A Novel Circular RNA Generated by FGFR2 Gene Promotes Myoblast Proliferation and Differentiation by Sponging miR-133a-5p and miR-29b-1-5p
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Primers
2.3. RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR
2.4. RNA Oligonucleotides and Plasmids Construction
2.5. Cell Culture
2.6. Transfections
2.7. 5-Ethynyl-2′-Deoxyuridine (EdU) Assays
2.8. Flow Cytometry Analysis of the Cell Cycle
2.9. Immunofluorescence
2.10. Luciferase Reporter Assay
2.11. Biotin-Coupled miRNA Pull Down Assay
2.12. Statistical Analysis
3. Results
3.1. CircFGFR2 Promotes Myoblast Proliferation
3.2. CircFGFR2 Promotes Myoblast Differentiation
3.3. CircFGFR2 Interacts with miR-133a-5p and miR-29b-1-5p, and Inhibits the Expression of miR-133a-5p and miR-29b-1-5p in Myoblast
3.4. MiR-133a-5p and miR-29b-1-5p Inhibit Myoblast Proliferation
3.5. CircFGFR2 Eliminates the Inhibition Effect of miR-133a-5p and miR-29b-1-5p on Myoblast Proliferation
3.6. miR-133a-5p and miR-29b-1-5p Repress Myoblast Differentiation
3.7. CircFGFR2 Eliminates the Inhibition Effect of miR-133a-5p and miR-29b-1-5p on Myoblast Differentiation
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sanger, H.L.; Klotz, G.; Riesner, D.; Gross, H.J. Kleinschmidt, A.K. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc. Natl. Acad. Sci. USA 1976, 73, 3852–3856. [Google Scholar] [CrossRef] [PubMed]
- Capel, B.; Swain, A.; Nicolis, S.; Hacker, A.; Walter, M.; Koopman, P.; Goodfellow, P.; Lovell-Badge, R. Circular transcripts of the testis-determining gene Sry in adult mouse testis. Cell 1993, 73, 1019–1030. [Google Scholar] [CrossRef]
- Arnberg, A.C.; Van Ommen, G.J.; Grivell, L.A.; Van Bruggen, E.F.; Borst, P. Some yeast mitochondrial RNAs are circular. Cell 1980, 19, 313–319. [Google Scholar] [CrossRef]
- Cocquerelle, C.; Mascrez, B.; Hetuin, D.; Bailleul, B. Mis-splicing yields circular RNA molecules. FASEB J. 1993, 7, 155–160. [Google Scholar] [CrossRef] [PubMed]
- Jeck, W.R.; Sharpless, N.E. Detecting and characterizing circular RNAs. Nat. Biotechnol. 2014, 32, 453–461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.; Qi, S.; Tang, N.; Zhang, X.; Chen, S.; Zhu, P.; Ma, L.; Cheng, J.; Xu, Y.; Lu, M.; et al. Discovery of replicating circular RNAs by RNA-seq and computational algorithms. PLoS Pathog. 2014, 10, e1004553. [Google Scholar] [CrossRef] [PubMed]
- Salzman, J.; Gawad, C.; Wang, P.L.; Lacayo, N.; Brown, P.O. Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types. PLoS ONE 2012, 7, e30733. [Google Scholar] [CrossRef] [PubMed]
- Abdelmohsen, K.; Panda, A.C.; De, S.; Grammatikakis, I.; Kim, J.; Ding, J.; Noh, J.H.; Kim, K.M.; Mattison, J.A.; de Cabo, R.; et al. Circular RNAs in monkey muscle: Age-dependent changes. Aging 2015, 7, 903–910. [Google Scholar] [CrossRef] [PubMed]
- Veno, M.T.; Hansen, T.B.; Veno, S.T.; Clausen, B.H.; Grebing, M.; Finsen, B.; Holm, I.E.; Kjems, J. Spatio-temporal regulation of circular RNA expression during porcine embryonic brain development. Genome Biol. 2015, 16, 245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qu, S.; Yang, X.; Li, X.; Wang, J.; Gao, Y.; Shang, R.; Sun, W.; Dou, K.; Li, H. Circular RNA: A new star of noncoding RNAs. Cancer Lett. 2015, 365, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.L. The biogenesis and emerging roles of circular RNAs. Nat. Rev. Mol. Cell Biol. 2016, 17, 205–211. [Google Scholar] [CrossRef] [PubMed]
- Du, W.W.; Yang, W.; Chen, Y.; Wu, Z.K.; Foster, F.S.; Yang, Z.; Li, X.; Yang, B.B. Foxo3 circular RNA promotes cardiac senescence by modulating multiple factors associated with stress and senescence responses. Eur. Heart J. 2017, 38, 1402–1412. [Google Scholar] [CrossRef] [PubMed]
- Du, W.W.; Yang, W.; Liu, E.; Yang, Z.; Dhaliwal, P.; Yang, B.B. Foxo3 circular RNA retards cell cycle progression via forming ternary complexes with p21 and CDK2. Nucleic Acids Res. 2016, 44, 2846–2858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, C.Y.; Sarnow, P. Initiation of protein synthesis by the eukaryotic translational apparatus on circular RNAs. Science 1995, 268, 415–417. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA 2015, 21, 172–179. [Google Scholar] [CrossRef] [PubMed]
- Abe, N.; Matsumoto, K.; Nishihara, M.; Nakano, Y.; Shibata, A.; Maruyama, H.; Shuto, S.; Matsuda, A.; Yoshida, M.; Ito, Y.; et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Sci. Rep. 2015, 5, 16435. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, R.; Zhang, X.O.; Zhang, Y.; Ma, X.K.; Chen, L.L.; Yang, L. CircRNA-derived pseudogenes. Cell Res. 2016, 26, 747–750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hansen, T.B.; Jensen, T.I.; Clausen, B.H.; Bramsen, J.B.; Finsen, B.; Damgaard, C.K.; Kjems, J. Natural RNA circles function as efficient microRNA sponges. Nature 2013, 495, 384–388. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Long, B.; Liu, F.; Wang, J.X.; Liu, C.Y.; Zhao, B.; Zhou, L.Y.; Sun, T.; Wang, M.; Yu, T.; et al. A circular RNA protects the heart from pathological hypertrophy and heart failure by targeting miR-223. Eur. Heart J. 2016, 37, 2602–2611. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, C.; Yuan, W.; Yang, X.; Li, P.; Wang, J.; Han, J.; Tao, J.; Li, P.; Yang, H.; Lv, Q.; et al. Circular RNA circ-ITCH inhibits bladder cancer progression by sponging miR-17/miR-224 and regulating p21, PTEN expression. Mol. Cancer 2018, 17, 19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zheng, Q.; Bao, C.; Guo, W.; Li, S.; Chen, J.; Chen, B.; Luo, Y.; Lyu, D.; Li, Y.; Shi, G.; et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nat. Commun. 2016, 7, 11215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ouyang, H.; Chen, X.; Wang, Z.; Yu, J.; Jia, X.; Li, Z.; Luo, W.; Abdalla, B.A.; Jebessa, E.; Nie, Q.; et al. Circular RNAs are abundant and dynamically expressed during embryonic muscle development in chickens. DNA Res. 2017. [Google Scholar] [CrossRef] [PubMed]
- Ornitz, D.M.; Marie, P.J. Fibroblast growth factor signaling in skeletal development and disease. Genes Dev. 2015, 29, 1463–1486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ambros, V. The functions of animal microRNAs. Nature 2004, 431, 350–355. [Google Scholar] [CrossRef] [PubMed]
- Baek, D.; Villen, J.; Shin, C.; Camargo, F.D.; Gygi, S.P.; Bartel, D.P. The impact of microRNAs on protein output. Nature 2008, 455, 64–71. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.F.; Mandel, E.M.; Thomson, J.M.; Wu, Q.; Callis, T.E.; Hammond, S.M.; Conlon, F.L.; Wang, D.Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat. Genet. 2006, 38, 228–233. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Wu, X.; Ling, Z.; Yuan, L.; Cheng, Y.; Chen, J.; Xiang, C. microRNA133a targets Foxl2 and promotes differentiation of C2C12 into myogenic progenitor cells. DNA Cell Biol. 2015, 34, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Mishima, Y.; Abreu-Goodger, C.; Staton, A.A.; Stahlhut, C.; Shou, C.; Cheng, C.; Gerstein, M.; Enright, A.J.; Giraldez, A.J. Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. Genes Dev. 2009, 23, 619–632. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kriegel, A.J.; Liu, Y.; Fang, Y.; Ding, X.; Liang, M. The miR-29 family: Genomics, cell biology, and relevance to renal and cardiovascular injury. Physiol. Genom. 2012, 44, 237–244. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Lim, S.; Song, B.W.; Cha, M.J.; Ham, O.; Lee, S.Y.; Lee, C.; Park, J.H.; Bae, Y.; Seo, H.H.; et al. MicroRNA-29b inhibits migration and proliferation of vascular smooth muscle cells in neointimal formation. J. Cell Biochem. 2015, 116, 598–608. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Hassan, M.Q.; Jafferji, M.; Aqeilan, R.I.; Garzon, R.; Croce, C.M.; van Wijnen, A.J.; Stein, J.L.; Stein, G.S.; Lian, J.B. Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation. J. Biol. Chem. 2009, 284, 15676–15684. [Google Scholar] [CrossRef] [PubMed]
- Fu, Q.; Shi, H.; Shi, M.; Meng, L.; Zhang, H.; Ren, Y.; Guo, F.; Jia, B.; Wang, P.; Ni, W.; et al. bta-miR-29b attenuates apoptosis by directly targeting caspase-7 and NAIF1 and suppresses bovine viral diarrhea virus replication in MDBK cells. Can. J. Microbiol. 2014, 60, 455–460. [Google Scholar] [CrossRef] [PubMed]
- Shen, L.; Song, Y.; Fu, Y.; Li, P. MiR-29b mimics promotes cell apoptosis of smooth muscle cells via targeting on MMP-2. Cytotechnology 2018, 70, 351–359. [Google Scholar] [CrossRef] [PubMed]
- Mott, J.L.; Kobayashi, S.; Bronk, S.F.; Gores, G.J. mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene 2007, 26, 6133–6140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fabbri, M.; Garzon, R.; Cimmino, A.; Liu, Z.; Zanesi, N.; Callegari, E.; Liu, S.; Alder, H.; Costinean, S.; Fernandez-Cymering, C.; et al. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc. Natl. Acad. Sci. USA 2007, 104, 15805–15810. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, Q.; Shi, H.; Chen, C. Roles of bta-miR-29b promoter regions DNA methylation in regulating miR-29b expression and bovine viral diarrhea virus NADL replication in MDBK cells. Arch. Virol. 2017, 162, 401–408. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Wang, L.; Lu, L.; Jiang, P.; Sun, H.; Wang, H. A novel target of microRNA-29, Ring1 and YY1-binding protein (Rybp), negatively regulates skeletal myogenesis. J. Biol. Chem. 2012, 287, 25255–25265. [Google Scholar] [CrossRef] [PubMed]
- Wei, W.; He, H.B.; Zhang, W.Y.; Zhang, H.X.; Bai, J.B.; Liu, H.Z.; Cao, J.H.; Chang, K.C.; Li, X.Y.; Zhao, S.H. miR-29 targets Akt3 to reduce proliferation and facilitate differentiation of myoblasts in skeletal muscle development. Cell Death Dis. 2013, 4, e668. [Google Scholar] [CrossRef] [PubMed]
- Winbanks, C.E.; Wang, B.; Beyer, C.; Koh, P.; White, L.; Kantharidis, P.; Gregorevic, P. TGF-beta regulates miR-206 and miR-29 to control myogenic differentiation through regulation of HDAC4. J. Biol. Chem. 2011, 286, 13805–13814. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Chan, M.C.; Yu, Y.; Bei, Y.; Chen, P.; Zhou, Q.; Cheng, L.; Chen, L.; Ziegler, O.; Rowe, G.C.; et al. miR-29b contributes to multiple types of muscle atrophy. Nat. Commun. 2017, 8, 15201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Zhou, L.; Jiang, P.; Lu, L.; Chen, X.; Lan, H.; Guttridge, D.C.; Sun, H.; Wang, H. Loss of miR-29 in myoblasts contributes to dystrophic muscle pathogenesis. Mol. Ther. 2012, 20, 1222–1233. [Google Scholar] [CrossRef] [PubMed]
- Zanotti, S.; Gibertini, S.; Curcio, M.; Savadori, P.; Pasanisi, B.; Morandi, L.; Cornelio, F.; Mantegazza, R.; Mora, M. Opposing roles of miR-21 and miR-29 in the progression of fibrosis in Duchenne muscular dystrophy. Biochim. Biophys. Acta 2015, 1852, 1451–1464. [Google Scholar] [CrossRef] [PubMed]
- Abmayr, S.M.; Pavlath, G.K. Myoblast fusion: Lessons from flies and mice. Development 2012, 139, 641–656. [Google Scholar] [CrossRef] [PubMed]
- Sassoon, D.A. Myogenic regulatory factors: Dissecting their role and regulation during vertebrate embryogenesis. Dev. Biol. 1993, 156, 11–23. [Google Scholar] [CrossRef] [PubMed]
- Salzman, J.; Chen, R.E.; Olsen, M.N.; Wang, P.L.; Brown, P.O. Cell-type specific features of circular RNA expression. PLoS Genet. 2013, 9, e1003777. [Google Scholar] [CrossRef]
- Westholm, J.O.; Miura, P.; Olson, S.; Shenker, S.; Joseph, B.; Sanfilippo, P.; Celniker, S.E.; Graveley, B.R.; Lai, E.C. Genome-wide analysis of drosophila circular RNAs reveals their structural and sequence properties and age-dependent neural accumulation. Cell Rep. 2014, 9, 1966–1980. [Google Scholar] [CrossRef] [PubMed]
- Dodou, E.; Xu, S.M.; Black, B.L. mef2c is activated directly by myogenic basic helix-loop-helix proteins during skeletal muscle development in vivo. Mech. Dev. 2003, 120, 1021–1032. [Google Scholar] [CrossRef]
- Blum, R.; Vethantham, V.; Bowman, C.; Rudnicki, M.; Dynlacht, B.D. Genome-wide identification of enhancers in skeletal muscle: The role of MYOD1. Genes Dev. 2012, 26, 2763–2779. [Google Scholar] [CrossRef] [PubMed]
- Berkes, C.A.; Tapscott, S.J. MYOD and the transcriptional control of myogenesis. Semin. Cell Dev. Biol. 2005, 16, 585–595. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Kumar, R.M.; Penn, B.H.; Berkes, C.A.; Kooperberg, C.; Boyer, L.A.; Young, R.A.; Tapscott, S.J. Global and gene-specific analyses show distinct roles for MYOD and Myog at a common set of promoters. EMBO J. 2006, 25, 502–511. [Google Scholar] [CrossRef] [PubMed]
- Tajsharghi, H.; Oldfors, A. Myosinopathies: Pathology and mechanisms. Acta Neuropathol. 2013, 125, 3–18. [Google Scholar] [CrossRef] [PubMed]
- Ashwal-Fluss, R.; Meyer, M.; Pamudurti, N.R.; Ivanov, A.; Bartok, O.; Hanan, M.; Evantal, N.; Memczak, S.; Rajewsky, N.; Kadener, S. circRNA biogenesis competes with pre-mRNA splicing. Mol. Cell 2014, 56, 55–66. [Google Scholar] [CrossRef] [PubMed]
- Jeck, W.R.; Sorrentino, J.A.; Wang, K.; Slevin, M.K.; Burd, C.E.; Liu, J.; Marzluff, W.F.; Sharpless, N.E. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA 2013, 19, 141–157. [Google Scholar] [CrossRef] [PubMed]
- Dudekula, D.B.; Panda, A.C.; Grammatikakis, I.; De, S.; Abdelmohsen, K.; Gorospe, M. CircInteractome: A web tool for exploring circular RNAs and their interacting proteins and microRNAs. RNA Biol. 2016, 13, 34–42. [Google Scholar] [CrossRef] [PubMed]
- Lal, A.; Thomas, M.P.; Altschuler, G.; Navarro, F.; O’Day, E.; Li, X.L.; Concepcion, C.; Han, Y.C.; Thiery, J.; Rajani, D.K.; et al. Capture of microRNA-bound mRNAs identifies the tumor suppressor miR-34a as a regulator of growth factor signaling. PLoS Genet. 2011, 7, e1002363. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Wang, L.; Lu, L.; Jiang, P.; Sun, H.; Wang, H. Inhibition of miR-29 by TGF-beta-Smad3 signaling through dual mechanisms promotes transdifferentiation of mouse myoblasts into myofibroblasts. PLoS ONE 2012, 7, e33766. [Google Scholar] [CrossRef] [PubMed]
Name | Nucleotide Sequences (5′→3′) | Annealing Temperature (°C) | Size | Application |
---|---|---|---|---|
circFGFR2 | F: ACATCGTATTGGCGGCTAT | 60 | 267 | qRT-PCR for circFGFR2 |
R: ACCCCATCCTTAGTCCAAC | ||||
FGFR2-1 | F: GTCCGCTGTATGTGATTGTAG | 56 | 129 | qRT-PCR for FGFR2 gene |
R: TGAATGTCATCTGCTCCTCT | ||||
FGFR2-2 | F: AGCCGCCAACCAAATACCAAATR: CGACAACATCGAGATGGTAAGT | 56 | 636 | Amplification of the whole linear sequence of circFGFR2 |
MYOD | F: GCTACTACACGGAATCACCAAAT | 58 | 200 | qRT-PCR |
R: CTGGGCTCCACTGTCACTCA | ||||
MYOG | F: CGGAGGCTGAAGAAGGTGAA | 60 | 320 | qRT-PCR |
R: CGGTCCTCTGCCTGGTCAT | ||||
β-actin | F: ACCACAGGACTCCATACCCAAGAAAG | 52–60 | 146 | qRT-PCR |
R: GCCGAGAGAGAAATTGTGCGTGAC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Ouyang, H.; Wang, Z.; Chen, B.; Nie, Q. A Novel Circular RNA Generated by FGFR2 Gene Promotes Myoblast Proliferation and Differentiation by Sponging miR-133a-5p and miR-29b-1-5p. Cells 2018, 7, 199. https://doi.org/10.3390/cells7110199
Chen X, Ouyang H, Wang Z, Chen B, Nie Q. A Novel Circular RNA Generated by FGFR2 Gene Promotes Myoblast Proliferation and Differentiation by Sponging miR-133a-5p and miR-29b-1-5p. Cells. 2018; 7(11):199. https://doi.org/10.3390/cells7110199
Chicago/Turabian StyleChen, Xiaolan, Hongjia Ouyang, Zhijun Wang, Biao Chen, and Qinghua Nie. 2018. "A Novel Circular RNA Generated by FGFR2 Gene Promotes Myoblast Proliferation and Differentiation by Sponging miR-133a-5p and miR-29b-1-5p" Cells 7, no. 11: 199. https://doi.org/10.3390/cells7110199