Engineered Rhizobia with Trehalose-Producing Genes Enhance Peanut Growth Under Salinity Stress

Abstract

The aggravation of soil salinization has become one of the major factors that threaten crop growth and yield. Rhizobia, as an important biological nitrogen-fixing microorganism, can establish symbiotic relationships with legumes to improve their nitrogen-fixing ability and stress tolerance. Trehalose, a non-reducing disaccharide that is widely found in bacteria, fungi, and plants, can protect cellular structures and maintain the viability of cells under stress conditions. However, it remains to be determined whether the endogenous trehalose level in rhizobia could affect its stress tolerance and nitrogen-fixing capabilities. In this study, we constructed four engineered rhizobial strains to examine the effects of the overexpression and knockout of the trehalose synthesis genes otsA/otsB in the rhizobium strain CCBAU25338 on its salt tolerance and nitrogen-fixing capacity. The results indicated that the overexpression of otsA, rather than the otsB gene, significantly enhanced both the stress tolerance and nitrogen-fixing abilities of the strains. Furthermore, the inoculation of otsA-overexpressing recombinant cells leads to greater agronomic traits in the host plant’s peanuts under salinity conditions. We hope our findings may serve as valuable references for the future development of efficient and superior engineered rhizobial strains for peanut cultivation.

1. Introduction

The peanut (Arachis hypogaea L.) is a globally significant food and oil crop. China is one of the world’s leading peanut producers. In 2022, China’s peanut cultivation area reached approximately 4.684 million hectares, yielding 18.3295 million tons of peanuts, which accounted for 50.16% of the total production of oil crops [1]. Peanut is a moderately salt-tolerant crop with considerable drought resistance, as well as a high tolerance of and adaptability to suboptimal soil conditions. Peanut cultivation requires relatively low inputs while offering significant economic returns [2]. However, the peanut industry is currently confronted with substantial challenges because of climate change, pest and disease pressures, suboptimal agricultural practices, and soil salinization [3].

Recent studies have increasingly explored the ability of peanut plants to withstand high-salinity conditions. Under conditions of elevated salinity, peanuts exhibit the significant accumulation of soluble sugars and proline. These osmolytes alleviate salt-induced physiological damage [4]. Further studies have identified several key genes, such as Sodium-hydrogen Exchanger (NHX), Salt Overly Sensitive (SOS), and High-affinity Potassium Transporter (HKT), that regulate processes like sodium ion transport and water balance control [5]. Furthermore, the roots of peanuts have special bumps called root nodules which can help the rhizobia to fix the nitrogen and which also play a crucial role in shaping host plants’ salt tolerance [6]. Under salinity conditions, leguminous plants experience nutrient supply limitations in their root systems. This deficiency disrupts the production of key components in the root nodules, including leghemoglobin, citrate, carbon sources, and organic nitrogen. Consequently, the impaired synthesis of these essential compounds reduces the nodules’ capacity to sustain rhizobia, ultimately leading to decreased nitrogen fixation efficiency [1]. It has been found that salt stress disrupts soybean nodule development by impairing cellular functions. During the early stage of nodule formation, salt exposure reduces the respiration and metabolic activity in nodule cells. This triggers the burst of hydrogen peroxide (H₂O₂), which damages the structure and function of the cell membrane, ultimately compromising the nodule performance [7]. On the other hand, salt stress also disrupts the symbiotic relationship between plants and nitrogen-fixing bacteria. The population sizes and distribution of rhizobia, as well as their nitrogen fixation efficiencies, are significantly reduced under high-salinity conditions. Research shows that salt stress acidifies root nodules (lowers pH) and increases the amount of reactive oxygen species (ROS) in the plant’s tissues. These changes trigger membrane damage through lipid peroxidation [8].

Trehalose is a non-reducing disaccharide. It has strong hydrophilicity and chemical stability. This compound is widely found in bacteria, fungi, and plants. Under stress conditions, it protects cellular structures and maintains essential functions by stabilizing biomolecules and regulating their metabolism [9]. Trehalose accumulation enhances the stress resilience of plants by maintaining their cell membrane integrity and shielding mitochondria from dehydration-induced and oxidative damage under stressful environments [10]. Trehalose functions as both a signaling molecule and a stress regulator in biological systems. In plants, it modulates their growth, development, and stress adaptation through trehalose-6-phosphate (T6P), its metabolic precursor. T6P regulates these processes by inhibiting the SnRK1 kinase activity, thereby coordinating the stress responses of the plant with its developmental programs [11]. These mechanisms establish trehalose as a key regulator of plant abiotic stress tolerance. Beyond plants, trehalose exhibits microbial applications—studies have demonstrated that 2% trehalose solutions significantly promote the proliferation of Lactobacillus plantarum [12].

Given trehalose’s diverse protective functions, revealing its method of biosynthesis is key to unlocking biotech applications for trehalose. The otsA and otsB genes are essential for the biosynthesis of trehalose in plants and bacteria. The otsA gene encodes trehalose-6-phosphate synthase, converting UDP-glucose and glucose-6-phosphate into trehalose-6-phosphate, while otsB encodes a phosphatase that hydrolyzes this intermediate to produce trehalose [13]. The overexpression of the otsA and otsB genes could elevate the trehalose levels in and enhance the stress resilience of many species. For instance, transgenic Oryza sativa with upregulated otsA and otsB expression exhibits a significantly improved salt tolerance [14]. Similar results were also reported in otsA-/otsB-overexpressing Escherichia coli strains, which have increased intracellular trehalose production and a better survival performance under acidic or low-temperature environment [15]. These findings underscore the broad biotechnological potential of otsA/otsB manipulation across biological systems. However, the functional significance of otsA/otsB in rhizobia remains unexplored. While these genes are well-characterized in plants and free-living bacteria, their impacts on the stress adaptation and symbiotic nitrogen fixation of rhizobia are unexplored. In this study, we engineered the peanut-nodulating rhizobium Mesorhizobium sp. CCBAU25338 by inducing otsA/otsB overexpression and knockout. We hope these findings may serve as important references for the future development of efficient and superior engineered rhizobial strains for peanut cultivation.

2. Materials and Methods

2.1. Plant Material and the Rhizobial Strains

The slow-growing rhizobial strain Mesorhizobium sp. CCBAU25338 and its derivatives were used for symbiotic studies with peanut (Arachis hypogaea cv. ’Shanhua 15′, collected from Shangdong Province).

2.2. Construction of Engineerd Rhizobial Strains

Genetic manipulation of otsA/otsB in CCBAU25338 strain was systematically performed. Genomic DNA extracted via CTAB method [16] provided otsA/otsB templates for cloning. Two expression vectors (pBBRIMCS-5-otsA/B) were constructed using the broad-host-range plasmid pBBRIMCS-5 with Lac promoter control [17]. For gene knockout, suicide vectors (pk18mobSacB-otsA/B-Kan) enabled homologous recombination-mediated gene replacement [18]. These constructs were introduced into rhizobia via optimized heat-shock transformation. Successful mutants were selected based on antibiotic resistance, verified by PCR and sequencing.

2.3. Determination of Trehalose Content and Salt Tolerance in Engineerd Rhizobial Strains

Trehalose content was measured separately in engineered rhizobia under normal and saline conditions (50 mM NaCl). Trehalose levels in engineered rhizobial cells were determined by using a commercial detection kit with anthrone-based colorimetric microassay (Solarbio BC0330, Solarbio, Hangzhou, China). Samples (cells, tissues, or serum) were homogenized, extracted, and centrifuged. Supernatants or trehalose standards (0–10 mg/mL) were mixed with anthrone-sulfuric acid reagent and heated at 95 °C for 10 min, and absorbance was measured at 620 nm. Concentrations were calculated via standard curve linear regression and normalized to sample weight, protein content, or cell count. For detailed procedures, refer to the manufacturer’s kit manual. Salt tolerance was assessed on YMA plates containing 0, 50, 100, or 150 mM NaCl. Recombinant strains were cultured at 30 °C, with colony growth photographed at 12 h intervals.

2.4. Methods of Pot Experiment, Rhizobial Inocualtion and Salt Treatment

The pot experiment employed sterilized peanut seeds and growth substrates (10–30 mm, PINDSTRUP, Ryomgaard, Denmark). Three seeds were sown per pot (30 cm diameter) at depths of 3–4 cm. Three salinity levels (0, 150, and 300 mM) were used and five bacterial treatments, which were mock-inoculation (CK), inoculation of CCBAU25338 strain (WT), inoculation of otsA or otsB gene-overexpressing strains (O-otsA/O-otsB), and inoculation of the strains with otsA or otsB gene knocked out (∆otsA/∆otsB), were performed, with six replicates per combination (126 pots total). Pre-germination irrigation was applied with 100 mL water per pot at three-day intervals. Post-germination watering maintained this schedule, and was supplemented weekly by 500 mL low-nitrogen nutrient solution per pot. Rhizobial inoculations were performed at 10 days post-germination: bacterial suspensions (1 mL, OD600 = 0.2) of different rhizobial strains were mixed with the growth substrates in each designated pot (18 pots per strain, 3 salinity levels × 6 replicates). A total of 1 mL of sterile water was mock-inoculated as control. All peanut plants were cultivated in a greenhouse with natural sunlight. Irrigation with different NaCl solutions was initiated 15 days after inoculation, establishing a dual-factor (bacteria × salinity) experimental system with six biological replicates per treatment combination.

2.5. qRT-PCR Analysis of Nodular Genes and Nitrogen-Fixing Genes in Peanut Root Nodules

Gene expression analysis in peanut root nodules was conducted as follows. The sequences of six crucial genes associated with nodulation (Castor, CCaMK, and SYMRK) and nitrogen-fixation (AMT1.1, NRT1.1, and NRT1.2) were retrieved from GenBank. The primers for qRT-PCR analysis were designed by BioEdit software (v7.2.6.1), respectively. Forty days after inoculation (which is 25 days after the salt treatment), the root nodules from the peanut plants were harvested for RNA isolation (ER501 RNA kit, Easen Biotechnology, Hangzhou, China). cDNA was generated via reverse transcription [19]. The qRT-Gene expression was quantified via 2^−ΔΔCT method using ADH (LOC112715878) as the reference gene. The primers used for qRT-PCR are listed in

Table 1. Primer sequences for qRT-PCR analysis.

Id of Primers	Sequence 5′→3′
AMT1.1-FP	GTTGGCGGCAAAGGTGAAG
AMT1.1-RP	TAAGGCCTCTCCGATCCGTA
NRT1.1-FP	AGGTCTGTGGATGCTCCTA
NRT1.1-RP	GATGGAAATGAGAAGCAGC
NRT1.2-FP	AGGTTTTGTACCGTAGACT
NRT1.2-RP	CTTCAATCCGTCGATAGCTC
Castor-FP	CGCACTCGCGACGTTGA
Castor-RP	TCGCCCAGTAATGTGGAACTC
SYMRK-FP	CCTGGTGCCTCTTCTTGGTT
SYMRK-RP	TTCTCTTTGCAGGTTCTCCATA
CCaMK-FP	CCTCTTGGAAGTGATGCGGT
CCaMK-RP	CCGGATCTGTCCCTTCCTGA
LOC-FP	CAGGATTTGCCGGTGATGATG
LOC-RP	TCTGTTGGCCTTCGGGTTGAG

.

2.6. Determination of Peanut Nitrogenase Activity

Nitrogenase activity in peanut plants was quantified at 25 days post-inoculation. Using the Plant Nitrogenase Immunoassay Kit (TW13191, Tongwei Biotechnology, Hangzhou, China), measurements were conducted following standardized protocols to compare different rhizobial strains.

2.7. Determination of Peanut Leaf Photosynthesis and Agronomic Traits After Inoculation of Different Engineered Rhizobial Strains

Photosynthetic and growth parameters were systematically measured 30 days post-inoculation. Leaf net photosynthesis rate (Pn) was determined using a portable photosynthesis system (HM-GH80, Hengmei Co., Hangzhou, China). Plant height, fresh/dry biomass, and root/shoot ratios were recorded after whole-plant harvesting. All measurements included six biological replicates per treatment group. Data were presented as mean of six replicates and compared with one-way ANOVA in SPSS software (Version 22) (p < 0.05).

2.8. Determination of Antioxidant Oxidase (SOD, POD) Activities, MDA and Proline Contents in Peanut

Key physiological indices were measured using standardized methods. Superoxide dismutase (SOD) activity was analyzed by nitroblue tetrazolium reduction [20], peroxidase (POD) by guaiacol oxidation [2], and malondialdehyde (MDA) content via thiobarbituric acid reaction [21]. Proline levels were determined using acidic ninhydrin assay [22].

3. Results

3.1. Construction of ostA and ostB Overexpression/Knockout Strains

To elucidate the function of trehalose metabolism in the salt tolerance and nitrogen fixation of rhizobia, we constructed otsA- and otsB-overexpressing and knockout mutants using the broad-host-range plasmid pBBRIMCS-5. Two recombinant plasmids (pBBRIMCS-5-otsA and pBBRIMCS-5-otsB) were successfully transformed into rhizobial strain CCBAU25338 through optimized heat-shock transformation (Figure S1). qRT-PCR quantification demonstrated significant transcriptional upregulation: the otsA expression level was 13-fold higher in the otsA-overexpressing strain (O-otsA) than in wild-type controls. Similarly, the expression level of otsB in the otsB-overexpressing strain (O-otsB) showed more than an 11-fold increase compared to that of the control (Figure 1a).

To establish the gene knockout models, we constructed ΔotsA and ΔotsB mutant strains through allelic replacement using the suicide vector pk18mobSacB. Two disruption cassettes (pk18mobSacB-otsA::Kan and pk18mobSacB-otsB::Kan) were generated for targeted homologous recombination in the wild-type strain (Figure S2). Following the transformation of the strains via our optimized protocol, qRT-PCR analysis confirmed the complete transcriptional silencing of otsA and otsB in the respective mutants (Figure 1b).

Because trehalose metabolism, governed by otsA and otsB, constitutes a conserved stress adaptation mechanism across different organisms, we then tested the salt tolerance of the engineered strains. As is presented in Figure 2a, all engineered strains exhibited comparable growth profiles across 1–50× dilutions after 6-day incubation under non-stressed conditions (0 mM NaCl). However, both the ΔotsA and ΔotsB mutant strains showed growth arrest beyond 2× dilution, whereas the wild-type and O-otsB strains tolerated up to 5× dilution on a YMA plate with 50 mM NaCl (Figure 2b). In contrast, O-otsA maintained viability at 10× dilution (Figure 2b). This advantage was amplified under 100 mM NaCl: O-otsA sustained its growth at 10× versus the 5× that was obtained for controls, while the ΔotsA mutants failed beyond 1× (Figure 2c). Under the 150 mM NaCl condition, only O-otsA demonstrated detectable colonies up to 5× dilution (Figure 2d). These findings establish otsA overexpression, rather than otsB overexpression, as the dominant determinant of the salt tolerance of rhizobia.

We took the above rhizobium liquid that was cultured for 5 days and conducted trehalose content analysis. Metabolite quantification revealed that the O-otsA cells accumulated more trehalose, showing 1.5-fold (p < 0.05, n = 6) and 65% (p < 0.05, n = 6) elevations over the wild-type (WT) cells under 0 and 50 mM NaCl conditions, respectively (Figure 3). In contrast, the O-otsB strains exhibited no significant trehalose increase compared to the WT controls for all conditions. However, both the ΔotsA and ΔotsB mutants displayed severely compromised trehalose contents, with ΔotsA/ΔotsB showing 80% (p < 0.05, n = 6) and 50% (p < 0.05, n = 6) reductions, respectively. Notably, the ΔotsA and ΔotsB mutants showed lower differences in trehalose levels at all conditions (p < 0.05, n = 6).

3.2. Analysis of Agronomic Traits in Peanuts Inoculated with Engineered Rhizobial Strains

The observed agronomic traits during the 40-day nitrogen fixation phase (25-day salt exposure in pot experiment) revealed a distinct phenotype under salt stress. Under moderate salt stress (150 mM NaCl), the peanuts inoculated with the engineered rhizobia all produced significantly more pods than the mock-inoculated controls (CKs) (Figure 4). The ΔotsA and ΔotsB (p < 0.05, n = 6) mutants exhibited equivalent pod numbers to the wild-type (WT) under normal conditions but showed significant pod reductions (22–25%) under moderate salinity (p < 0.05, n = 6). All plants succumbed at 300 mM NaCl, preventing pod quantification.

In the analysis of photosynthesis, all peanuts that were inoculated with engineered rhizobial strains showed 18–24% greater photosynthetic performance than CK both at 0 and 150 mM NaCl treatment (

Table 2. Leaf photosynthesis and agronomy traits of peanuts inoculated with different engineered strains.

Salt Concentration	Strain	Net Photosynthetic Rate (μmol/m2/s)	Average Plant Height (cm)	Average Fresh Weight (g)	Average Dry Weight (g)
0 mM	CK	16.81 b	13.31 b	12.13 a	4.52 b
	WT	22.39 a	16.90 a	17.01 ab	6.81 a
	O-otsA	23.63 a	16.52 a	18.10 a	7.50 a
	O-otsB	23.81 a	16.01 a	15.89 bc	7.34 a
	ΔotsA	24.04 a	16.60 a	14.34 c	6.90 a
	ΔotsB	22.41 a	15.90 a	14.77 c	6.77 a
150 mM	CK	13.66 b	9.50 e	7.17 c	3.78 b
	WT	19.14 a	15.60 b	11.09 a	5.49 ab
	O-otsA	19.64 a	17.80 a	12.05 a	6.03 a
	O-otsB	18.88 a	15.00 bc	10.88 ab	5.57 ab
	ΔotsA	18.82 a	12.00 d	10.59 ab	5.10 ab
	ΔotsB	18.59 a	13.70 c	9.29 b	4.89 ab
300 mM	CK	8.91 c	6.15 d	4.59 c	1.53 b
	WT	11.36 b	10.00 bc	6.79 b	3.24 ab
	O-otsA	14.50 a	11.87 a	8.37 a	4.57 a
	O-otsB	11.32 b	10.98 ab	6.18 bc	3.53 a
	ΔotsA	10.93 b	9.12 c	5.36 bc	2.91 ab
	ΔotsB	11.87 b	8.98 c	5.17 bc	2.98 ab

Data are presented as mean of six experimental replicates and marked with different characters if they are statistically different (p < 0.05, n = 6). The statistical significance of the data was derived from comparisons within each individual salt concentration condition.

). Notably, in the 300 mM NaCl treatment group, the peanuts inoculated with the O-otsA strain achieved 27.2% greater Pn than thef WT (p < 0.05, n = 6), indicating enhanced photosynthetic resilience under lethal salinity.

As is shown in Table 2, the engineered rhizobial strains exhibited consistently improved growth metrics across all NaCl levels. All rhizobial strains, including CCBAU25338, O-otsA, O-otsB, ΔotsA, and ΔotsB (p < 0.05, n = 6), exhibited an enhanced plant height (12–15%) and biomass (20–28%) versus CK. For the 300 mM NaCl treatment, O-otsA inoculation increased the plant height by 18.7% compared to WT, while the ΔotsA and ΔotsB mutants (p < 0.05, n = 6) displayed 8.8% and 10.2% reductions, respectively (p < 0.05, n = 6). These data confirm otsA genes as critical enhancers of symbiotic performance due to carrying out coordinated osmotic regulation and carbon metabolism under salt stress.

3.3. Analysis of the Growth of Peanut Root Nodules and Enzyme Activity

The symbiotic nitrogen fixation efficiency of the strains was assessed through nodule quantification across different NaCl levels (Figure 5). Under normal (0 mM NaCl) and moderate salinity (150 mM NaCl), the rhizobia-inoculated plants exhibited significantly higher nodule counts than the mock-inoculated controls (CKs). No inter-strain differences occurred among the rhizobial variants under these conditions. At 300 mM NaCl treatment, the rhizobial inoculation (both WT and engineered strains) resulted in elevated nodule numbers versus CK, with the O-otsA strain showing a 30% increase over the wild-type (WT) (p < 0.05, n = 6). The O-otsB inoculation did not significantly alter the nodule count compared to the WT. Conversely, the ΔotsA and ΔotsB strains caused 30% nodule reduction versus the WT (p < 0.05, n = 6).

To further determine the capacities of the engineered rhizobial strains to fixate nitrogen to their host plants, we assessed the nitrogenase activity of the obtained peanuts (

Table 3. Analysis of the activities of nitrogenase and anti-oxidative enzymes.

Salt Concentration	Strain	Nitrogenase Activity (U/g)	SOD Activity (U/g)	POD Activity (U/g)	MDA Content (mol/g)	Proline Content(μg/g)
0 mM	CK	15.79 c	72.03 a	4.82 b	2.70 a	69.80 a
	WT	25.52 a	78.92 a	5.01 b	2.55 a	64.50 bc
	O-otsA	25.03 a	68.13 a	7.94 a	2.47 a	65.10 b
	O-otsB	24.90 a	74.78 a	5.63 b	2.44 a	62.80 c
	ΔotsA	23.00 b	75.66 a	5.68 b	2.52 a	64.10 bc
	ΔotsB	22.61 b	70.24 a	7.69 a	2.51 a	63.20 c
150 mM	CK	15.78 b	148.12 b	10.20 c	10.00 a	80.30 a
	WT	15.69 b	151.98 b	14.80 b	7.30 cd	75.80 b
	O-otsA	18.61 a	161.67 a	17.69 a	5.63 e	69.80 d
	O-otsB	16.54 b	138.44 c	15.65 b	6.11 de	72.00 c
	ΔotsA	16.02 b	125.39 d	14.34 b	9.22 ab	72.50 c
	ΔotsB	16.00 b	134.61 cd	14.90 b	8.20 bc	71.90 c
300 mM	CK	7.52 a	180.10 d	15.21 e	25.21 a	104.80 a
	WT	14.68 a	266.39 b	23.08 b	15.18 c	95.70 a
	O-otsA	16.28 a	281.69 a	28.37 a	9.27 e	84.30 b
	O-otsB	14.73 a	250.22 c	20.32 c	11.80 d	94.00 a
	ΔotsA	11.83 b	178.01 d	19.71 c	20.01 b	97.50 a
	ΔotsB	11.90 b	186.65 d	17.20 d	19.68 b	100.90 a

Data are presented as mean of six experimental replicates and marked with different characters if they are statistically different (p < 0.05, n = 6) The statistical significance of the data was derived from comparisons within each individual salt concentration condition.

). No activity differences occurred among the strains under normal growth conditions. At 150 mM NaCl treatment, the O-otsA-inoculated peanut roots showed significantly enhanced nitrogenase activity versus the other strains (p < 0.05, n = 6), while the O-otsB, ΔotsA, and ΔotsB (p < 0.05, n = 6) variants maintained baseline activity levels. This demonstrates that otsA overexpression specifically enhances the nitrogen fixation capacity of rhizobia under ionic stress.

The activities of the superoxide dismutase (SOD), peroxidase (POD), and malondialdehyde (MDA) content in the peanuts under different salt levels are shown in Table 3. Under non-saline conditions, the SOD and POD activities, as well as the MDA content, did not significantly differ between the rhizobia-inoculated plants and mock-inoculated controls (p > 0.05, n = 6). However, under 150 and 300 mM NaCl conditions, the rhizobia-inoculated plants exhibited significantly increased SOD and POD activities, along with a marked reduction in their MDA contents (p < 0.05, n = 6), suggesting that rhizobial inoculation enhances antioxidant enzyme production to mitigate salt stress. Under the 300 mM NaCl treatment, the peanuts inoculated with the O-otsA strain showed 6% and 21.6% higher SOD and POD activities, as well as a 38.8% reduction in MDA content (p < 0.05, n = 6), compared to those inoculated with the wild-type strain (p < 0.05, n = 6). In contrast, the plants inoculated with the ΔotsA and ΔotsB strains displayed 13.2% and 15.8% reductions in their SOD and POD activities, respectively (p < 0.05, n = 6), alongside a 12.3% increase in their MDA contents (p < 0.05, n = 6). These findings demonstrate that the otsA genes in rhizobia may play a beneficial role in enhancing the antioxidant enzyme production in peanuts under salt stress.

The proline content of plants serves as a reliable indicator of their adaptability to adversarial environments. In this study, we found that the rhizobia-inoculated plants had significantly lower proline contents compared to the uninoculated controls (CKs) (Table 3, p < 0.05, n = 6). Notably, peanuts inoculated with the O-otsA strain exhibited approximately 12% lower proline levels than those inoculated with the wild-type (WT) strain (p < 0.05, n = 6). These results suggest that rhizobial inoculation, particularly with the O-otsA strain, enhances the stress adaptation in peanuts by reducing their proline accumulation (Table 3).

3.4. qRT-PCR Analysis of Nodulation and Nitrogen Fixation Genes in Peanut Roots

The expression profiles of key peanut nodulation-related genes (Castor, CCaMK, SYMRK) and nitrogen fixation-associated genes (AMT1.1, NRT1.1, NRT1.2) were quantitatively analyzed via qRT-PCR, with the peanut ethanol dehydrogenase (ADH) coding gene LOC112715878 serving as the internal reference. As illustrated in Figure 6, under three distinct salt stress conditions (0, 50, 100, and 150 mM NaCl), a marked upregulation exceeding 200% (p < 0.05, n = 6) was observed in both the nodulation and nitrogen-fixing gene expression levels in the rhizobium-inoculated plants compared to uninoculated controls (CKs). Notably, the engineered rhizobium strain O-otsA demonstrated enhanced functionality under salt stress, exhibiting a ≥ 15% increase (p < 0.05, n = 6) in nodulation-related gene expression relative to the wild-type strain CCBAU25338 (WT). In contrast, significant downregulation (~20% reduction, p < 0.05, n = 6) of both the nitrogen-fixation and nodulation genes was detected in the plants inoculated with the mutant strains ΔotsA and ΔotsB, which is consistent with their impaired salt tolerance. Interestingly, the overexpression strain O-otsB showed no statistically significant alterations in its gene expression profiles compared to the WT, aligning with its neutral phenotypic response to salinity. These transcriptional dynamics corroborate the physiological salt tolerance hierarchy observed across the rhizobium genotypes (O-otsA > WT ≈ O-otsB > ΔotsA ≈ ΔotsB), thereby establishing a molecular basis for the differential salt adaptation mechanisms in symbiotic nitrogen fixation.

4. Discussion

The gap between the supply and demand for legume crops has been steadily widening. The symbiotic nitrogen fixation process involving leguminous plants and rhizobia offers an economically viable and ecologically sustainable alternative to traditional chemical fertilizers. Thus, the utilization of rhizobia to enhance the yield and stress resistance of peanuts has garnered significant attention in recent years [23]. Rhizobia are soil bacteria that form symbiotic relationships with legumes, facilitating biological nitrogen fixation, which is crucial for plant growth and productivity [24]. This symbiotic relationship not only improves the nitrogen availability of plants but also enhances their resilience to various environmental stresses. One of the key studies in this area highlights the phenotypic and genotypic characterization of rhizobia isolated from peanut root nodules in Moroccan soils. This research provides insights into the diversity of rhizobial strains and their potential applications in improving peanut crop yields, especially in saline and acidic soils [25]. Furthermore, the role of rhizobia in improving the ecological resource-use efficiency of legumes, such as the endangered Kerstings groundnut, has been explored. Inoculation with specific Bradyrhizobium strains has been shown to significantly impact the growth, nitrogen fixation, and grain yield of plants [26]. Additionally, advancements in molecular biology have opened new avenues for improving biological nitrogen fixation by rhizobia. The development of genetically modified rhizobial strains with enhanced nitrogen fixation efficiencies and competitiveness under unfavorable conditions is a promising strategy [27]. It was reported that modified Azotobacter vinelandii could release elevated levels of ammonia under specific conditions, thereby promoting the growth of microalgae and cucumbers without the need for nitrogen fertilizers [28]. Microbial genetic modification is a promising approach to enhancing the salt tolerance of plants, addressing global soil salinization challenges in agriculture and environmental science. For instance, overexpressing Mrp anti-transporters in the cyanobacterium Synechococcus elongatus UTEX 2973 boosted its salt tolerance by 57.7% under 0.4 M NaCl, improving its growth and shedding light on cyanobacterial salt-resistance mechanisms [29]. Similarly, genetically engineered plant growth-promoting bacteria (PGPB) can strengthen the resilience of plants in saline environments by producing growth hormones, volatile organic compounds, and nitrogen-fixing agents [30,31]. Additionally, studies on soil microbes in China’s Yuncheng Salt Lake demonstrated that upregulating genes for Na+/H+ anti-transporters and betaine/proline transport systems enhances the microbial survival in high-salinity soils [32]. These advancements underscore the potential of genetic engineering to develop robust salt-tolerant microbes, offering sustainable solutions for improving crop productivity and rehabilitating saline-affected ecosystems. In this study, we genetically modified rhizobia by constructing strains that overexpress and knockout the trehalose synthesis genes otsA and otsB. We found the salt tolerance, as well as the nitrogen fixation capacities, increased remarkably in the plants inoculated with the O-otsA strain (Figure 2 and Figure 5).

Trehalose, a versatile non-reducing disaccharide, serves as a critical stress protectant in both plants and microorganisms, with its biosynthesis pathways offering unique insights into stress adaptation mechanisms. In plants, trehalose synthesis is mediated by trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP), enzymes that are dynamically regulated by environmental stresses to enhance resilience. For instance, in Arabidopsis thaliana, overexpression of the AtTPPI gene strengthens the drought tolerance of the plant by fine-tuning the stomatal closure, which optimizes the water use efficiency (WUE) and integrates trehalose metabolism with sugar signaling pathways to amplify abiotic stress responses [33,34]. Similarly, rice seedlings overexpressing OsTPS1 exhibit robust tolerance to low temperature, salinity, and drought through coordinated increases in their trehalose and proline levels, alongside the activation of stress-responsive genes such as OsLEA3 and OsDREB1A, all without compromising their growth phenotypes [35]. In tomatoes, exogenous trehalose application bypasses direct ABA accumulation but upregulates ABA signaling genes (e.g., SlAREB1 and SlNCED1), enhancing the plant’s drought resistance by reinforcing stomatal regulation and osmotic adjustment [36]. Parallel mechanisms exist in microbial systems, where the otsA and otsB genes form the OtsA/B pathway—a cornerstone of bacterial osmotic stress tolerance. In Escherichia coli, the deletion of otsA/B severely impairs the bacteria’s survival under hypertonic conditions, while the overexpression of these genes, coupled with trehalase inhibition by validamycin A, elevates its intracellular trehalose levels and stress resistance [37,38]. Remarkably, the Arthrobacter strain A3 exploits OtsA not only for trehalose biosynthesis but also as an osmotic sensor that dynamically adjusts the morphology of cells in fluctuating environments [39]. In the present study, we engineered rhizobial strains with either overexpressed or knockout otsA/otsB genes to evaluate their salt tolerance and their impact on symbiotic nitrogen fixation and stress tolerance in peanuts. The findings revealed that the overexpression of otsA significantly increased the trehalose content, whereas the knockout of either otsA or otsB resulted in decreased trehalose levels. Notably, the overexpression of otsB did not lead to any significant change in the trehalose content. Our analysis suggests that both genes are indispensable for trehalose synthesis in rhizobia, with otsA possibly functioning as a rate-limiting gene relative to otsB. These findings underscore the pivotal roles of otsA and otsB in stress responses and their potential applicability in agricultural and industrial contexts.

Biological nitrogen fixation is integral to agricultural production, particularly in the cultivation of leguminous crops. According to previous studies, the role of otsA and otsB in symbiotic relationships is also significant. In the Burkholderia–bean bug symbiosis, the otsA gene is crucial for the initial infection stage, providing resistance against osmotic stress encountered during the passage through the host’s midgut. Mutants lacking otsA exhibit reduced colonization of the host symbiotic organ, highlighting the gene’s importance in establishing and maintaining symbiotic associations [40]. In the context of peanuts, the application of rhizobial inoculants has demonstrated significant effects. Specifically, the overexpression of otsA genes substantially increased the expression levels of genes related to nodule formation and nitrogen fixation in peanuts, as illustrated in Figure 6. This indicates that the otsA genes positively influence the enhancement of peanut nodule formation and its symbiotic nitrogen fixation capabilities. Conversely, the knockout of the otsA/otsB genes did not markedly affect the nitrogen fixation capabilities of peanuts, which may be attributed to the inherently strong nitrogen fixation ability of the peanut variety utilized in this study. Compared to the non-inoculated control group (CK), inoculation with various rhizobial strains significantly enhanced the agronomic traits of peanuts, including the plant height, root length, dry weight, and fresh weight, under both normal and saline stress conditions, as shown in Figure 5. More specifically, under moderate salinity stress conditions (150 mM NaCl), the inoculation with O-otsA rhizobia resulted in a significant increase in the plant height of peanuts compared to the control group inoculated with the original CCBAU25338 strain (CK). In contrast, inoculation with the ΔotsA and ΔotsB (p < 0.05, n = 6) strains led to a significant decrease in plant height (Table 2). Under high-salinity-stress conditions (300 mM NaCl), the O-otsA strain significantly enhanced the plant height, dry weight, and nodule number of peanut roots relative to the control group, whereas these parameters were significantly reduced in the peanuts inoculated with the ΔotsA and ΔotsB (p < 0.05, n = 6) strains (Table 2). These findings align with previous studies on leguminous plants, such as Medicago sativa, which have demonstrated that the otsA/otsB genes are crucial for enhancing the stress tolerance and symbiotic nitrogen fixation ability of rhizobia under saline conditions [41].

The activity of antioxidant enzymes in a plant serves as a crucial indicator of its tolerance to stress [42]. In our investigation, the inoculation of various rhizobial strains did not significantly alter the activity of superoxide dismutase (SOD) or peroxidase (POD), nor the concentration of malondialdehyde (MDA), in the peanut plants under normal conditions when compared to the non-inoculated control group (Table 3). However, under conditions of moderate (150 mM NaCl) and high (300 mM NaCl) salinity stress, the activity of SOD and POD in the inoculated peanut plants increased significantly, while the MDA content decreased significantly. These findings are consistent with previous research, suggesting that rhizobial inoculation can enhance the activity of antioxidant enzymes in plants, thereby mitigating stress-induced damage [43]. Specifically, under moderate salinity stress conditions (150 mM NaCl), peanuts inoculated with the O-otsA strain exhibited a significant reduction in MDA content compared to those inoculated with the original CCBAU25338 strain, whereas peanuts inoculated with the ΔotsA and ΔotsB (p < 0.05, n = 6) strains showed a significant increase in MDA content. Under conditions of high salinity stress (300 mM NaCl), peanuts inoculated with the O-otsA strain exhibited a significant increase in their superoxide dismutase (SOD) and peroxidase (POD) activities, alongside a notable decrease in their malondialdehyde (MDA) content, compared to those inoculated with the original CCBAU25338 strain. Conversely, peanuts inoculated with the ΔotsA strain demonstrated a significant reduction in their SOD and POD activities and an increase in their MDA content (Table 3). These findings suggest that the overexpression of the otsA and otsB genes in rhizobia, which enhances the bacteria’s trehalose metabolic pathway, is advantageous for improving its symbiotic nitrogen fixation capability under saline stress conditions. Consequently, this indirectly enhances the salt tolerance of peanuts.

Nodules facilitate the conversion of atmospheric nitrogen gas into bioavailable amino nitrogen through the activity of rhizobia, while simultaneously supplying a carbon source to the rhizobia, thereby establishing a mutualistic symbiosis that enhances nitrogen fixation [44]. Consequently, both the quantity and quality of nodules serve as indicators of the efficacy of symbiotic nitrogen fixation. Under normal conditions, no significant differences were observed in the number of peanut nodules across various rhizobial treatments; however, variations in nodule numbers were observed in both the 150 and 300 mM NaCl conditions. Peanuts inoculated with the O-otsA strain exhibited a significant increase in their nodule number compared to those treated with other rhizobial strains (Figure 5), suggesting that the otsA gene possibly plays crucial roles in the salt tolerance of rhizobia. Nevertheless, it is important to acknowledge that this study was conducted under controlled greenhouse conditions using a sterilized soil substrate. In contrast, in the natural environment, where climatic conditions are variable and soil microbial communities are thriving [45], the effectiveness of engineered rhizobia may be affected. Therefore, further validation of these findings under field conditions is necessary.

5. Conclusions

This study reveals the differential roles of otsA and otsB in rhizobial trehalose metabolism, with otsA acting as the primary driver of trehalose biosynthesis and otsB potentially regulating pathway flux. The overexpression of otsA boosted the trehalose levels in peanuts by 1.5-fold under normal conditions and 65% under salt stress, conferring superior salt tolerance (survival at 150 mM NaCl) and symbiotic benefits to the peanuts, including 30% more nodules, 22% higher nitrogenase activity, and 38.8% lower oxidative damage under 300 mM NaCl compared to the wild-type strains. While otsB overexpression alone showed no trehalose accumulation, its knockout reduced the trehalose levels by 50%, suggesting complementary roles in maintaining metabolic equilibrium. Both gene knockouts impaired nodulation (30% reduction) and stress resilience, with otsA deficiency causing more severe impacts (80% trehalose loss). The findings highlight otsA as a prime target for engineering stress-tolerant rhizobia, while otsB may fine-tune trehalose-6-phosphate homeostasis to prevent metabolic toxicity. This dual-gene system offers a framework for developing salt-resistant biofertilizers to enhance the productivity of legumes in saline soils, warranting further exploration of otsB’s regulatory mechanisms and field validation of the engineered strains.