Evaluation of Rice Blast Resistance and R Gene Analysis in Japonica Rice Varieties Tested in the Anhui Region

Abstract

Rice blast caused by the ascomycete fungus Magnaporthe oryzea is one of the most widespread and destructive rice diseases worldwide. The most economical and effective strategy for controlling rice blast is the rational use and promotion of disease-resistant varieties. To enhance disease resistance, it is essential to analyze the resistance levels of rice varieties and the role of resistance (R) genes. To investigate blast resistance, R gene distribution, and their contributions in japonica rice, 287 varieties were evaluated through artificial inoculation. PCR detection was also performed using specific primers for eleven R genes. The results showed that 24.4% of the varieties exhibited moderate resistance (MR), indicating an overall moderate resistance level. The frequency of R genes varied significantly: Pib was the most prevalent (89.2%), followed by Pi5 (73.5%), Pita (62.4%), Pia (54.4%), Pikh (48.4%), Pik (41.1%), Pi9 (35.5%), Pizt (23.7%), Pit (10.8%), and Pi1 (10.5%). No Pigm was detected. Among these, Pik, Pi9, Pizt, and Pita contributed most significantly to disease resistance, with contributions of 42.4%, 38.2%, 38.2%, and 33.5%, respectively. The number of R genes detected in the tested varieties ranged from 0 to 9, with most varieties containing more than three genes. The highest proportion of resistant varieties was observed in those carrying six genes. The most common R gene combinations in resistant varieties were ‘Pib + Pita + Pi5 + Pikh + Pik + Pi9’ and ‘Pizt + Pib + Pita + Pia + Pi5 + Pik + Pi9’. In conclusion, these findings provide valuable insights into the breeding and utilizing blast-resistant japonica rice varieties in Anhui Province.

1. Introduction

Rice (Oryza sativa L.) is a crucial food crop essential for human survival as a primary cereal crop in ensuring global food security [1]. Rice is widely cultivated in China. Two major types of O. sativa—O. sativa Xian (also known as Indica) and O. sativa Geng (also known as Japonica) were recognized as early as the Han Dynasty 2000 years ago. They each have unique characteristics and growth environments, and there are obvious differences in growth cycle, pest resistance and yield, and significant differences in taste, use and nutritional value [2].

Rice blast caused by the ascomycete fungus Magnaporthe oryzea is one of the most widespread and destructive rice diseases worldwide. It is also referred to as ‘rice fever’, ‘fire blight’, or ‘choke neck fever’ in some regions. Depending on the stage and part of the plant affected, it can be classified into seedling blast, leaf blast, and panicle blast. When the disease is severe, it will cause a reduction in rice yield and seriously affect rice production safety [3]. In recent years, due to the change in market demand, the planting area of japonica rice has increased year by year, and the japonica rice varieties used in the current production have poor resistance to rice blast, and there is a risk of disease epidemic [4].

The activation of the plant immune system serves as the physiological foundation for disease resistance. Through co-evolution with pathogenic microorganisms, plants have developed a two-layered defense system: Pattern Triggered Immunity (PTI) and Effector Triggered Immunity (ETI). PTI is initiated when cell surface pattern recognition receptors (PRRs) detect pathogen-associated molecular patterns (PAMPs), triggering immune responses such as callose deposition, reactive oxygen species (ROS) bursts, and MAPK signaling cascades. ETI, a stronger and more specific response, occurs when intracellular NLR immune receptors recognize pathogen effectors, often leading to a hypersensitive response (HR). In rice (O. sativa), both PTI and ETI are deployed against M. oryzae, the causal agent of blast disease. While M. oryzae can suppress PTI through effector proteins (e.g., products of avirulence genes), ETI mediated by blast resistance (R) genes (e.g., Pita, Pib, Pi9) enables effector recognition and robust immunity [5].

At present, the most economical and effective method in the prevention and control of rice blast is to rationally use and promote disease-resistant varieties [6]. China’s ‘one-vote veto’ policy mandates that new rice varieties must meet blast resistance criteria for approval, alongside yield and quality standards since 2008. It requires highly for disease resistance breeding, and the utilization of rice blast resistance genes is the key to disease resistance breeding [7]. The interaction between rice resistance (R) genes and M. oryzae avirulence (Avr) genes follows the classic gene-for-gene model. When a local M. oryzae population lacks the complementary Avr gene, or when the Avr gene undergoes a mutation that allows it to escape recognition, the corresponding R gene will lose its resistance function in that area [8,9].

Comparative studies of rice blast resistance genes across Chinese provinces reveal distinct regional distribution patterns and efficacy profiles. The 70 major rice cultivars of Guangdong Province showed high occurrences of Pib and Pita but weak resistance and a complete absence of Pi1 and Pi9, while Pi2 demonstrated superior resistance to blast [10]. Analysis of 195 newly bred japonica varieties in Jiangsu revealed that varieties carried 2–5 R genes, with none containing the Pigm gene. High-frequency R genes were Pib, Pita and Pikh, and the gene combination ‘Pia + Pita’ conferred consistent panicle blast resistance [11]. Evaluation of 111 rice accessions (22 monogenic lines under natural infection + 89 japonica varieties under artificial inoculation) revealed that Pib, Pikh, Piz, Pi9, and Pi5 conferred effective resistance to Yunnan’s predominant M. oryzae strains, suggesting their utility for regional breeding programs [12]. Marker-assisted screening of the 52 japonica rice germplasm resources of the Yangtze River Delta region identified Pib and Pita as the most prevalent R genes, though Pita, Pi5, Pi2 and Pikm carriers showed greater resistance efficacy [13]. Analysis of 34 major rice varieties in Heilongjiang Province revealed the different distribution frequencies of R genes, ranked from high to low, were as follows: Pi9, Pita, Pikm, Pib, Pii, and Pid3. The varieties with two R genes accounted for the largest proportion. ‘Longjing 40’ and ‘Longjing 42’ did not contain the gene to be detected [14].

Anhui is located in the central-eastern part of China, close to the sea and adjacent to rivers, with clear geographical advantages, rich agricultural resources, and a significant proportion of agricultural products, making it a typical agricultural province. The annual planting area of rice exceeds 2.47 million hectares, with a total output of over 15 million tons. Anhui is located in the transitional zone between the northern and southern climates, where natural disasters such as floods, droughts, hailstorms, and other calamities occur frequently. Every year, the rice blast disease occurs to varying degrees and can adversely affect rice production. However, there are comparatively few research papers regarding the contributions of disease resistance and resistance genes of rice varieties in Anhui.

Our research group previously conducted studies on the interaction between single-gene resistant rice varieties and M. oryzae, the identification of Avr genes and physiological races of M. oryzae, and analyzed the broad-spectrum R genes Pi9, Pik, Pizt, Pi1, and Pikh in the rice-growing areas of Anhui Province. The selection of other R genes (Pib, Pita, Pia, Pi5, Pit, Pigm) was based on prior studies in neighboring regions (e.g., Jiangsu, Zhejiang) and consultations with breeders. This study employed a comprehensive approach to evaluate blast resistance in the japonica rice varieties, which were tested in Anhui Province in 2023. The conventional PCR was conducted to detect the distribution and combination of the eleven R genes (Pizt, Pit, Pib, Pita, Pia, Pi5, Pi1, Pikh, Pik, Pi9, and Pigm) in the tested rice varieties. This aims to select disease-resistant varieties and combinations of disease-resistant genes, providing a basis for the breeding and utilization of disease-resistant rice varieties in Anhui.

2. Materials and Methods

2.1. Rice Varieties and Blast Fungal Strains

The 287 japonica rice varieties were all Chinese varieties, including 166 new rice varieties selected and introduced in Anhui Province in recent years and 121 new rice varieties tested in the middle and lower reaches of the Yangtze River. The susceptible control variety was Changjinnuo No.2. Provided by the Seed Management Station of Anhui Province.

Nine strains were selected from the dominant population (ZB group) of M. oryzae in Anhui Province. These selections were based on the identification of physiological races of M. oryzae using seven Chinese rice differential varieties. The selected strain numbers (formatted as collection year–serial number) were as follows: 2021–2, 2020–11, 2019–78, 2019–80, 2019–96, 2016–24, 2016–26, 2016–27, and 2016–51. These strains were provided by our research group.

2.2. Assessment of Blast Resistance Magnitude

The test strains were maintained at a constant temperature of 26 °C. First, they were cultured on potato sucrose agar (PSA) medium for 7 days, then transferred to barley medium (boiled barley grains) for 7 days, and then transferred to a culture plate (a flat tray used for laying out barley grains) for 1 day. Finally, they were washed with sterile water, filtered, centrifugated, and added 0.05% Tween to prepare spore suspension containing 2 × 10⁵ spores/mL.

The experiment on rice blast resistance was conducted in the experimental field of Anhui Academy of Agricultural Sciences in Hefei (31°49′21″ N, 117°13′24″ E). The experiment consisted of two replicates, all of which were randomized. Two replicate inoculations were performed per batch under controlled conditions (25–28 °C, >95% RH).

During the seedling blast identification period, after soaking and germinating the rice seeds at 30 °C. Ten to fifteen seeds of each variety were sown in a plastic tray with holes filled with fine soil, with holes spaced 3 cm apart. ‘Changjinnuo No.2’ as the susceptible control was set for each tray. At the third–fourth leaf stage, the seedlings were inoculated with spore suspension. The inoculum was sprayed on the rice seedlings with a high-pressure mist (pressure: 2.0 Pa, median droplet volume diameter 50–100 μm) sprayer, and the inoculation amount was limited to the spore liquid covering all the leaves. After inoculation, it was placed in a greenhouse of 25–28 °C, the relative humidity above 95% and light-shielding for 24 h. Then, the shading conditions were removed, and humidity was maintained by spraying water three–four times daily to ensure that the rice seedlings could fully develop the disease.

During the panicle blast identification period, the seedlings were transplanted at the fifth–sixth leaf stage, with two lines for each variety, three points per row, two–four basic seedlings in each point, and 14 cm × 20 cm spacing. ‘Changjinnuo No. 2’ was planted around the tested varieties and was included after every 20 varieties. Identification nursery was fertilized highly, and treating insects does not cure the disease. From the booting stage to the breaking stage, each panicle was inoculated with a 2 mL spore suspension. After inoculation, water was sprayed three–four times daily. The temperature was kept at 25–28 °C, and the relative humidity was kept above 95%.

The rice blast grading system adhered to NY/T2646-2014 (China, 2014) [15]. The disease severity of seedling leaf blast was evaluated using the standard 0–9 grade, defined as follows: grade 0—no disease symptoms; grade 1—brown spots the size of needles; grade 2—large brown spots, diameter <1 mm; grade 3—circular to elliptic gray lesions with brown edges, diameter 1–2 mm; grade 4—typical spindle-shaped lesions, length 1–2 cm, limited between two leaf veins, the infested area less than 2.0% of leaf area; grade 5—typical spindle-shaped lesions, the infested area accounts for 2.1–10.0% of leaf area; grade 6—typical spindle-shaped lesions, the infested area accounts for 10.1–25.0% of leaf area; grade 7—typical spindle-shaped lesions, the infested area accounts for 25.1–50.0% of leaf area; grade 8—typical spindle-shaped lesions, the infested area accounts for 50.1–75.0% of leaf area; grade 9—typical spindle-shaped lesions covering >75.0% of leaf area.

The panicle loss rate of rice panicle blast was scored visually on six levels, defined as follows: grade 0—no disease symptoms; grade 1—individual branch diseased, loss per panicle <5.0%; grade 3—spindle or panicle diseased, loss per panicle 5.1–20.0%; grade 5—spindle or panicle diseased, grains half shriveled, loss per panicle 20.1–50.0%; grade 7—panicle diseased, most grains shriveled, loss per panicle 50.1–70.0%; grade 9—panicle diseased, loss per panicle >70.0%.

The standard for grading the incidence of rice panicle blast was defined as follows: grade 0—no disease symptoms; grade 1—incidence ≤5.0%; grade 3—incidence 5.1–10.0%; grade 5—incidence 10.1–25.0%; grade 7—incidence 25.1–50.0%; grade 9—incidence ≥50.1%.

The seedling blast was investigated when the susceptible control variety reached grade 7 or above, investigating the most affected leaves of 10 plants in each variety. In the early stage of rice ripening (80% of the grain of the rice panicle tip was mature), the 100 most diseased panicles per variety were investigated, and the incidence rate and single-panicle loss rate were investigated.

2.3. Identification of Rice Blast Resistance (R) Genes

R gene identification in each japonica rice variety was conducted using a conventional PCR approach with R gene-specific primers, as detailed in

Table 1. Sequences of specific primers for rice blast resistance genes.

Gene Name	Primer Name	Primer Sequence (5′–3′)	Expected Size/bp
Pi9	Pi9-1F	TGCCCAACCTTTACCCACTGTA	807 [16]
	Pi9-1R	AACATGAGTAGAAACAAATTAGTTTG
Pik	dCAPS-2953-F	TTCGAGGCCCTACCAAGACA	102 [17]
	dCAPS-2953-R	CATGGAAGGCTATCCTTGGTA
Pi1	M-Pi1-F	GTGCTGCTGTGGCTAGTTTG	460 [18]
	M-Pi1-R	AGTCCCCGCTCAATTTTTCT
Pikh	MAS-F	CAATCTCCAAAGTTTTCAGG	216 [19]
	MAS-R	GCTTCAATCACTGCTAGACC
Pita	YL155-F	AGCAGGTTATAAGCTAGGCC	1042 [20]
	YL155-R	CTACCAACAAGTTCATCAAA
Pi5	M-Pi5-F	ATAGATCATGCGCCCTCTTG	484 [20]
	M-Pi5-R	TCATACCCCATTCGGTCAT
Pia	Pia-F	GCGACTGACACTTTCAATAGC	189 [20]
	Pia-R	CGGTAGAGCAATTTAGAAGCAG
Pib	Pibdom-F	GAACAATGCCCAAACTTGAGA	350 [20]
	Pibdom-R	GGGTCCACATGTCAGTGAGC
Pizt	AP22-F	GTGCATGAGTCCAGCTCAAA	143 [21]
	AP22-R	GTGTACTCCCATGGCTGCTC
Pit	tN11-F	ATGATAACCTCATCCTCAATAAGT	733 [22]
	tN11-R	GTTGGAGCTACGGTTGTTCAG
Pigm	GMR-3-F	AGTTCTACTTACGGAGGAGC	146 + 98 [11]
	GMR-3-R	AGAATTATGATAAAGAGAAAGGAA

. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).

Genomic DNA was extracted from leaf tissue using the Plant DNA kit (SparkJade, Qingdao, China) and stored at −20 °C. PCR amplification was performed in 20 µL reactions containing 8 µL PCR-grade ddH₂O, 0.5 µL each of 10 µM forward/reverse primers, 10 µL 2 × Spark Fast Taq Master Mix (SparkJade, China), and 1 µL template DNA (20 ng/µL). Thermocycling conditions: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 15 s, 55 °C annealing for 15 s, 72 °C extension for 15 s, 30 cycles; 72 °C further extension for 5 min. Products were separated on 1% agarose gels and photographed in a gel imaging system.

2.4. Data Analysis

The results of the survey on the identification of blast resistance were calculated according to the following formulas.

$$GLB={\displaystyle \frac{{\displaystyle \sum \left(NDL\times GDL\right)}}{TNL}}$$

(1)

$$IDP={\displaystyle \frac{TNDP}{TNP}}\times 100$$

(2)

$$GLRP={\displaystyle \frac{{\displaystyle \sum \left(NDP\times GDP\right)}}{TNP}}$$

(3)

$$IB=GLB\times 25\%+GIDP\times 25\%+GLRP\times 50\%$$

(4)

Formula presentations: GLB—seedling leaf blight grade; NDL—number of diseased leaves; GDL—grade of diseased leaves; TNL—total number of investigated leaves; IDP—incidence of diseased panicles, unit is percentage (%); TNDP—total number of diseased panicles; TNP—total number of investigated panicles; GLRP—panicle loss rate grade; NDP—number of diseased panicles; GDP—grade of diseased panicles; IB—comprehensive index of rice blast; GIDP—diseased panicle incidence grade.

This study evaluated the resistance levels of the tested rice varieties to rice blast based on the comprehensive index. The evaluation and grading standards for the resistance types of rice blast and the comprehensive index were as follows: high resistance (HR), grade 0: <0.1; resistance (R), grade 1: 0.1–2.0; moderate resistance (MR), grade 3: 2.1–4.0; moderate susceptibility (MS), grade 5: 4.1–6.0; susceptibility (S), grade 7: 6.1–7.5; high susceptibility (HS), grade 9: 7.6–9.0. The proportion of varieties at each resistance level (%) = the number of varieties at each resistance level/the total number of tested varieties × 100. Varieties with HR, R and MR were recorded as disease-resistant varieties, and varieties with MS, S and HS were recorded as susceptible varieties. The proportion of disease-resistant varieties (%) = the number of disease-resistant varieties/the total number of tested varieties × 100.

The presence or absence of R genes was determined according to the electrophoresis line. The number of R genes refers to the number of R genes detected per variety. The relationship between R genes and resistance levels was evaluated using multiple stepwise regression in Microsoft Excel. Distribution frequency of R gene (%) = the number of varieties containing R gene/the total number of tested varieties × 100. Disease resistance contribution rate of R gene (%) = the number of varieties containing R gene and resisting disease/the total number of varieties containing R gene × 100.

3. Results

3.1. Rice Blast Resistance Magnitude in the Tested Rice Varieties

Under artificial inoculation, the susceptible control exhibited grade-7 seedling blast and grade-9 panicle blast (both incidence and loss rates). With a comprehensive index of 8.5, the variety was rated HS, validating the validity of the experimental data.

In this study, the levels of seedling blast and the incidence and loss rates of panicle blast of 287 participating varieties were investigated and analyzed, and their resistance levels were evaluated using comprehensive indexes (Figure 1). None of the tested varieties was rated HR or R, 70 varieties (24.4%) with MR, 144 (50.2%) with MS, 68 (23.7%) with S, and 5 (1.7%) with HS.

3.2. Analysis of Eleven R Genes in the Tested Rice Varieties

R gene identification in the tested varieties was conducted using a conventional PCR approach with eleven specific primers. Gel electrophoresis plots of eleven R genes in eight tested varieties were shown in Figure 2. Except for six genes (Pit, Pib, Pita, Pi1, Pik, Pi9), PCR detection of the other five genes (Pizt, Pi5, Pia, Pikh, Pigm) yielded two amplification bands. Referencing the size of DNA marker fragments, eleven resistance genes were determined in the presence or absence based on the size of gene fragments in Table 1.

3.3. Distribution of Resistance Genes and the Contribution of Disease Resistance

Except for Pigm, the other ten R genes were distributed with different frequencies (

Table 2. Distribution frequency and disease resistance contribution rate of R genes.

R Gene	Number of Varieties	Distribution Frequency (%)	Number of Disease-Resistant Varieties	Disease Resistance Contribution Rate (%)
Pizt	68	23.7%	26	38.2%
Pit	31	10.8%	9	29.0%
Pib	256	89.2%	66	25.8%
Pita	179	62.4%	60	33.5%
Pia	156	54.4%	32	20.5%
Pi5	211	73.5%	42	19.9%
Pi1	30	10.5%	5	16.7%
Pikh	139	48.4%	37	26.6%
Pik	118	41.1%	50	42.4%
Pi9	102	35.5%	39	38.2%

). Pib had the highest frequency of 89.2%, followed by Pi5 (73.5%), Pita (62.4%), Pia (54.4%), Pikh (48.4%), Pik (41.1%), Pi9 (35.5%), Pizt (23.7%), Pit (10.8%), and Pi1 (10.5%).

Based on the proportion of resistant varieties, the contribution of R genes to the disease resistance was analyzed (Table 2). The contribution rates of ten different R genes ranged from 16.7% to 42.4%. The contribution rate of Pik, Pi9, Pizt or Pita was respectively 42.4%, 38.2%, 38.2% or 33.5%. It indicated that the four R genes Pik, Pi9, Pizt and Pita had great utilization value and could be used as the main R genes in Anhui.

3.4. Correlation Between the Number of Resistance Genes and the Resistance Level

The correlation between the number of R genes and the resistance level was analyzed based on the proportion of disease-resistant varieties. The tested varieties contained zero–nine R genes. There were 226 varieties containing three–six R genes, accounting for 78.7%. The most varieties contained five genes, accounting for 25.8%. The varieties containing no detected R genes or only one R gene showed MS or S levels. The varieties containing six R genes had the highest proportion of disease-resistant varieties, with 52.3% (Figure 3,

Table 3. Distribution of different R gene combinations in the tested plants, along with the total number of plants for each combination and the number of plants exhibiting blast resistance.

R Gene Combination	Number of Varieties	Number of Disease-Resistant Varieties	R gene Combination	Number of Varieties	Number of Disease-Resistant Varieties
0	1	0	Pib + Pita + Pi5 + Pi1 + Pik	2	2
Pib	5	0	Pizt + Pib + Pita + Pi5 + Pi9	3	2
Pita	1	0	Pit + Pib + Pita + Pia + Pi5	4	0
Pi5	2	0	Pib + Pita + Pia + Pi5 + Pik	3	0
Pia + Pi5	3	0	Pib + Pia + Pi5 + Pik + Pi9	1	0
Pib + Pik	1	0	Pib + Pita + Pi5 + Pikh + Pi9	1	0
Pib + Pia	10	2	Pib + Pita + Pia + Pikh + Pi9	2	1
Pib + Pi5	3	1	Pib + Pia + Pi5 + Pikh + Pi9	2	0
Pi5 + Pik	1	1	Pit + Pib + Pia + Pi5 + Pik	1	1
Pikh + Pi9	1	0	Pit + Pib + Pita + Pi5 + Pikh	1	0
Pib + Pita	2	1	Pizt + Pib + Pia + Pi5 + Pi9	2	0
Pizt + Pia	1	0	Pizt + Pib + Pi5 + Pikh + Pi9	5	1
Pib + Pi5 + Pikh	5	0	Pib + Pia + Pi5 + Pi1 + Pik	5	0
Pib + Pikh + Pik	1	0	Pit + Pib + Pi5 + Pi1 + Pik	1	0
Pita + Pi5 + Pikh	4	1	Pizt + Pib + Pita + Pia + Pikh	1	0
Pib + Pi5 + Pik	2	1	Pit + Pib + Pia + Pi5 + Pikh	1	0
Pib + Pia + Pi5	10	0	Pizt + Pib + Pita + Pia + Pi9	1	1
Pib + Pia + Pik	3	1	Pib + Pita + Pi5 + Pikh + Pi9	1	0
Pib + Pikh + Pi9	2	0	Pib + Pia + Pi5 + Pikh + Pik	1	0
Pib + Pita + Pik	2	0	Pizt + Pib + Pita + Pi5 + Pik + Pi9	3	2
Pizt + Pib + Pikh	1	0	Pizt + Pib + Pita + Pikh + Pik + Pi9	6	5
Pib + Pia + Pikh	3	0	Pib + Pita + Pi5 + Pi1 + Pik + Pi9	2	0
Pita + Pikh + Pik	1	0	Pizt + Pib + Pita + Pia + Pi5 + Pikh	1	1
Pib + Pi5 + Pi1	1	0	Pizt + Pit + Pib + Pi5 + Pik + Pi9	1	0
Pi5 + Pikh + Pik	1	0	Pizt + Pib + Pi5 + Pikh + Pik + Pi9	1	1
Pib + Pita + Pi5	4	0	Pib + Pita + Pi5 + Pikh + Pik + Pi9	3	3
Pib + Pita + Pia	2	2	Pib + Pita + Pia + Pikh + Pik + Pi9	4	3
Pib + Pi5 + Pi9	1	0	Pit + Pib + Pita + Pi5 + Pi1 + Pik	1	1
Pib + Pita + Pikh	1	1	Pit + Pib + Pita + Pia + Pi5 + Pi9	2	0
Pia + Pi5 + Pik	2	0	Pib + Pita + Pia + Pi5 + Pik + Pi9	1	1
Pita + Pia + Pi5	1	0	Pit + Pib + Pita + Pi5 + Pikh + Pik	1	1
Pib + Pita + Pi5 + Pik	6	1	Pit + Pib + Pita + Pi5 + Pik + Pi9	1	1
Pib + Pita + Pi5 + Pikh	9	0	Pizt + Pib + Pita + Pi5 + Pikh + Pi9	3	1
Pita + Pia + Pi5 + Pikh	5	0	Pizt + Pib + Pia + Pi5 + Pikh + Pi9	3	0
Pita + Pi5 + Pikh + Pik	1	1	Pib + Pita + Pia + Pi5 + Pikh + Pi9	2	1
Pita + Pi5 + Pi1 + Pik	2	1	Pit + Pib + Pita + Pia + Pi5 + Pikh	1	1
Pib + Pia + Pi5 + Pik	2	0	Pizt + Pib + Pita + Pia + Pi5 + Pi9	3	1
Pizt + Pib + Pik + Pi9	1	0	Pib + Pia + Pi5 + Pi1 + Pik + Pi9	1	0
Pib + Pia + Pikh + Pik	1	1	Pit + Pib + Pia + Pi5 + Pi1 + Pik	3	0
Pib + Pi1 + Pik + Pi9	1	0	Pizt + Pib + Pi5 + Pi1 + Pikh + Pik	1	0
Pib + Pita + Pia + Pi5	9	0	Pib + Pita + Pi5 + Pi1 + Pikh + Pik + Pi9	1	0
Pizt + Pita + Pia + Pi5	1	0	Pizt + Pib + Pita + Pia + Pi5 + Pik + Pi9	5	5
Pizt + Pita + Pi5 + Pikh	1	0	Pizt + Pit + Pib + Pita + Pikh + Pik + Pi9	1	1
Pib + Pita + Pi5 + Pi9	4	0	Pib + Pita + Pia + Pi5 + Pikh + Pik + Pi9	1	1
Pib + Pi5 + Pikh + Pik	1	0	Pib + Pita + Pia + Pi1 + Pikh + Pik + Pi9	1	0
Pib + Pita + Pia + Pik	2	1	Pizt + Pit + Pib + Pita + Pi5 + Pik + Pi9	2	1
Pib + Pia + Pikh + Pi9	1	0	Pizt + Pit + Pib + Pi5 + Pikh + Pik + Pi9	1	0
Pib + Pita + Pia + Pikh	4	0	Pit + Pib + Pita + Pia + Pi5 + Pikh + Pik	1	0
Pia + Pi5 + Pikh + Pi9	1	0	Pizt + Pib + Pita + Pia + Pikh + Pik + Pi9	1	1
Pib + Pi5 + Pikh + Pi9	1	0	Pizt + Pit + Pib + Pita + Pia + Pi5 + Pik	1	1
Pib + Pia + Pi5 + Pikh	6	0	Pizt + Pib + Pita + Pia + Pi5 + Pi1 + Pik	1	0
Pizt + Pib + Pia + Pi5	1	0	Pizt + Pib + Pita + Pia + Pi5 + Pikh + Pi9	4	0
Pizt + Pib + Pita + Pik	1	0	Pizt + Pit + Pib + Pia + Pi5 + Pikh + Pi9	1	0
Pib + Pita + Pia + Pi5 + Pikh	16	1	Pib + Pita + Pia + Pi5 + Pi1 + Pikh + Pik	1	1
Pizt + Pib + Pita + Pik + Pi9	1	1	Pizt + Pib + Pia + Pi5 + Pi1 + Pik + Pi9	1	0
Pib + Pita + Pi5 + Pik + Pi9	4	1	Pizt + Pib + Pita + Pia + Pi5 + Pikh + Pik	1	0
Pib + Pita + Pikh + Pik + Pi9	4	3	Pizt + Pit + Pib + Pita + Pia + Pi5 + Pikh + Pi9	1	1
Pib + Pita + Pi5 + Pikh + Pik	5	2	Pit + Pib + Pita + Pi5 + Pi1 + Pikh + Pik + Pi9	1	0
Pib + Pita + Pia + Pikh + Pik	4	3	Pizt + Pit + Pib + Pita + Pi5 + Pi1 + Pik + Pi9	1	0
Pizt + Pib + Pita + Pi5 + Pik	1	0	Pizt + Pit + Pita + Pia + Pi5 + Pi1 + Pikh + Pik + Pi9	1	0
Pizt + Pib + Pita + Pikh + Pi9	1	0	Pizt + Pit + Pib + Pita + Pia + Pi5 + Pi1 + Pik + Pi9	2	0

Note: The number of varieties conferring rice blast resistance represents the number of varieties with the MR type.

).

With the increase in the number of R genes, the proportion of disease-resistant varieties tends to rise, indicating that pooling a certain number of R genes can improve breed resistance. In addition, correlation analysis showed that the resistance level was weakly positively correlated with the number of resistance genes (R² = 0.117) (Figure 3).

However, the resistance levels of different varieties varied greatly. For example, the resistance of five varieties containing two R genes reached the MR type, while the resistance of three varieties containing nine R genes was only at the MS type (Table 3). This suggested that cultivar resistance did not necessarily become stronger with the number of aggregated R genes.

3.5. Distribution of Resistance Gene Combinations and the Contribution of Disease Resistance

Based on the proportion of disease-resistant varieties under different combinations of R genes, the contribution of R genes to disease resistance was analyzed (Table 3). There were 122 combinations of R genes in the tested varieties, and there were no resistant varieties in the varieties containing no or a single gene. There were 24 combinations with 100% disease-resistant varieties, but there were just one–two varieties in each of the 22 combinations, and their utilization value needed to be further investigated. There were three or five varieties in each of the other two combinations—three varieties contained Pib + Pita + Pi5 + Pikh + Pik + Pi9, and five varieties contained Pizt + Pib + Pita + Pia + Pi5 + Pik + Pi9. It was speculated that these two combinations of R genes could be used in disease resistance breeding in Anhui Province.

Many varieties containing the following three combinations showed no disease resistance, that was, Pib + Pia + Pi5, Pib + Pita + Pi5 + Pikh, Pib + Pita + Pia + Pi5, indicating that these three combinations of blast R genes had little effect on disease resistance in rice production in Anhui Province.

4. Discussion

Rice blast is one of the most important diseases affecting rice, and it can occur during the whole growth period of rice. According to the occurrence period and location, it can be divided into seedling blast, leaf blast, panicle blast, etc. In epidemic years, rice production can be reduced by more than 50%, which seriously affects the yield and quality of rice [23]. In response to M. oryzae infection, rice plants deploy complex innate and induced defenses mediated by R genes and defense regulators. However, M. oryzae has the ability to manipulate rice immunity through various strategies, including producing large amounts of effector molecules to promote infection and induce disease in the host. Environmental conditions are key factors regulating blast resistance in rice. Warm temperatures, high humidity, and low light intensity favor the prevalence of blast disease in paddy fields [24].

Breeding and planting resistant varieties is an economical and effective strategy for rice blast control. Recent advances in the localization and cloning of resistance genes have enabled breeders to increasingly adopt molecular marker-assisted selection methods for disease resistance breeding. The mining of rice blast resistance genes and the identification of resistance effects were the basis of disease resistance breeding work, and many scholars have carried out relevant studies.

Artificial inoculation of 153 japonica rice varieties in the middle and lower reaches of the Yangtze River at the seedling stage showed a low proportion of varieties with the MR type, yet nearly half of varieties with the MS type [25]. Genetic testing and identification of 65 japonica rice varieties approved was conducted in Jiangsu Province and found that Pita was positively correlated with the resistance to panicle blast, which was still the main R gene in Jiangsu Province [26]. The eighty-seven resistant rice materials were screened in the Chongqing field. The distribution of nine R genes showed that most of the materials contained at least two R genes, and the most one contained five R genes [27]. The thirty-one main rice varieties were studied in Ningxia, Liaoning and Jilin. R genes Ptr, Pit, Pia, Pita and Pikh had high distribution frequency. The rice varieties carrying the R genes Pi9, Pikm, Pid3, Pi5, Pita or Pi63 had high blast resistance, and these genes could be used as the core R genes [28]. The molecular detection and analysis of blast R genes in major rice varieties was conducted in Jiangsu Province. The distribution frequencies of Pish, Pit and Pia were higher than 80%, and the eight major R genes Pita, Pi5, Pi9, Pib, Pb1, Pikm, Pizt and Pi2 had a significant effect on the resistance of rice [29].

In this study, 287 japonica rice varieties were identified by artificial inoculation at the seedling and panicle stage, and a comprehensive index was used to evaluate the rice blast resistance level. The results showed a relatively low proportion of varieties with MR (24.4%) and the highest proportion of varieties with MS (50.2%). According to the resistance level, seventy disease-resistant varieties were selected in Anhui Province in 2023. On the whole, the rice blast resistance of japonica rice was general, and there were potential production safety risks when utilized. Therefore, attention should be paid to prevent the occurrence of rice blast.

R gene identification was conducted using a conventional PCR approach with eleven specific primers. The frequency of Pib was highest at 89.2%, followed by Pi5 (73.5%), Pita (62.4%), Pia (54.4%), Pikh (48.4%), Pik (41.1%), Pi9 (35.5%), Pizt (23.7%), Pit (10.8%), Pi1 (10.5%), and no Pigm was detected. R genes Pik, Pi9, Pizt and Pita contributed more to disease resistance, with 42.4%, 38.2%, 38.2% and 33.5%, respectively. The low phenotypic contribution of Pib aligns with prior findings that Avr–Pib frequency in Anhui is only 47.5%, reducing selection pressure for this R gene [30].

Most varieties contained more than three R genes, but rice varieties with some multiple R genes only exhibit moderate resistance (MR) level. This study evaluated the blast resistance of rice varieties using artificial inoculation methods. The M. oryzae strains were highly pathogenic, and maintaining suitable temperatures and high humidity in the field was conducive to blast disease.

5. Conclusions

From the 287 tested japonica rice varieties, 70 varieties were identified as potential resistant varieties. Four R genes, Pik, Pi9, Pizt and Pita, were found to improve the disease resistance of rice varieties and could be used as the main R genes in Anhui Province. Two R gene combinations, Pib + Pita + Pi5 + Pikh + Pik + Pi9 and Pizt + Pib + Pita + Pia + Pi5 + Pik + Pi9, could improve the disease resistance of rice varieties, which could be applied to multi-gene aggregate disease resistance breeding. In conclusion, the results of this study provided a reference for the breeding and utilization of resistant japonica varieties in Anhui.