Complement-Mediated Selective Tumor Cell Lysis Enabled by Bi-Functional RNA Aptamers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Proteins, Sera, Antibodies, Oligonucleotides, and Cells
2.2. Nucleic Acid Sequences
- 5′-GGGAGAAUUCAACUGCCAUCUAGCUACAAAAAUACGAGGAAAGC AAAGUACCAGUGUAGCUACCAAAAGGAGUAGUAAAACACUACAAGC UUCUGGACAUCGGU-3′
- 5′-GGGAGAAUUCAACUGCCAUCUAGCUUGACCAAUAAGACGUAUUG GCCUCCUACGCAUGGCAAGCAGUUCUCUCUACUGAACUACAAGCUU CUGGACUCGGU-3′
- 5′-GGGAGAAUUCAACUGCCAUCUACAGCCCCUCGGCCGCGUUCAGCG UCUAACCUUGGGCUGUAUAGAAAGGGUUUCCAGACUACAAGCUUCU GGACUCGGU-3′
- 5′-GGGAGAAUUCAACUGCCAUCUAGUUGCAAAAACAUGAGGAUAGC AAAGUACCAGUGCAACUAACAAGGAAAAGAAGACGGACUACAAGCU UCUGGACUCGGU-3′
- 5′-GGGAGAAUUCAACUGCCAUCUAGCUACGUGGAACCUAAGGUUAA ACCGUAUGAUGCAGUUGUACACUCCAAACGAAGAACUACAAGCUUC UGGACUCGGU-3′
- 5′-GGGAGAAUUCAACUGCCAUCUAACCACGUAGUAAUACGGUAUGA UCCAGUUUUAAUUCUAACCAGACUGUUCAGAUGACUACAAGCUUCU GGACUCGGU-3′
- 5′-GGGACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCGGAAC CGUCCCGAAUUAAAUGCCCGCCAUGACCAG-3′
- 5′ biotin-CTGGTCATGGCGGGCATTTAATTC-3′
- The tri-molecular construct (Trifecta-t) was assembled from the following three fragments.
- 5′-GGGACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCGGAAC CGUCCCUUGCCAUGUGUAUGUGGG-3′
- 5′-GGGCCCCUCGGCCGCGUUCAGCGUCUAACCUUGGGCCCGGAUCAA UCAUGGCAA-3′
- 5′-CCCACAUACUUUGUUGAUCC-3′ [This is a DNA oligo with U instead of T.]
- The bi-molecular construct (Trifecta-b) was assembled from two fragments, Fb1 and Fb2.
- 5′-GGGACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCGGAAC CGUCCCUUGCCAUGUGUAUGUGGGCCC-3′
- 5′-GGGCCCACAUACUUUGUUGAUCCGGGCCCCUCGGCCGCGUUCAGC GUCUAACCUUGGGCCCGGAUCAAUCAUGGCAA-3′
- 5′-GGGUCGUGGCGCGAGCUGAUAAAUACAUGCCCAUAUUAAGGAAC CGUCCC-3′
- 5′-GGGCUCCUGGUCGCCGUCCAGGCUCUACACGUCGCGGC-3′
2.3. In Vitro Selection
2.4. Molecular Binding Assays
2.5. Assembly of Multi-Valent Aptamers
2.6. Aptamer Stability Assays
2.7. Cell Surface Binding Assays
2.8. Cell Viability Assays
3. Results
3.1. Generation and Refinement of the Utility Aptamers
3.2. Adaptation of a Targeting Aptamer
3.3. Construction of Bi-Functional Aptamers
3.4. Deposition of C3 Family Proteins on the Target Cell Surface
3.5. Reduced Viability of Target Cells
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A. Isolation of RNase-Resistant Aptamers for C3 and Its Derivatives
Appendix A.1. Nucleic Acid Sequences
- 5′-GCUAGAAGAAUAUGACGGAUUGACCGUAUCAGGGUAGC-3′
- 5′-GGGAGAAUUCAACUGCCAUCUA-(N55 or N58)-GACUACAAGCUUCU GGACUCGGU-3′
- Oligo-1: 5′-ACCGAGTCCAGAAGCTTGTAGTC-(N55)-TAGATGGCAGTTGA ATTCTCCC-3′
- Oligo-2: 5′-GTAATACGACTCACTATAGGGAGAATTCAACTGCCATC-3′
- Oligo-3: 5′-ACCGAGTCCAGAAGCTTGTAGT-3′
- Oligo-4: 5′-ACCGAGTCCAGAAGCTTGTAGT-(GCTACCCTGATACGGTCAA TCCGTCATATTCTTCTAGC—30% doped)-(N20)-TAGATGGCAGTTGAATT CTC-3′
- Oligo-5: 5′-ACCGAGTCCAGAAGCTTGTAGT-(N20)-(GCTACCCTGATACGG TCAATCCGTCATATTCTTCTAGC—30% doped)-TAGATGGCAGTTGAATT CTC-3′
- Oligo-6: 5′-CTGGTACTTTGCTTTCCTC-3′
- Oligo-7: 5′-GCTTGCCATGCGTAGGAGGCC-3′
- Oligo-8: 5′-CGCTGAACGCGGCCGAGG-3′
- Oligo-9: 5′-GCACTGGTACTTTGCTATCCTC-3′
Appendix A.2. In Vitro Selection
Appendix A.3. Results
SELEX Exp. | Starting Pool | Target Protein | Aptamers & Their Abundance in Final Pool | Affinity to C3 ** | Affinity to C3b ** | Affinity to iC3b ** |
---|---|---|---|---|---|---|
#1 | Un-doped | C3 | AptC3-I (18/96) AptC3-II * (17/96) AptC3-III * (5/96) | ++ ++ ++++ | +++ ++ ++++ | +++ ++ ++++ |
#2 | Doped | iC3b | AptC3-IV (14/41) AptC3-II * (2/41) | + | ++++ | +++ |
#3 | 2nd generation from Exp. 1 & 2 | iC3b | AptC3-V (9/90) AptC3-VI (5/90) AptC3-III * (3/90) | ++ + | +++ ++++ | ++ + |
References
- Sahu, A.; Lambris, J.D. Structure and biology of complement protein C3, a connecting link between innate and acquired immunity. Immunol. Rev. 2001, 180, 35–48. [Google Scholar] [CrossRef]
- Muller-Eberhard, H.J. The membrane attack complex of complement. Ann. Rev. Immunol. 1986, 4, 503–528. [Google Scholar] [CrossRef] [PubMed]
- Ross, G.D. Regulation of the adhesion versus cytotoxic functions of the Mac-1/CR3/alphaMbeta2-integrin glycoprotein. Crit. Rev. Immunol. 2000, 20, 197–222. [Google Scholar] [CrossRef] [PubMed]
- Walport, M.J. Complement. First of two parts. N. Engl. J. Med. 2001, 344, 1058–1066. [Google Scholar] [CrossRef]
- Walport, M.J. Complement. Second of two parts. N. Engl. J. Med. 2001, 344, 1140–1144. [Google Scholar] [CrossRef]
- Cooper, P.D. Complement and cancer: Activation of the alternative pathway as a theoretical base for immunotherapy. Adv. Immun. Cancer Ther. 1985, 1, 125–166. [Google Scholar]
- Macor, P.; Tedesco, F. Complement as effector system in cancer immunotherapy. Immunol. Lett. 2007, 111, 6–13. [Google Scholar] [CrossRef] [PubMed]
- Taylor, R.P.; Lindorfer, M.A. The role of complement in mAb-based therapies of cancer. Methods 2014, 65, 18–27. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, B.; Nilsson Ekdahl, K. The tick-over theory revisited: Is C3 a contact-activated protein? Immunobiology 2012, 217, 1106–1110. [Google Scholar] [CrossRef] [PubMed]
- Nishida, N.; Walz, T.; Springer, T.A. Structural transitions of complement component C3 and its activation products. Proc. Natl. Acad. Sci. USA 2006, 103, 19737–19742. [Google Scholar] [PubMed] [Green Version]
- Janssen, B.J.C.; Christodoulidou, A.; McCarthy, A.; Lambris, J.; Gros, P. Structure of C3b reveals conformational changes that underlie complement activity. Nature 2006, 444, 213–216. [Google Scholar] [CrossRef] [Green Version]
- Mallik, P.K.; Nishikawa, K.; Millis, A.J.T.; Shi, H. Commandeering a biological pathway using aptamer-derived molecular adaptors. Nucleic Acids Res. 2010, 38, e93. [Google Scholar] [CrossRef] [Green Version]
- Shi, H.; Fan, X.; Ni, Z.; Lis, J.T. Evolutionary dynamics and population control during in vitro selection and amplification with multiple targets. RNA 2002, 8, 1461–1470. [Google Scholar] [CrossRef] [Green Version]
- Shu, D.; Shu, Y.; Haque, F.; Abdelmawla, S.; Guo, P. Thermodynamically stable RNA three-way junction for constructing multifunctional nanoparticles for delivery of therapeutics. Nat. Nanotechnol. 2011, 6, 658–667. [Google Scholar] [CrossRef] [Green Version]
- Herbst, R.S. Review of epidermal growth factor receptor biology. Int. J. Radiat. Oncol. Biol. Phys. 2004, 59 (Suppl. 2), 21–26. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Nguyen, H.H.; Byrom, M.; Ellington, A.D. Inhibition of cell proliferation by an anti-EGFR aptamer. PLoS ONE 2011, 6, e20299. [Google Scholar] [CrossRef] [PubMed]
- Herschkowitz, J.I.; Simin, K.; Weigman, V.J.; Mikaelian, I.; Usary, J.; Hu, Z.; Rasmussen, K.E.; Jones, L.P.; Assefnia, S.; Chandrasekharan, S.; et al. Identification of conserved gene expression features between murine mammary carcinoma models and human breast tumors. Genome Biol. 2007, 8, R76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prat, A.; Parker, J.S.; Karginova, O.; Fan, C.; Livasy, C.; Herschkowitz, J.I.; He, X.; Perou, C.M. Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast Cancer Res. 2010, 12, R68. [Google Scholar] [CrossRef] [Green Version]
- Meyer, A.S.; Miller, M.A.; Gertler, F.B.; Lauffenburger, D.A. The receptor AXL diversifies EGFR signaling and limits the response to EGFR-targeted inhibitors in triple-negative breast cancer cells. Sci. Signal. 2013, 6, ra66. [Google Scholar] [CrossRef] [Green Version]
- Mueller, K.L.; Madden, J.M.; Zoratti, G.L.; Kuperwasser, C.; List, K.; Boerner, J.L. Fibroblast-secreted hepatocyte growth factor mediates epidermal growth factor receptor tyrosine kinase inhibitor resistance in triple-negative breast cancers through paracrine activation of Met. Breast Cancer Res. 2012, 14, R104. [Google Scholar] [CrossRef] [Green Version]
- Reeder-Hayes, K.E.; Carey, L.A.; Sikov, W.M. Clinical trials in triple negative breast cancer. Breast Dis. 2010, 32, 123–136. [Google Scholar] [CrossRef]
- Longva, K.E.; Pedersen, N.M.; Haslekås, C.; Stang, E.; Madshus, I.H. Herceptin-induced inhibition of ErbB2 signaling involves reduced phosphorylation of Akt but not endocytic down-regulation of ErbB. Int. J. Cancer 2005, 116, 359–367. [Google Scholar] [CrossRef] [PubMed]
- Wheeler, D.L.; Huang, S.; Kruser, T.; Nechrebecki, M.M.; Armstrong, E.A.; Benavente, S.; Gondi, V.; Hsu, K.-T.; Harari, P.M. Mechanisms of acquired resistance to cetuximab: Role of HER (ErbB) family members. Oncogene 2008, 27, 3944–3956. [Google Scholar] [CrossRef] [Green Version]
- Jaramillo, M.L.; Leon, Z.; Grothe, S.; Paul-Roc, B.; Abulrob, A.; McCourt, M.O. Effect of the anti-receptor ligand-blocking 225 monoclonal antibody on EGF receptor endocytosis and sorting. Exp. Cell Res. 2006, 312, 2778–2790. [Google Scholar] [CrossRef] [PubMed]
- Jurianz, K.; Ziegler, S.; Schüler, H.G.; Kraus, S.; Bohana-Kashtan, O.; Fishelson, Z.; Kirschfink, M. Complement resistance of tumor cells: Basal and induced mechanisms. Mol. Immunol. 1999, 36, 929–939. [Google Scholar] [CrossRef]
- Fishelson, Z.; Donin, N.; Zell, S.; Schultz, S.; Kirschfink, M. Obstacles to cancer immunotherapy: Expression of membrane complement regulatory proteins (mCRPs) in tumors. Mol. Immunol. 2003, 40, 109–123. [Google Scholar] [CrossRef]
- Golay, J.; Zaffaroni, L.; Vaccari, T.; Lazzari, M.; Borleri, G.M.; Bernasconi, S.; Tedesco, F.; Rambaldi, A.; Introna, M. Biologic response of B lymphoma cells to anti-CD20 monoclonal antibody rituximab in vitro: CD55 and CD59 regulate complement-mediated cell lysis. Blood 2000, 95, 3900–3908. [Google Scholar] [CrossRef]
- Prang, N.; Preithner, S.; Brischwein, K.; Göster, P.; Wöppel, A.; Müller, J.; Steiger, C.; Peters, M.; Baeuerle, P.A.; Da Silva, A.J. Cellular and complement-dependent cytotoxicity of Ep-CAM-specific monoclonal antibody MT201 against breast cancer cell lines. Br. J. Cancer 2005, 92, 342–349. [Google Scholar] [CrossRef] [Green Version]
- Soltis, R.D.; Hasz, D.; Morris, M.J.; Wilson, I.D. The effect of heat inactivation of serum on aggregation of immunoglobins. Immunology 1979, 36, 37–45. [Google Scholar] [PubMed]
- Amara, U.; Flierl, M.A.; Rittirsch, D.; Klos, A.; Chen, H.; Acker, B.; Brückner, U.B.; Nilsson, B.; Gebhard, F.; Lambris, J.D.; et al. Molecular intercommunication between the complement and coagulation systems. J. Immunol. 2010, 185, 5628–5636. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Song, Y.; Du, W.; Gong, L.; Chang, H.; Zou, Z. Tumor-associated macrophages: An accomplice in solid tumor progression. J. Biomed. Sci. 2019, 26, 78. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Tang, Z.; Gao, S.; Li, C.; Feng, Y.; Zhou, X. Tumor-associated macrophages: Recent insights and therapies. Front. Oncol. 2020, 10, 188. [Google Scholar] [CrossRef]
- Bruno, J.G. Aptamer-biotin-streptavidin-C1q complexes can trigger the classical complement pathway to kill cancer cells. In vitro Cellular & Developmental Biology. Animal 2010, 46, 107–113. [Google Scholar]
- Mi, J.; Liu, Y.; Rabbani, Z.; Yang, Z.; Urban, J.H.; Sullenger, B.A.; Clary, B.M. In vivo selection of tumor-targeting RNA motifs. Nat. Chem. Biol. 2010, 6, 22–24. [Google Scholar] [CrossRef]
- Cheng, C.; Chen, Y.H.; Lennox, K.A.; Behlke, M.; Davidson, B.L. In vivo SELEX for Identification of Brain-penetrating Aptamers. Mol. Ther. Nucleic Acids 2013, 2, e67. [Google Scholar] [CrossRef]
- Hicke, B.J.; Stephens, A.W.; Gould, T.; Chang, Y.-F.; Lynott, C.K.; Heil, J.; Borkowski, S.; Hilger, C.-S.; Cook, G.; Warren, S.; et al. Tumor targeting by an aptamer. J. Nuclear Med. 2006, 47, 668–678. [Google Scholar]
- Zhang, X.; Claerhout, S.; Prat, A.; Dobrolecki, L.E.; Petrovic, I.; Lai, Q.; Landis, M.D.; Wiechmann, L.; Schiff, R.; Giuliano, M.; et al. A renewable tissue resource of phenotypically stable, biologically and ethnically diverse, patient-derived human breast cancer xenograft models. Cancer Res. 2013, 73, 4885–4897. [Google Scholar] [CrossRef] [Green Version]
- Clarke, R. Human breast cancer cell line xenografts as models of breast cancer. The immunobiologies of recipient mice and the characteristics of several tumorigenic cell lines. Breast Cancer Res. Treat. 1996, 39, 69–86. [Google Scholar] [CrossRef]
- Cheung, N.K.; Modak, S. Oral (1-->3),(1-->4)-beta-D-glucan synergizes with antiganglioside GD2 monoclonal antibody 3F8 in the therapy of neuroblastoma. Clin. Cancer Res. 2002, 8, 1217–1223. [Google Scholar] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mallik, P.K.; Nishikawa, K.; Mallik, P.; Shi, H. Complement-Mediated Selective Tumor Cell Lysis Enabled by Bi-Functional RNA Aptamers. Genes 2022, 13, 86. https://doi.org/10.3390/genes13010086
Mallik PK, Nishikawa K, Mallik P, Shi H. Complement-Mediated Selective Tumor Cell Lysis Enabled by Bi-Functional RNA Aptamers. Genes. 2022; 13(1):86. https://doi.org/10.3390/genes13010086
Chicago/Turabian StyleMallik, Prabhat K., Kimi Nishikawa, Pramit Mallik, and Hua Shi. 2022. "Complement-Mediated Selective Tumor Cell Lysis Enabled by Bi-Functional RNA Aptamers" Genes 13, no. 1: 86. https://doi.org/10.3390/genes13010086