Expression and Variations in EPAS1 Associated with Oxygen Metabolism in Sheep
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Data Collection
2.2. Blood Gas Indicator Measurement
2.3. Primers for PCR and RT-qPCR
2.4. Amplification of Ovine EPAS1
2.5. Screening for Variation and Sequencing of Variants
2.6. Real-Time Quantitative PCR (RT-qPCR) Analysis
2.7. Statistical Analyses
3. Results
3.1. Variation in Ovine EPAS1
3.2. Comparison of Allele and Genotype Frequencies between Tibetan Sheep and Hu Sheep
3.3. Effect of Breed and Gender on Blood Gas in Sheep
3.4. Effect of Variation in EPAS1 on Blood Gas
3.5. Expression of EPAS1 in Hu Sheep and Tibetan Sheep from Different Altitudes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Choudhry, H.; Harris, A.L. Advances in hypoxia-inducible factor biology. Cell Metab. 2018, 27, 281–298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schödel, J.; Grampp, S.; Maher, E.R.; Moch, H.; Ratcliffe, P.J.; Russo, P.; Mole, D.R. Hypoxia, hypoxia-inducible transcription factors, and renal cancer. Eur. Urol. 2016, 69, 646–657. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schofield, C.J.; Ratcliffe, P.J. Oxygen sensing by HIF hydroxylases. Nat. Rev. Mol. Cell Biol. 2004, 5, 343–354. [Google Scholar] [CrossRef] [PubMed]
- Erbel, P.J.; Card, P.B.; Karakuzu, O.; Bruick, R.K.; Gardner, K.H. Structural basis for PAS domain heterodimerization in the basic helix--loop--helix-PAS transcription factor hypoxia-inducible factor. Proc. Natl. Acad. Sci. USA 2003, 100, 15504–15509. [Google Scholar] [CrossRef] [Green Version]
- Tian, H.; Hammer, R.E.; Matsumoto, A.M.; Russell, D.W.; McKnight, S.L. The hypoxia-responsive transcription factor EPAS1 is essential for catecholamine homeostasis and protection against heart failure during embryonic development. Genes Dev. 1998, 12, 3320–3324. [Google Scholar] [CrossRef] [Green Version]
- Wu, D.-D.; Yang, C.-P.; Wang, M.-S.; Dong, K.-Z.; Yan, D.-W.; Hao, Z.-Q.; Fan, S.-Q.; Chu, S.-Z.; Shen, Q.-S.; Jiang, L.-P.; et al. Convergent genomic signatures of high-altitude adaptation among domestic mammals. Natl. Sci. Rev. 2020, 7, 952–963. [Google Scholar] [CrossRef] [Green Version]
- Wei, C.; Wang, H.; Liu, G.; Zhao, F.; Kijas, J.W.; Ma, Y.; Lu, J.; Zhang, L.; Cao, J.; Wu, M.; et al. Genome-wide analysis reveals adaptation to high altitudes in Tibetan sheep. Sci. Rep. 2016, 6, 26770. [Google Scholar] [CrossRef] [Green Version]
- Yi, X.; Liang, Y.; Huerta-Sanchez, E.; Jin, X.; Cuo, Z.X.; Pool, J.E.; Xu, X.; Jiang, H.; Vinckenbosch, N.; Korneliussen, T.S.; et al. Sequencing of 50 human exomes reveals adaptation to high altitude. Science 2010, 329, 75–78. [Google Scholar] [CrossRef] [Green Version]
- Hanaoka, M.; Droma, Y.; Basnyat, B.; Ito, M.; Kobayashi, N.; Katsuyama, Y.; Kubo, K.; Ota, M. Genetic variants in EPAS1 contribute to adaptation to high-altitude hypoxia in Sherpas. PLoS ONE 2012, 7, e50566. [Google Scholar] [CrossRef]
- Peng, Y.; Cui, C.; He, Y.; Ouzhuluobu Zhang, H.; Yang, D.; Zhang, Q.; Bianbazhuoma Yang, L.; He, Y.; Xiang , K.; Zhang , X.; et al. Down-regulation of EPAS1 transcription and genetic adaptation of Tibetans to high-altitude hypoxia. Mol. Biol. Evol. 2017, 34, 818–830. [Google Scholar] [CrossRef]
- Zhou, H.; Hickford, J.G.; Fang, Q. A two-step procedure for extracting genomic DNA from dried blood spots on filter paper for polymerase chain reaction amplification. Anal. Biochem. 2006, 354, 159–161. [Google Scholar] [CrossRef] [PubMed]
- Lichtman, M.A.; Murphy, M.S.; Adamson, J.W. Detection of mutant hemoglobins with altered affinity for oxygen. A simplified technique. Ann. Intern. Med. 1976, 84, 517–520. [Google Scholar] [CrossRef] [PubMed]
- Tashi, T.; Feng, T.; Koul, P.; Amaru, R.; Hussey, D.; Lorenzo, F.R.; RiLi, G.; Prchal, J.T. High altitude genetic adaptation in Tibetans: No role of increased hemoglobin-oxygen affinity. Blood Cells Mol. Dis. 2014, 53, 27–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Byun, S.O.; Fang, Q.; Zhou, H.; Hickford, J.G. An effective method for silver-staining DNA in large numbers of polyacrylamide gels. Anal. Biochem. 2009, 385, 174–175. [Google Scholar] [CrossRef] [PubMed]
- Gong, H.; Zhou, H.; Dyer, J.M.; Hickford, J.G. Identification of the ovine KAP11-1 gene (KRTAP11-1) and genetic variation in its coding sequence. Mol. Biol. Rep. 2011, 38, 5429–5433. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhao, P.; He, Z.; Xi, Q.; Sun, H.; Luo, Y.; Wang, J.; Liu, X.; Zhao, Z.; Li, S. Variations in HIF-1α contributed to high altitude hypoxia adaptation via affected oxygen metabolism in Tibetan sheep. Animals 2021, 12, 58. [Google Scholar] [CrossRef]
- Xu, X.H.; Huang, X.W.; Qun, L.; Li, Y.N.; Wang, Y.; Liu, C.; Ma, Y.; Liu, Q.M.; Sun, K.; Qian, F.; et al. Two functional loci in the promoter of EPAS1 gene involved in high-altitude adaptation of Tibetans. Sci. Rep. 2014, 4, 7465. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.H.; Shen, Y.; Liu, C.; Yang, J.; Yang, Y.Q.; Zhang, C.; Bian, S.Z.; Yu, J.; Gao, X.B.; Zhang, L.P.; et al. EPAS1 and VEGFA gene variants are related to the symptoms of acute mountain sickness in Chinese Han population: A cross-sectional study. Mil. Med. Res. 2020, 7, 35. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, Y.; Li, Y.; Pan, J.; Wang, D.; Chen, W.; Zheng, Z.; He, X.; Zhao, Q.; Pu, Y.; et al. EPAS1 gain-of-function mutation contributes to high-altitude adaptation in Tibetan horses. Mol. Biol. Evol. 2019, 36, 2591–2603. [Google Scholar] [CrossRef]
- Zhuang, Z.; Yang, C.; Lorenzo, F.; Merino, M.; Fojo, T.; Kebebew, E.; Popovic, V.; Stratakis, C.A.; Prchal, J.T.; Pacak, K. Somatic HIF2A gain-of-function mutations in paraganglioma with polycythemia. N. Engl. J. Med. 2012, 367, 922–930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, C.; Sun, M.G.; Matro, J.; Huynh, T.T.; Rahimpour, S.; Prchal, J.T.; Lechan, R.; Lonser, R.; Pacak, K.; Zhuang, Z. Novel HIF2A mutations disrupt oxygen sensing, leading to polycythemia, paragangliomas, and somatostatinomas. Blood 2013, 121, 2563–2566. [Google Scholar] [CrossRef] [PubMed]
- Beall, C.M. Two routes to functional adaptation: Tibetan and Andean high-altitude natives. Proc. Natl. Acad. Sci. USA 2007, 104, 8655–8660. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wen, Y.; Li, S.; Zhao, F.; Wang, J.; Liu, X.; Hu, J.; Bao, G.; Luo, Y. Changes in the mitochondrial dynamics and functions together with the mRNA/miRNA network in the heart tissue contribute to hypoxia adaptation in Tibetan sheep. Animals 2022, 12, 583. [Google Scholar] [CrossRef]
- Girard, P.; Angers, B. The functional gene diversity in natural populations over postglacial areas: The shaping mechanisms behind genetic composition of longnose dace (Rhinichthys cataractae) in northeastern North America. J. Mol. Evol. 2011, 73, 45–57. [Google Scholar] [CrossRef] [PubMed]
- Dong, K.; Kang, Y.; Yao, N.; Shu, G.; Zuo, Q.; Zhao, Q.; Ma, Y. Genetic variation of EPAS1 gene in Tibetan pigs and three low-altitude pig breeds in China. JIA 2014, 13, 1990–1998. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Jiang, C.; Luo, Y.; Liu, F.; Gao, Y. An EPAS1 haplotype is associated with high altitude polycythemia in male Han Chinese at the Qinghai-Tibetan plateau. Wilderness Environ. Med. 2014, 25, 392–400. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Hu, S.; Maslov, K.; Zhang, Y.; Xia, Y.; Wang, L.V. In vivo integrated photoacoustic and confocal microscopy of hemoglobin oxygen saturation and oxygen partial pressure. Opt. Lett. 2011, 36, 1029–1031. [Google Scholar] [CrossRef] [Green Version]
- Hu, C.J.; Sataur, A.; Wang, L.; Chen, H.; Simon, M.C. The N-terminal transactivation domain confers target gene specificity of hypoxia-inducible factors HIF-1alpha and HIF-2alpha. Mol. Biol. Cell 2007, 18, 4528–4542. [Google Scholar] [CrossRef] [Green Version]
- Hurst, L. The sound of silence. Nature 2011, 471, 582–583. [Google Scholar] [CrossRef]
- Wu, X.; Ding, X.; Chu, M.; Guo, X.; Bao, P.; Liang, C.; Yan, P. Novel SNP of EPAS1 gene associated with higher hemoglobin concentration revealed the hypoxia adaptation of yak (Bos grunniens). JIA 2015, 14, 741–748. [Google Scholar] [CrossRef]
- Noonan, H.R.; Metelo, A.M.; Kamei, C.N.; Peterson, R.T.; Drummond, I.A.; Iliopoulos, O. Loss of vhl in the zebrafish pronephros recapitulates early stages of human clear cell renal cell carcinoma. Dis. Model. Mech. 2016, 9, 873–884. [Google Scholar] [CrossRef] [Green Version]
- Han, S.S.; Yeager, M.; Moore, L.E.; Wei, M.H.; Pfeiffer, R.; Toure, O.; Purdue, M.P.; Johansson, M.; Scelo, G.; Chung, C.C.; et al. The chromosome 2p21 region harbors a complex genetic architecture for association with risk for renal cell carcinoma. Hum. Mol. Genet. 2012, 21, 1190–1200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, C.; Li, X.; Xiao, J.; Liu, J.; Fan, X.; Fan, F.; Lei, H. Genetic changes in the EPAS1 gene between Tibetan and Han ethnic groups and adaptation to the plateau hypoxic environment. PeerJ 2019, 7, e7943. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′ → 3′) | Product Size (bp) | Annealing Temperature/°C | Purpose |
---|---|---|---|---|
EPAS1 | F: GAGAGGACTTCCAGCTTAGC R: TCCCCTATGCAGCCCAGC | 470 | 61 | PCR |
EPAS1 | F: CCTCTCACAGCACCTTCCTC R: GCCACTGTGTGCTGGATATG | 122 | 60 | RT-qPCR |
β-actin | F: AGCCTTCCTTCCTGGGCATGGA R: GGACAGCACCGTGTTGGCGTAGA | 113 | 60 | RT-qPCR |
Location | A | B | C | D | Ammo Acid Change |
---|---|---|---|---|---|
c.1641 | G | G | A | A | no change |
c.1674 | G | G | C | G | no change |
c.1816 | T | T | C | T | p.F606L |
c.1824 | T | C | C | C | no change |
c.2028 | G | G | A | G | no change |
c.2039+14 | G | G | A | G | no change |
Breeds | n | Genotype Frequency (%) | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
AA | BB | CC | DD | AB | AC | AD | BC | BD | CD | ||
Tibetan sheep | 332 | 0.30 | 83.13 | 0 | 0 | 7.23 | 0.9 | 0.3 | 3.31 | 4.22 | 0.60 |
Hu sheep | 339 | 8.85 | 9.73 | 1.77 | 5.01 | 16.22 | 7.96 | 13.57 | 12.98 | 15.93 | 7.96 |
pCO2 | pO2 | sO2 | p50 | ||
---|---|---|---|---|---|
breeds | Tibetan sheep (n = 176) | 39.819 ± 0.926 B | 34.820 ± 1.050 B | 64.710 ± 1.430 B | 26.435 ± 0.129 |
Hu sheep (n = 231) | 42.235 ± 0.592 A | 42.212 ± 0.669 A | 76.553 ± 0.916 A | 26.615 ± 0.082 | |
1 Gender | Male (n = 134) | 39.996 ± 0.880 B | 37.804 ± 0.994 | 70.400 ± 1.360 | 26.532 ± 0.122 |
Female (n = 42) | 42.058 ± 0.589 A | 39.227 ± 0.667 | 70.862 ± 0.913 | 26.519 ± 0.081 |
Blood Gas | Variant | Absent | Present | p1 | ||
---|---|---|---|---|---|---|
Mean ± SE | n | Mean ± SE | n | |||
pCO2 | A | 40.416 ± 0.454 | 271 | 40.830 ± 0.645 | 136 | 0.568 |
B | 41.530 ± 0.730 | 107 | 40.253 ± 0.435 | 300 | 0.107 | |
C | 40.497 ± 0.417 | 328 | 40.783 ± 0.798 | 79 | 0.726 | |
D | 40.528 ± 0.436 | 306 | 40.583 ± 0.708 | 101 | 0.943 | |
pO2 | A | 37.517 ± 0.509 | 271 | 39.514 ± 0.725 | 135 | 0.015 |
B | 38.050 ± 0.833 | 106 | 38.133 ± 0.493 | 300 | 0.927 | |
C | 38.250 ± 0.471 | 327 | 37.364 ± 0.900 | 79 | 0.337 | |
D | 38.417 ± 0.491 | 305 | 37.114 ± 0.799 | 101 | 0.132 | |
sO2 | A | 64.639 ± 0.907 | 271 | 71.798 ± 0.991 | 135 | 0.039 |
B | 70.160 ± 1.140 | 106 | 70.187 ± 0.672 | 300 | 0.983 | |
C | 70.251 ± 0.643 | 327 | 69.800 ± 1.230 | 79 | 0.717 | |
D | 70.449 ± 0.671 | 305 | 69.300 ± 1.090 | 101 | 0.329 | |
p50 | A | 26.695 ± 0.063 | 271 | 26.537 ± 0.089 | 135 | 0.133 |
B | 26.564 ± 0.102 | 106 | 26.671 ± 0.060 | 300 | 0.329 | |
C | 26.640 ± 0.058 | 327 | 26.689 ± 0.110 | 79 | 0.666 | |
D | 26.662 ± 0.060 | 305 | 26.601 ± 0.098 | 101 | 0.567 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xi, Q.; Zhao, F.; Hu, J.; Wang, J.; Liu, X.; Dang, P.; Luo, Y.; Li, S. Expression and Variations in EPAS1 Associated with Oxygen Metabolism in Sheep. Genes 2022, 13, 1871. https://doi.org/10.3390/genes13101871
Xi Q, Zhao F, Hu J, Wang J, Liu X, Dang P, Luo Y, Li S. Expression and Variations in EPAS1 Associated with Oxygen Metabolism in Sheep. Genes. 2022; 13(10):1871. https://doi.org/10.3390/genes13101871
Chicago/Turabian StyleXi, Qiming, Fangfang Zhao, Jiang Hu, Jiqing Wang, Xiu Liu, Pengju Dang, Yuzhu Luo, and Shaobin Li. 2022. "Expression and Variations in EPAS1 Associated with Oxygen Metabolism in Sheep" Genes 13, no. 10: 1871. https://doi.org/10.3390/genes13101871