NuMY—A qPCR Assay Simultaneously Targeting Human Autosomal, Y-Chromosomal, and Mitochondrial DNA
Abstract
:1. Introduction
2. Materials and Methods
2.1. Assay Design and qPCR Settings
2.2. Samples
2.2.1. DNA Standards and Calibration Curves
2.2.2. DNA Controls
2.2.3. Model Inhibitors
2.2.4. Challenging Samples
2.2.5. Mixtures
2.3. Data Analysis
3. Results and Discussion
3.1. In Silico Characterization of the Quantification Modules
3.2. Single- vs. Multiplex Assay Performance
3.3. Working Range, PCR Efficiency, and Replicate Variation in Standard Curves
3.4. Performance with High-Quality DNA Templates
3.5. PCR Inhibitors
3.6. Challenging Biological Samples
3.7. DNA Mixtures
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Al-Asfi, M.; McNevin, D.; Mehta, B.; Power, D.; Gahan, M.E.; Daniel, R. Assessment of the Precision ID Ancestry panel. Int. J. Leg. Med. 2018, 132, 1581–1594. [Google Scholar] [CrossRef] [PubMed]
- Eduardoff, M.; Santos, C.; de la Puente, M.; Gross, T.E.; Fondevila, M.; Strobl, C.; Sobrino, B.; Ballard, D.; Schneider, P.M.; Carracedo, Á.; et al. Inter-laboratory evaluation of SNP-based forensic identification by massively parallel sequencing using the Ion PGMTM. Forensic Sci. Int. Genet. 2015, 17, 110–121. [Google Scholar] [CrossRef] [PubMed]
- Ralf, A.; van Oven, M.; González, D.M.; de Knijff, P.; van der Beek, K.; Wootton, S.; Lagacé, R.; Kayser, M. Forensic Y-SNP analysis beyond SNaPshot: High-resolution Y-chromosomal haplogrouping from low quality and quantity DNA using Ion AmpliSeq and targeted massively parallel sequencing. Forensic Sci. Int. Genet. 2019, 41, 93–106. [Google Scholar] [CrossRef] [PubMed]
- Strobl, C.; Cihlar, J.C.; Lagacé, R.; Wootton, S.; Roth, C.; Huber, N.; Schnaller, L.; Zimmermann, B.; Huber, G.; Hong, S.L.; et al. Evaluation of mitogenome sequence concordance, heteroplasmy detection, and haplogrouping in a worldwide lineage study using the Precision ID mtDNA Whole Genome Panel. Forensic Sci. Int. Genet. 2019, 42, 244–251. [Google Scholar] [CrossRef] [PubMed]
- Diepenbroek, M.; Bayer, B.; Schwender, K.; Schiller, R.; Lim, J.; Lagacé, R.; Anslinger, K. Evaluation of the Ion AmpliSeqTM PhenoTrivium Panel: MPS-Based Assay for Ancestry and Phenotype Predictions Challenged by Casework Samples. Genes 2020, 11, 1398. [Google Scholar] [CrossRef] [PubMed]
- Tillmar, A.; Sturk-Andreaggi, K.; Daniels-Higginbotham, J.; Thomas, J.T.; Marshall, C. The FORCE Panel: An All-in-One SNP Marker Set for Confirming Investigative Genetic Genealogy Leads and for General Forensic Applications. Genes 2021, 12, 1968. [Google Scholar] [CrossRef] [PubMed]
- Xavier, C.; de la Puente, M.; Mosquera-Miguel, A.; Freire-Aradas, A.; Kalamara, V.; Ralf, A.; Revoir, A.; Gross, T.E.; Schneider, P.M.; Ames, C.; et al. Development and inter-laboratory evaluation of the VISAGE Enhanced Tool for Appearance and Ancestry inference from DNA. Forensic Sci. Int. Genet. 2022, 61, 102779. [Google Scholar] [CrossRef]
- Thermo Fisher Scientific. QuantifilerTM HP and Trio DNA Quantification Kits. Available online: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/4485356_Quantifiler_HP_Trio_DNA_QR.pdf (accessed on 15 August 2023).
- Krenke, B.; Nassif, N.; Sprecher, C.; Knox, C.; Schwandt, M.; Storts, D. Developmental validation of a real-time PCR assay for the simultaneous quantification of total human and male DNA. Forensic Sci. Int. Genet. 2008, 1, 14–21. [Google Scholar] [CrossRef]
- ScienCell. Absolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qPCR Assay Kit. Available online: https://sciencellonline.com/absolute-human-telomere-length-and-mitochondrial-dna-copy-number-dual-quantification-qpcr-assay-kit/ (accessed on 15 August 2023).
- Sigma-Aldrich. NovaQUANTTM Human Mitochondrial to Nuclear DNA Ratio Kit. Available online: https://www.sigmaaldrich.com/AT/de/product/mm/72620m (accessed on 15 August 2023).
- Takara Bio Inc. Human Mitochondrial DNA (mtDNA) Monitoring Primer Set. Available online: https://www.takarabio.com/products/stem-cell-research/accessories/human-mitochondrial-dna-monitoring (accessed on 15 August 2023).
- Andréasson, H.; Gyllensten, U.; Allen, M. Real-Time DNA Quantification of Nuclear and Mitochondrial DNA in Forensic Analysis. BioTechniques 2002, 33, 402–411. [Google Scholar] [CrossRef]
- Alonso, A. Real-time PCR designs to estimate nuclear and mitochondrial DNA copy number in forensic and ancient DNA studies. Forensic Sci. Int. 2004, 139, 141–149. [Google Scholar] [CrossRef]
- Walker, J.A.; Hedges, D.J.; Perodeau, B.P.; Landry, K.E.; Stoilova, N.; Laborde, M.E.; Shewale, J.; Sinha, S.K.; Batzer, M.A. Multiplex polymerase chain reaction for simultaneous quantitation of human nuclear, mitochondrial, and male Y-chromosome DNA: Application in human identification. Anal. Biochem. 2005, 337, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Niederstätter, H.; Köchl, S.; Grubwieser, P.; Pavlic, M.; Steinlechner, M.; Parson, W. A modular real-time PCR concept for determining the quantity and quality of human nuclear and mitochondrial DNA. Forensic Sci. Int. Genet. 2007, 1, 29–34. [Google Scholar] [CrossRef] [PubMed]
- Kavlick, M.F.; Lawrence, H.S.; Merritt, R.T.; Fisher, C.; Isenberg, A.; Robertson, J.M.; Budowle, B. Quantification of Human Mitochondrial DNA Using Synthesized DNA Standards*. J. Forensic Sci. 2011, 56, 1457–1463. [Google Scholar] [CrossRef] [PubMed]
- Sprouse, M.L.; Phillips, N.R.; Kavlick, M.F.; Roby, R.K. Internal Validation of Human Mitochondrial DNA Quantification Using Real-Time PCR. J. Forensic Sci. 2014, 59, 1049–1056. [Google Scholar] [CrossRef] [PubMed]
- Goodwin, C.; Higgins, D.; Tobe, S.S.; Austin, J.; Wotherspoon, A.; Gahan, M.E.; McNevin, D. Singleplex quantitative real-time PCR for the assessment of human mitochondrial DNA quantity and quality. Forensic Sci. Med. Pathol. 2018, 14, 70–75. [Google Scholar] [CrossRef] [PubMed]
- Fazzini, F.; Schöpf, B.; Blatzer, M.; Coassin, S.; Hicks, A.A.; Kronenberg, F.; Fendt, L. Plasmid-normalized quantification of relative mitochondrial DNA copy number. Sci. Rep. 2018, 8, 15347. [Google Scholar] [CrossRef] [PubMed]
- Kavlick, M.F. Development of a triplex mtDNA qPCR assay to assess quantification, degradation, inhibition, and amplification target copy numbers. Mitochondrion 2019, 46, 41–50. [Google Scholar] [CrossRef] [PubMed]
- Xavier, C.; Eduardoff, M.; Strobl, C.; Parson, W. SD quants—Sensitive detection tetraplex-system for nuclear and mitochondrial DNA quantification and degradation inference. Forensic Sci. Int. Genet. 2019, 42, 39–44. [Google Scholar] [CrossRef]
- Fujii, K.; Mita, Y.; Watahiki, H.; Fukagawa, T.; Kitayama, T.; Mizuno, N.; Nakahara, H.; Sekiguchi, K. Development and validation of a SYBR green-based mitochondrial DNA quantification method by following the MIQE and other guidelines. Leg. Med. 2022, 58, 102096. [Google Scholar] [CrossRef]
- Jin, S.; Lin, X.M.; Law, H.; Kwek, K.Y.C.; Yeo, G.S.H.; Ding, C. Further Improvement in Quantifying Male Fetal DNA in Maternal Plasma. Clin. Chem. 2012, 58, 465–468. [Google Scholar] [CrossRef]
- Timken, M.D.; Swango, K.L.; Orrego, C.; Chong, M.D.; Buoncristiani, M.R. Quantitation of DNA for Forensic DNA Typing by qPCR. Final. Grant Rep. Calif. Dep. Justice 2005, 1–89. Available online: https://www.semanticscholar.org/paper/Document-Title%3A-Quantitation-of-DNA-for-Forensic-by-Timken-Swango/ecdcaa8bb21ae34cd22accbd153307145b6a0fff (accessed on 15 August 2023).
- Bauer, C.M.; Niederstätter, H.; McGlynn, G.; Stadler, H.; Parson, W. Comparison of morphological and molecular genetic sex-typing on mediaeval human skeletal remains. Forensic Sci. Int. Genet. 2013, 7, 581–586. [Google Scholar] [CrossRef] [PubMed]
- Casas-Vargas, A.; Romero, L.M.; Usaquén, W.; Zea, S.; Silva, M.; Briceño, I.; Gómez, A.; Rodríguez, J.V. Mitochondrial DNA diversity in prehispanic bone remains on the eastern Colombian Andes. Biomedica 2017, 37, 548. [Google Scholar] [CrossRef] [PubMed]
- Loreille, O.M.; Diegoli, T.M.; Irwin, J.A.; Coble, M.D.; Parsons, T.J. High efficiency DNA extraction from bone by total demineralization. Forensic Sci. Int. Genet. 2007, 1, 191–195. [Google Scholar] [CrossRef] [PubMed]
- Amory, S.; Huel, R.; Bilić, A.; Loreille, O.; Parsons, T.J. Automatable full demineralization DNA extraction procedure from degraded skeletal remains. Forensic Sci. Int. Genet. 2012, 6, 398–406. [Google Scholar] [CrossRef] [PubMed]
- Dabney, J.; Knapp, M.; Glocke, I.; Gansauge, M.-T.; Weihmann, A.; Nickel, B.; Valdiosera, C.; García, N.; Pääbo, S.; Arsuaga, J.-L.; et al. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proc. Natl. Acad. Sci. USA 2013, 110, 15758–15763. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing. 2021. Available online: https://www.R-project.org/ (accessed on 15 August 2023).
- Wickham, H. ggplot2: Elegant Graphics for Data Analysis, 2nd ed.; Springer International Publishing: Cham, Switzerland, 2016. [Google Scholar] [CrossRef]
- Wright, S.E. Using DECIPHER v2.0 to Analyze Big Biological Sequence Data in R. R J. 2016, 8, 352–359. [Google Scholar] [CrossRef]
- Team TBD. BSgenome.Hsapiens.UCSC.hg38: Full Genomic Sequences for Homo sapiens (UCSC genome hg38). 2023. Available online: https://bioconductor.org/packages/release/data/annotation/html/BSgenome.Hsapiens.UCSC.hg38.html (accessed on 15 August 2023).
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Taylor, S.; Wakem, M.; Dijkman, G.; Alsarraj, M.; Nguyen, M. A practical approach to RT-qPCR—Publishing data that conform to the MIQE guidelines. Methods 2010, 50, S1–S5. [Google Scholar] [CrossRef]
- Van Arsdell, S.W.; Weiner, A.M. Human genes for U2 small nuclear RNA are tandemly repeated. Mol. Cell. Biol. 1984, 4, 492–499. [Google Scholar] [CrossRef]
- Massaia, A.; Xue, Y.; Human, Y. chromosome copy number variation in the next generation sequencing era and beyond. Hum. Genet. 2017, 136, 591–603. [Google Scholar] [CrossRef] [PubMed]
- Sidstedt, M.; Steffen, C.R.; Kiesler, K.M.; Vallone, P.M.; Rådström, P.; Hedman, J. The impact of common PCR inhibitors on forensic MPS analysis. Forensic Sci. Int. Genet. 2019, 40, 182–191. [Google Scholar] [CrossRef] [PubMed]
- Xavier, C.; de la Puente, M.; Mosquera-Miguel, A.; Freire-Aradas, A.; Kalamara, V.; Vidaki, A.; Gross, T.E.; Revoir, A.; Pośpiech, E.; Kartasińska, E.; et al. Development and validation of the VISAGE AmpliSeq basic tool to predict appearance and ancestry from DNA. Forensic Sci. Int. Genet. 2020, 48, 102336. [Google Scholar] [CrossRef] [PubMed]
- Xavier, C.; de la Puente, M.; Sidstedt, M.; Junker, K.; Minawi, A.; Unterländer, M.; Chantrel, Y.; Laurent, F.-X.; Delest, A.; Hohoff, C.; et al. Evaluation of the VISAGE basic tool for appearance and ancestry inference using ForenSeq® chemistry on the MiSeq FGx® system. Forensic Sci. Int. Genet. 2022, 58, 102675. [Google Scholar] [CrossRef] [PubMed]
- Opel, K.L.; Chung, D.; McCord, B.R. A Study of PCR Inhibition Mechanisms Using Real Time PCR. J. Forensic Sci. 2010, 55, 25–33. [Google Scholar] [CrossRef] [PubMed]
- Parson, W.; Huber, G.; Moreno, L.; Madel, M.-B.; Brandhagen, M.D.; Nagl, S.; Xavier, C.; Eduardoff, M.; Callaghan, T.C.; Irwin, J.A. Massively parallel sequencing of complete mitochondrial genomes from hair shaft samples. Forensic Sci. Int. Genet. 2015, 15, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Xavier, C.; Eduardoff, M.; Bertoglio, B.; Amory, C.; Berger, C.; Casas-Vargas, A.; Pallua, J.; Parson, W. Evaluation of DNA Extraction Methods Developed for Forensic and Ancient DNA Applications Using Bone Samples of Different Age. Genes 2021, 12, 146. [Google Scholar] [CrossRef]
Target | Size [bp] | Type | Sequence | Final Concentration |
---|---|---|---|---|
nuRNU | 70 | Forward | GGATTTTTGGAGCAGGGAGA | 900 nM |
Reverse | CTGCAATACCAGGTCGATGC | 900 nM | ||
Probe | FAM GAGCTTGCTCCGTCCACTCC BHQ-1 | 500 nM | ||
YRS | 117 | Forward | AGTGTTACAGCACTTAAAGGTGT | 600 nM |
Reverse | AGGTCTGCAGCTTCATTCT | 600 nM | ||
Probe | NED TCTTGCTCACTTCAA NFQ/MGB | 400 nM | ||
mtND1 | 69 | Forward | CCCTAAAACCCGCCACATCT | 150 nM |
Reverse | GAGCGATGGTGAGAGCTAAGGT | 150 nM | ||
Probe | VIC CCATCACCCTCTACATC NFQ/MGB | 80 nM | ||
IPC | 69 | Forward | ATCAGCTTAGCGTGCAGTCA | 100 nM |
Reverse | TCTTCGTCGTAACGGTGAGC | 100 nM | ||
Probe | Cy5 GTTGCACTACTTCAGCGTCCCA BHQ-2 | 100 nM | ||
Template | ATCAGCTTAGCGTGCAGTCAGATAATGTTGCACTAC TTCAGCGTCCCAAGCTCACCGTTACGACGAAGAG | 2.5 fM |
Type | Sample | Ratio nuRNU/YRS |
---|---|---|
Control | 2800M | 1.82 |
007 | 0.58 | |
Coriell | NA07029 | 1.92 |
NA06994 | 1.01 | |
NA07000 | female | |
NA10540 | 1.99 | |
NA11200 | 0.46 | |
NA18498 | 2.3 | |
Mock casework | GEDNAP_42-S3 | female |
GEDNAP_44-S3 | female | |
GEDNAP_45-S2 | 2.14 | |
GEDNAP_48-S4 | female | |
GEDNAP_49-S2 | female | |
GEDNAP_49-S4 | 1.38 | |
GEDNAP_53-S6 | 0.64 | |
Bone | Bone_30Y-O | 5.04 |
Bone_30Y-N | 16.87 | |
Bone_2000Y-O | 41.81 | |
Bone_2000Y-N | n.a. | |
Bone_800Y-O | 5.55 | |
Bone_800Y-N | 7.74 | |
Hair root | Hair_root_male1 | 1.23 |
Hair_root_male2 | 1.31 | |
Hair_root_male3 | 0.69 | |
Hair_root_female1 | female | |
Hair_root_female2 | female | |
Hair shaft | Hair_shaft_male3 | 4.55 |
Hair_shaft_female2 | female | |
Mixture | Mix_1:1 | 1.92 |
Mix_1:4 | 5.43 | |
Mix_1:9 | 11.06 | |
Mix_1:19 | 26.56 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xavier, C.; Sutter, C.; Amory, C.; Niederstätter, H.; Parson, W. NuMY—A qPCR Assay Simultaneously Targeting Human Autosomal, Y-Chromosomal, and Mitochondrial DNA. Genes 2023, 14, 1645. https://doi.org/10.3390/genes14081645
Xavier C, Sutter C, Amory C, Niederstätter H, Parson W. NuMY—A qPCR Assay Simultaneously Targeting Human Autosomal, Y-Chromosomal, and Mitochondrial DNA. Genes. 2023; 14(8):1645. https://doi.org/10.3390/genes14081645
Chicago/Turabian StyleXavier, Catarina, Charlotte Sutter, Christina Amory, Harald Niederstätter, and Walther Parson. 2023. "NuMY—A qPCR Assay Simultaneously Targeting Human Autosomal, Y-Chromosomal, and Mitochondrial DNA" Genes 14, no. 8: 1645. https://doi.org/10.3390/genes14081645