Maltouf, A.; Belkadi, B.; Ferradouss, A.; El Modafar, C.; Ibnsouda Koraichi, S.; El Mousadik, A. Using microsatellite markers to map genetic diversity and population structure of an endangered Moroccan endemic tree (Argania spinosa L. Skeels) and development of a core collection. Plant Gene 2017, 10, 51–59. [Google Scholar] [CrossRef]
  30. Paczos-Grzęda, E.; Bednarek, P.T. Comparative analysis of hexaploid Avena species using REMAP and ISSR methods. Turk. J. Bot. 2014, 38, 1103–1111. [Google Scholar] [CrossRef]
  31. Robarts, D.W.; Wolfe, A.D. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology. Appl. Plant Sci. 2014, 2, 1400017. [Google Scholar] [CrossRef] [PubMed]
  32. Mint Abdelaziz, S.; Medraoui, L.; Alami, M.; Pakhrou, O.; Makkaoui, M.; Boukhary, M.S.; Filali-Maltouf, A. Inter simple sequence repeat markers to assess genetic diversity of the desert date (Balanites aegyptiaca Del.) for Sahelian ecosystem restoration. Sci. Rep. 2020, 10, 14948. [Google Scholar] [CrossRef] [PubMed]
  33. Verey, M. Theoretical analysis and practical consequences of adopting a model ATPOL grid as a conical projection defining the conversion of plane coordinates to the WGS 84 ellipsoid. Fragm. Flor. Geobot. Pol. 2017, 24, 469–488. [Google Scholar]
  34. Rozen, S.; Skaletsky, H. Primer3 on the www for General Users and For Biologist Programmers. In Bioinformatics Methods and Protocols; Springer: Berlin/Heidelberg, Germany, 2000; Volume 132, pp. 365–386. [Google Scholar] [CrossRef]
  35. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  36. Nicholas, K.B.; Nicholas, H.B. GeneDoc: A Tool for Editing and Annotating Multiple Sequence Alignments, Pittsburgh Supercomputing Center’s National Resource for Biomedical Supercomputing, Ver. 2.7.000. 1997. Available online: www.psc.edu/biomed/genedoc (accessed on 10 October 2024).
  37. Zietkiewicz, E.; Rafalski, A.; Labuda, D. Genome Fingerprinting by Simple Sequence Repeat (SSR)-Anchored Polymerase Chain Reaction Amplification. Genomics 1994, 20, 176–183. [Google Scholar] [CrossRef]
  38. Li, G.; Quiros, C.F. Sequence-related amplified polymorphism (SRAP), A new marker system based on a simple PCR reaction: Its application to mapping and gene tagging in Brassica. TAG Theor. Appl. Genet. 2001, 103, 455–461. [Google Scholar] [CrossRef]
  39. Roldán-Ruiz, I.; Calsyn, E.; Gilliland, T.J.; Coll, R.; Van Eijk, M.J.T.; De Loose, M. Estimating genetic conformity between related ryegrass (Lolium) varieties. 2. AFLP characterization. Mol. Breed. 2000, 6, 593–602. [Google Scholar] [CrossRef]
  40. Roldán-Ruiz, I.; Dendauw, J.; Van Bockstaele, E.; Depicker, A.; De Loose, M. AFLP markers reveal high polymorphic rates in ryegrasses (Lolium spp.). Mol. Breed. [CrossRef]
  41. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  42. Nei, M.; Li, W.H. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 1979, 76, 5269–5273. [Google Scholar] [CrossRef]
  43. Mantel, N. The detection of disease clustering and a generalized regression approach. Cancer Res. 1967, 27, 209–220. [Google Scholar]
  44. Dice, L.R. Measures of the amount of ecologic association between species. Ecology 1945, 26, 297–302. [Google Scholar] [CrossRef]
  45. Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological Statistics Software Package for education and data analysis. Palaeontol. Electron. 2001, 4, 1–9. [Google Scholar]
  46. Porras-Hurtado Ruiz, Y.; Santos, C.; Phillips, C.; Carracedo, A.; Lareu, M.V. An overview of Structure: Applications, parameter settings, and supporting software. Front. Genet. 2013, 4, 98. [Google Scholar] [CrossRef] [PubMed]
  47. Li, Y.L.; Liu, J.X. Structure Selector: A web-based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef] [PubMed]
  48. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef]
  49. Frankham, R. Challenges and opportunities of genetic approaches to biological conservation. Biol. Conserv. 2010, 143, 1919–1927. [Google Scholar] [CrossRef]
  50. Höglund, J. Evolutionary Conservation Genetics; Oxford University Press: Oxford, UK, 2009. [Google Scholar]
  51. Laikre, L. Genetic diversity is overlooked in international conservation policy implementation. Conserv. Genet. 2010, 11, 349–354. [Google Scholar] [CrossRef]
  52. Dostálek, T.; Münzbergová, Z.; Plačková, I. Genetic diversity and its effect on fitness in an endangered plant species Dracocephalum austriacum L. Conserv. Genet. 2010, 11, 773–783. [Google Scholar] [CrossRef]
  53. Spielman, D.; Brook, B.W.; Frankham, R. Most species are not driven to extinction before genetic factors impact them. Proc. Natl. Acad. Sci. USA 2004, 101, 15261–15264. [Google Scholar] [CrossRef] [PubMed]
  54. Marshall, E.J.P.; Brown, V.K.; Boatman, N.D.; Lutman, P.J.W.; Squire, G.R.; Ward, L.K. The role of weeds in supporting biological diversity within crop fields. Weed Res. 2003, 43, 77–89. [Google Scholar] [CrossRef]
  55. Baessler, C.; Klotz, S. Effects of changes in agricultural land-use on landscape structure and arable weed vegetation over the last 50 years. Agric. Ecosyst. Environ. 2006, 115, 43–50. [Google Scholar] [CrossRef]
  56. Storkey, J.; Meyer, S.; Still, K.S.; Leuschner, C. The impact of agricultural intensification and land-use change on the European arable flora. Proc. R. Soc. B Biol. Sci. 2012, 279, 1421–1429. [Google Scholar] [CrossRef]
  57. Meyer, S.; Wesche, K.; Krause, B.; Leuschner, C. Dramatic losses of specialist arable plants in Central Germany since the 1950s/60s—A cross-regional analysis. Divers. Distrib. 2013, 19, 1175–1187. [Google Scholar] [CrossRef]
  58. Mayerová, M.; Mikulka, J.; Soukup, J. Effects of selective herbicide treatment on weed community in cereal crop rotation. Plant Soil Environ. 2018, 64, 413–420. [Google Scholar] [CrossRef]
  59. Warcholińska, A.U. Features of threatened segetal flora species in Central Poland and possibility of their protection. Acta Univ. Lodziensis. Folia Biol. Oecol. 2002, 1, 71–95. [Google Scholar] [CrossRef]
  60. Armengot, L.; Sans, F.X.; Fischer, C.M.; Flohre, A.; Jose-Maria, L.; Tscharntke, T.; Thies, C. The β-diversity of arable weed communities on organic and conventional cereal farms in two contrasting regions. Appl. Veg. Sci. 2012, 15, 571–579. [Google Scholar] [CrossRef]
  61. Chamorro, L.; Armengot, L.; José-María, L.; Sans, F.X. Organic farming enhances the recovery of ancient crops and segetal weeds in Catalonia (NE of Spain). Build. Org. Bridges 2014, 3, 979–982. [Google Scholar]
  62. Taylor, P. The genus Anagallis in tropical and South Africa. Kew Bull. 1955, 3, 321–350. [Google Scholar] [CrossRef]
  63. Minasiewicz, J.; Tukałło, P.; Trzepanowska, K. Dactylorhiza incarnata (L.) Soó in the Gdańsk region—Morphological and genetic variation of populations and the present state of the localities. Acta Bot. Cassub. 2004, 4, 139–160. [Google Scholar]
  64. Zając, M.; Zając, A.; Tokarska-Guzik, B. Extinct and endangered archaeophytes and the dynamics of their diversity in Poland. Biodivers. Res. Conserv. 2009, 13, 17–24. [Google Scholar] [CrossRef]
  65. Kwiecińska-Poppe, E.; Haliniarz, M.; Sowa, S.; Paczos-Grzęda, E. Genetic diversity and population structure of endangered plant species Anagallis foemina Mill. [Lysimachia foemina (Mill.) U. Manns & Anderb.]. Physiol. Mol. Biol. Plants 2020, 26, 1675–1683. [Google Scholar] [CrossRef]
  66. Godefroid, S.; Rivie‘re, S.; Waldren, S.; Boretos, N.; Eastwood, R.; Vanderborght, T. To what extent are threatened European plant species conserved in seed banks? Biol. Conserv. 2011, 144, 1494–1498. [Google Scholar] [CrossRef]
  67. Brütting, C.; Hensen, I.; Wesche, K. Ex Situ Cultivation Affects Genetic Structure and Diversity in Arable Plants. Plant Biol. 2013, 15, 505–513. [Google Scholar] [CrossRef] [PubMed]
  68. Daco, L.; Tiphaine, M.; Muller, S.; Rossa, J.; Colling, G. Genetic status of the endangered plant species Gladiolus palustris in the western part of its distribution area. Conserv. Genet. 2019, 20, 1339–1354. [Google Scholar] [CrossRef]
  69. Glemin, S.; Bazin, E.; Charlesworth, D. Impact of mating systems on patterns of sequence polymorphism in flowering plants. Proc. Biol. Sci. 2006, 273, 3011–3019. [Google Scholar] [CrossRef] [PubMed]
  70. Wright, S.I.; Kalisz, S.; Slotte, T. Evolutionary consequences of self-fertilization in plants. Proc. R. Soc. Lond. B 2013, 280, 20130133. [Google Scholar] [CrossRef]
  71. Brandvain, Y.; Slotte, T.; Hazzouri, K.M.; Wright, S.I.; Coop, G. Identyfikacja genomiczna haplotypów założycielskich ujawnia historię samozapylającego gatunku Capsella rubella. PLoS Genet. 2013, 9, e1003754. [Google Scholar] [CrossRef]
  72. Goldberg, E.E.; Kohn, J.R.; Lande, R.; Robertson, K.A.; Smith, S.A.; Igic, B. Species selection maintains self-incompatibility. Science 2010, 330, 493–495. [Google Scholar] [CrossRef]
  73. Young, A.; Boyle, T.; Brown, T. The population genetic consequences of habitat fragmentation for plants. Trends Ecol. Evol. 1996, 11, 413–418. [Google Scholar] [CrossRef] [PubMed]
  74. Le Corre, V.; Bellanger, S.; Guillemin, J.-P.; Darmency, H. Genetic diversity of the declining arable plant Centaurea cyanus: Population fragmentation within an agricultural landscape is not associated with enhanced spatial genetic structure. Weed Res. 2014, 54, 436–444. [Google Scholar] [CrossRef]
  75. Marshall, E.J.P. The impact of landscape structure and sown grass margin strips on weed assemblages in arable crops and their boundaries. Weed Res. 2009, 49, 107–115. [Google Scholar] [CrossRef]
  76. Listl, D.; Reisch, C. Genetic variation of Sherardia arvensis L.—How land use and fragmentation affect an arable weed. Biochem. Syst. Ecol. 2014, 55, 164–169. [Google Scholar] [CrossRef]
Figure 1. Geographical distribution of collection sites of Anagallis foemina and Anagallis arvensis in south-eastern Poland: Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU) (ATPOL). Sample names specified in Table 1.
Figure 1. Geographical distribution of collection sites of Anagallis foemina and Anagallis arvensis in south-eastern Poland: Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU) (ATPOL). Sample names specified in Table 1.
Agronomy 15 00003 g001
Figure 2. Aligned sequences of the trnL-F region of the chloroplast showing the presence/absence of deletions in randomly selected pairs of genotypes from the same location and different flower colours. *—20 nucleotides.
Figure 2. Aligned sequences of the trnL-F region of the chloroplast showing the presence/absence of deletions in randomly selected pairs of genotypes from the same location and different flower colours. *—20 nucleotides.
Agronomy 15 00003 g002
Figure 3. Band patterns across Anagallis L. populations collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU), Poland. No. Bands, number of different bands; No. Private Bands, number of bands unique to a single population; No. Bands Freq. ≥ 5%, number of different bands with a frequency ≥ 5%; No. LComm Bands (≤25%), number of locally common bands (Freq. ≥ 5%) found in 25% of the groups or fewer; No. LComm Bands (≤50%), number of locally common bands (Freq. ≥ 5%) found in 50% of the groups or fewer; uHe, unbiased expected heterozygosity [=(2N/(2N − 1)) * He]; r, red flower colour; b, blue flower colour.
Figure 3. Band patterns across Anagallis L. populations collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU), Poland. No. Bands, number of different bands; No. Private Bands, number of bands unique to a single population; No. Bands Freq. ≥ 5%, number of different bands with a frequency ≥ 5%; No. LComm Bands (≤25%), number of locally common bands (Freq. ≥ 5%) found in 25% of the groups or fewer; No. LComm Bands (≤50%), number of locally common bands (Freq. ≥ 5%) found in 50% of the groups or fewer; uHe, unbiased expected heterozygosity [=(2N/(2N − 1)) * He]; r, red flower colour; b, blue flower colour.
Agronomy 15 00003 g003
Figure 4. UPGMA dendrogram of 30 Anagallis L. genotypes collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU) based on ISSR and SRAP markers. The bootstrap value is indicated on nodes. Genotypes with red flowers are marked r; genotypes with blue flowers are marked b. Sample names are specified in Table 1.
Figure 4. UPGMA dendrogram of 30 Anagallis L. genotypes collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU) based on ISSR and SRAP markers. The bootstrap value is indicated on nodes. Genotypes with red flowers are marked r; genotypes with blue flowers are marked b. Sample names are specified in Table 1.
Agronomy 15 00003 g004
Figure 5. Principal coordinates 1 vs. 2 plotted for 30 Anagallis L. genotypes collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU), Poland, based on Dice similarity index values. Red symbols represent genotypes with red flowers; blue symbols represent genotypes with blue flowers.
Figure 5. Principal coordinates 1 vs. 2 plotted for 30 Anagallis L. genotypes collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU), Poland, based on Dice similarity index values. Red symbols represent genotypes with red flowers; blue symbols represent genotypes with blue flowers.
Agronomy 15 00003 g005
Figure 6. Estimated number of clusters of 30 Anagallis L. genotypes collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU), Poland, obtained for values of K ranging from 2 to 6 using ISSR and SRAP data based on ΔK.
Figure 6. Estimated number of clusters of 30 Anagallis L. genotypes collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU), Poland, obtained for values of K ranging from 2 to 6 using ISSR and SRAP data based on ΔK.
Agronomy 15 00003 g006
Figure 7. Graphic representation of structure of 30 Anagallis L. genotypes for K = 3. Genotypes with red flowers are marked _r; genotypes with blue flowers are marked _b. Different colours represent diverse genetic backgrounds; LU, Lublin Upland, Poland; VP, Volhynian Polesie, Poland; VU, West Volhynian Upland, Poland. Sample names are specified in Table 1.
Figure 7. Graphic representation of structure of 30 Anagallis L. genotypes for K = 3. Genotypes with red flowers are marked _r; genotypes with blue flowers are marked _b. Different colours represent diverse genetic backgrounds; LU, Lublin Upland, Poland; VP, Volhynian Polesie, Poland; VU, West Volhynian Upland, Poland. Sample names are specified in Table 1.
Agronomy 15 00003 g007
Table 1. Physico-geographical origin of Anagallis L. genotypes used in this study.
Table 1. Physico-geographical origin of Anagallis L. genotypes used in this study.
No.Geographical CoordinatesSample NamePhysico-Geographical Region
LongitudeLatitudeA. arvensisA. foemina
123.366051.1822VU/1_rVU/1_bWest Volhynian Upland (VU)
223.579751.1517VU/2_rVU/2_b
323.531051.1160VU/3_rVU/3_b
423.518951.1145VU/4_rVU/4_b
523.530251.1152VU/5_rVU/5_b
623.444851.0983VU/6_rVU/6_b
723.427351.0825VU/7_r
823.391351.0585VU/8_r
923.702050.9739VU/9_r
1023.498350.4312VP/1_rVP/1_bVolhynian Polesie (VP)
1123.519150.4312VP2_rVP2_b
1223.540550.4100VP/3_rVP/3_b
1323.544550.4033VP/4_rVP/4_b
1423.586750.3677VP/5_rVP/5_b
1523.455450.4942VP/6_r
1622.010251.1113LU/1_rLU/1_bLublin Upland (LU)
1722.055951.1050LU/2_rLU/2_b
Table 2. List of ISSR and SRAP primers used in this study and values of markers’ polymorphism indices.
Table 2. List of ISSR and SRAP primers used in this study and values of markers’ polymorphism indices.
Name of ISSR PrimerSequence
5′→3′
Name of SRAP PrimerSequence
5′→3′
sr14(GA)7YGFsrap13_epCGAATCTTAATGGCGATA
sr16(GA)8CFsrap17_epGATCCAGTTATGGCGCAC
sr31(AG)8YCMe1TGAGTCCAAACCGGATA
sr36(AC)8CGMe2TGAGTCCAAACCGGAGC
sr37(AC)8CMe3TGAGTCCAAACCGGAAT
sr58(ACC)6TMe4TGAGTCCAAACCGGACC
Em1GACTGCGTACGAATTAAT
Em2GACTGCGTACGAATTTGC
Em5GACTGCGTACGAATTAAC
Table 3. Values of markers’ polymorphism indices estimated based on ISSRs.
Table 3. Values of markers’ polymorphism indices estimated based on ISSRs.
NameTNF 1NPFPIC
sr1426250.366
sr1629290.369
sr3134330.372
sr3623230.403
sr3732310.364
sr5830270.281
Mean29280.360
1 TNF, total number of fragments; NPF, number of polymorphic fragments; PIC, polymorphism information content.
Table 4. Values of markers’ polymorphism indices estimated based on SRAPs.
Table 4. Values of markers’ polymorphism indices estimated based on SRAPs.
Primer PairTNF 1NPFPIC
Fsrap13_ep-Em111100.344
Fsrap17_ep-Em120180.366
Fsrap13_ep-Em218140.322
Fsrap13_ep-Em525250.292
Fsrap17_ep-Em522220.394
Me1-Em126260.343
Me1-Em522210.307
Me2-Em21680.135
Me3-Em227270.345
Me4-Em117160.322
Me4-Em226260.329
Fsrap17_ep-Em227270.309
Mean21200.317
1 TNF, total number of fragments; NPF, number of polymorphic fragments; PIC, polymorphism information content.
Table 5. The within-group genetic diversity of 30 Anagallis L. genotypes collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU) based on ISSR and SRAP data.
Table 5. The within-group genetic diversity of 30 Anagallis L. genotypes collected in Lublin Upland (LU), Volhynian Polesie (VP), and West Volhynian Upland (VU) based on ISSR and SRAP data.
GroupOriginNo. of BandsPercentage of Polymorphic LociNo. of Private BandsUnbiased Expected Heterozygosity (uHe)
1VU, Poland red 22224.75%50.084
2VP, Poland red24133.91%10.118
3LU, Poland red19015.10%10.083
4VU, Poland blue1807.43%390.030
5VP, Poland blue18511.14%220.047
6LU, Poland blue17915.84%80.087
Mean20018.03%12.670.075
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kwiecińska-Poppe, E.; Sowa, S.; Lech, J.; Haliniarz, M.; Paczos-Grzęda, E. Genetic Structure of Endangered Species Anagallis foemina Mill. and Abundant Weed Anagalis arvensis L. Occurring in Segetal Habitats in South-Eastern Poland. Agronomy 2025, 15, 3. https://doi.org/10.3390/agronomy15010003

AMA Style

Kwiecińska-Poppe E, Sowa S, Lech J, Haliniarz M, Paczos-Grzęda E. Genetic Structure of Endangered Species Anagallis foemina Mill. and Abundant Weed Anagalis arvensis L. Occurring in Segetal Habitats in South-Eastern Poland. Agronomy. 2025; 15(1):3. https://doi.org/10.3390/agronomy15010003

Chicago/Turabian Style

Kwiecińska-Poppe, Ewa, Sylwia Sowa, Joanna Lech, Małgorzata Haliniarz, and Edyta Paczos-Grzęda. 2025. "Genetic Structure of Endangered Species Anagallis foemina Mill. and Abundant Weed Anagalis arvensis L. Occurring in Segetal Habitats in South-Eastern Poland" Agronomy 15, no. 1: 3. https://doi.org/10.3390/agronomy15010003

APA Style

Kwiecińska-Poppe, E., Sowa, S., Lech, J., Haliniarz, M., & Paczos-Grzęda, E. (2025). Genetic Structure of Endangered Species Anagallis foemina Mill. and Abundant Weed Anagalis arvensis L. Occurring in Segetal Habitats in South-Eastern Poland. Agronomy, 15(1), 3. https://doi.org/10.3390/agronomy15010003

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop