Injectable Cell-Laden Nanofibrous Matrix for Treating Annulus Fibrosus Defects in Porcine Model: An Organ Culture Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Porcine Intervertebral Disc Isolation
2.2. X-ray Guided Intervertebral Disc Defect Creation
2.3. Synthesis of Cell-Laden Injectable Nanofibrous Scaffold and Implementation to the Defect Site
2.4. Ex Vivo IVD Organ Culture
2.5. Structural and Morphological Characterization
2.5.1. Scanning Electron Microscopy Analysis of Cell-Laden Injectable Tissue Scaffold
2.5.2. Histological Analysis of IVDs following the Organ Culturing
2.5.3. MRI Analysis of IVDs following the Organ Culturing
2.6. Biological Characterization
2.6.1. Cell Viability Analysis
2.6.2. Gene Expression Analysis
2.7. Statistical Analysis
3. Results
3.1. Confirmation of Annulus Fibrosus Damage Creation
3.2. Structure of Fibrous Cell-Laden PNCOL Scaffold and Cell Viability
3.3. Cell Viability within the IVD Organ Culture
3.4. Optical and Histological-Based AF Tissue Regeneration Analysis
3.5. MRI Analysis
3.6. Molecular Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Frauchiger, D.A.; Chan, S.C.W.; Benneker, L.M.; Gantenbein, B. Intervertebral disc damage models in organ culture: A comparison of annulus fibrosus cross-incision versus punch model under complex loading. Eur. Spine J. 2018, 27, 1785–1797. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rickers, K.; Bendtsen, M.; Le, D.Q.S.; Veen, A.J.; Bunger, C.E. Biomechanical evaluation of annulus fibrosus repair with scaffold and soft anchors in an ex vivo porcine model. SICOT J. 2018, 4, 38. [Google Scholar] [CrossRef] [PubMed]
- Takeoka, Y.; Yurube, T.; Morimoto, K.; Kunii, S.; Kanda, Y.; Tsujimoto, R.; Kawakami, Y.; Fukase, N.; Takemori, T.; Omae, K.; et al. Reduced nucleotomy-induced intervertebral disc disruption through spontaneous spheroid formation by the Low Adhesive Scaffold Collagen (LASCol). Biomaterials 2020, 235, 119781. [Google Scholar] [CrossRef] [PubMed]
- Torre, O.M.; Mroz, V.; Benitez, A.R.M.; Huang, A.H.; Iatridis, J.C. Neonatal annulus fibrosus regeneration occurs via recruitment and proliferation of Scleraxis-lineage cells. NPJ Regen. Med. 2019, 4, 23. [Google Scholar] [CrossRef] [Green Version]
- Guillaume, O.; Naqvi, S.M.; Lennon, K.; Buckley, C.T. Enhancing cell migration in shape-memory alginate-collagen composite scaffolds: In vitro and ex vivo assessment for intervertebral disc repair. J. Biomater. Appl. 2015, 29, 1230–1246. [Google Scholar] [CrossRef]
- Sang, C.; Cao, X.; Chen, F.; Yang, X.; Zhang, Y. Differential Characterization of Two Kinds of Stem Cells Isolated from Rabbit Nucleus Pulposus and Annulus Fibrosus. Stem Cells Int. 2016, 2016, 8283257. [Google Scholar] [CrossRef] [Green Version]
- Dewle, A.; Rakshasmare, P.; Srivastava, A. A Polycaprolactone (PCL)-Supported Electrocompacted Aligned Collagen Type-I Patch for Annulus Fibrosus Repair and Regeneration. ACS Appl. Bio Mater. 2021, 4, 1238–1251. [Google Scholar] [CrossRef]
- Alexeev, D.; Cui, S.; Grad, S.; Li, Z.; Ferguson, S.J. Mechanical and biological characterization of a composite annulus fibrosus repair strategy in an endplate delamination model. JOR Spine 2020, 3, e1107. [Google Scholar] [CrossRef]
- Jin, X.; Kang, R.; Deng, R.; Zhao, X.; Wang, Z.; Rong, W.; Xie, L. Fabrication and characterization of an acellular annulus fibrosus scaffold with aligned porous construct for tissue engineering. J. Biomater. Appl. 2022, 36, 985–995. [Google Scholar] [CrossRef]
- Bowles, R.D.; Setton, L.A. Biomaterials for intervertebral disc regeneration and repair. Biomaterials 2017, 129, 54–67. [Google Scholar] [CrossRef]
- Ma, J.; He, Y.; Liu, X.; Chen, W.; Wang, A.; Lin, C.Y.; Mo, X.; Ye, X. A novel electrospun-aligned nanoyarn/three-dimensional porous nanofibrous hybrid scaffold for annulus fibrosus tissue engineering. Int. J. Nanomed. 2018, 13, 1553–1567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanno, H.; Aizawa, T.; Hahimoto, K.; Itoi, E. Minimally invasive discectomy for lumbar disc herniation: Current concepts, surgical techniques, and outcomes. Int. Orthop. 2019, 43, 917–922. [Google Scholar] [CrossRef] [PubMed]
- De Cicco, F.L.; Camino Willhuber, G.O. Nucleus Pulposus Herniation. StatPearls: Treasure Island, FL, USA, 2021. [Google Scholar]
- Li, K.; Kapper, D.; Mondal, S.; Lufkin, T.; Kraus, P. Quantitative Single-Cell Transcript Assessment of Biomarkers Supports Cellular Heterogeneity in the Bovine IVD. Vet. Sci. 2019, 6, 42. [Google Scholar] [CrossRef] [Green Version]
- Xu, G.; Liu, Y.; Zhang, C.; Zhou, Y.; Hou, S.; Tang, J.; Li, Z. Temporal and spatial expression of Sox9, Pax1, TGF-beta1 and type I and II collagen in human intervertebral disc development. Neurochirurgie 2020, 66, 168–173. [Google Scholar] [CrossRef] [PubMed]
- Vergroesen, P.P.; Kingma, I.; Emanuel, K.S.; Hoogendoorn, R.J.; Welting, T.J.; van Royen, B.J.; van Dieen, J.H.; Smit, T.H. Mechanics and biology in intervertebral disc degeneration: A vicious circle. Osteoarthr. Cartil. 2015, 23, 1057–1070. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moriguchi, Y.; Borde, B.; Berlin, C.; Wipplinger, C.; Sloan, S.R.; Kirnaz, S.; Pennicooke, B.; Navarro-Ramirez, R.; Khair, T.; Grunert, P.; et al. In vivo annular repair using high-density collagen gel seeded with annulus fibrosus cells. Acta Biomater. 2018, 79, 230–238. [Google Scholar] [CrossRef] [PubMed]
- Wan, Y.; Feng, G.; Shen, F.H.; Laurencin, C.T.; Li, X. Biphasic scaffold for annulus fibrosus tissue regeneration. Biomaterials 2008, 29, 643–652. [Google Scholar] [CrossRef] [PubMed]
- Hayes, A.J.; Isaacs, M.D.; Hughes, C.; Caterson, B.; Ralphs, J.R. Collagen fibrillogenesis in the development of the annulus fibrosus of the intervertebral disc. Eur. Cell Mater. 2011, 22, 226–241. [Google Scholar] [CrossRef] [PubMed]
- Borem, R.; Madeline, A.; Vela, R., Jr.; Gill, S.; Mercuri, J. Multi-laminate annulus fibrosus repair scaffold with an interlamellar matrix enhances impact resistance, prevents herniation and assists in restoring spinal kinematics. J. Mech. Behav. Biomed. Mater. 2019, 95, 41–52. [Google Scholar] [CrossRef]
- Scheibler, A.G.; Gotschi, T.; Widmer, J.; Holenstein, C.; Steffen, T.; Camenzind, R.S.; Snedeker, J.G.; Farshad, M. Feasibility of the annulus fibrosus repair with in situ gelating hydrogels—A biomechanical study. PLoS ONE 2018, 13, e0208460. [Google Scholar] [CrossRef]
- Zhang, T.; Du, L.; Zhao, J.; Ding, J.; Zhang, P.; Wang, L.; Xu, B. Biomimetic angle-ply multi-lamellar scaffold for annulus fibrosus tissue engineering. J. Mater. Sci. Mater. Med. 2020, 31, 67. [Google Scholar] [CrossRef] [PubMed]
- Nerurkar, N.L.; Baker, B.M.; Sen, S.; Wible, E.E.; Elliott, D.M.; Mauck, R.L. Nanofibrous biologic laminates replicate the form and function of the annulus fibrosus. Nat. Mater. 2009, 8, 986–992. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shamsah, A.H.; Cartmell, S.H.; Richardson, S.M.; Bosworth, L.A. Tissue Engineering the Annulus Fibrosus Using 3D Rings of Electrospun PCL:PLLA Angle-Ply Nanofiber Sheets. Front. Bioeng. Biotechnol. 2019, 7, 437. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Christiani, T.R.; Baroncini, E.; Stanzione, J.; Vernengo, A.J. In vitro evaluation of 3D printed polycaprolactone scaffolds with angle-ply architecture for annulus fibrosus tissue engineering. Regen. Biomater. 2019, 6, 175–184. [Google Scholar] [CrossRef] [PubMed]
- Jin, L.; Liu, Q.; Scott, P.; Zhang, D.; Shen, F.; Balian, G.; Li, X. Annulus fibrosus cell characteristics are a potential source of intervertebral disc pathogenesis. PLoS ONE 2014, 9, e96519. [Google Scholar] [CrossRef] [PubMed]
- McAlinden, A.; Hudson, D.M.; Fernandes, A.A.; Ravindran, S.; Fernandes, R.J. Biochemical and immuno-histochemical localization of type IIA procollagen in annulus fibrosus of mature bovine intervertebral disc. Matrix Biol. Plus 2021, 12, 100077. [Google Scholar] [CrossRef]
- Chu, G.; Shi, C.; Lin, J.; Wang, S.; Wang, H.; Liu, T.; Yang, H.; Li, B. Biomechanics in Annulus Fibrosus Degeneration and Regeneration. Adv. Exp. Med. Biol. 2018, 1078, 409–420. [Google Scholar] [CrossRef]
- Walter, B.A.; Illien-Junger, S.; Nasser, P.R.; Hecht, A.C.; Iatridis, J.C. Development and validation of a bioreactor system for dynamic loading and mechanical characterization of whole human intervertebral discs in organ culture. J. Biomech. 2014, 47, 2095–2101. [Google Scholar] [CrossRef] [Green Version]
- Walter, B.A.; Korecki, C.L.; Purmessur, D.; Roughley, P.J.; Michalek, A.J.; Iatridis, J.C. Complex loading affects intervertebral disc mechanics and biology. Osteoarthr. Cartil. 2011, 19, 1011–1018. [Google Scholar] [CrossRef] [Green Version]
- Khandaker, M.; Kotturi, H.; Progri, H.; Tummala, S.; Nikfarjam, S.; Rao, P.; Hosna, A.; Arasu, D.T.; Williams, W.; Haleem, A.M. In vitroandin vivoeffect of polycaprolactone nanofiber coating on polyethylene glycol diacrylate scaffolds for intervertebral disc repair. Biomed. Mater. 2021, 16, 045024. [Google Scholar] [CrossRef]
- Li, C.; Bai, Q.; Lai, Y.; Tian, J.; Li, J.; Sun, X.; Zhao, Y. Advances and Prospects in Biomaterials for Intervertebral Disk Regeneration. Front. Bioeng. Biotechnol. 2021, 9, 766087. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Yang, X.; Wang, L.; Zhang, W.; Yu, W.; Wang, N.; Peng, B.; Zheng, W.; Yang, G.; Jiang, X. Biomimetic nanofibers can construct effective tissue-engineered intervertebral discs for therapeutic implantation. Nanoscale 2017, 9, 13095–13103. [Google Scholar] [CrossRef] [PubMed]
- Elsaadany, M.; Winters, K.; Adams, S.; Stasuk, A.; Ayan, H.; Yildirim-Ayan, E. Equiaxial Strain Modulates Adipose-derived Stem Cell Differentiation within 3D Biphasic Scaffolds towards Annulus Fibrosus. Sci. Rep. 2017, 7, 12868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gantenbein, B.; Illien-Junger, S.; Chan, S.C.; Walser, J.; Haglund, L.; Ferguson, S.J.; Iatridis, J.C.; Grad, S. Organ culture bioreactors—platforms to study human intervertebral disc degeneration and regenerative therapy. Curr. Stem. Cell. Res. Ther. 2015, 10, 339–352. [Google Scholar] [CrossRef] [Green Version]
- Li, Z.; Gehlen, Y.; Heizmann, F.; Grad, S.; Alini, M.; Richards, R.G.; Kubosch, D.; Sudkamp, N.; Izadpanah, K.; Kubosch, E.J.; et al. Preclinical ex-vivo Testing of Anti-inflammatory Drugs in a Bovine Intervertebral Degenerative Disc Model. Front. Bioeng. Biotechnol. 2020, 8, 583. [Google Scholar] [CrossRef] [PubMed]
- Cui, S.; Zhou, Z.; Chen, X.; Wei, F.; Richards, R.G.; Alini, M.; Grad, S.; Li, Z. Transcriptional profiling of intervertebral disc in a post-traumatic early degeneration organ culture model. JOR Spine 2021, 4, e1146. [Google Scholar] [CrossRef]
- Linde, P.E.; Puttlitz, C.M.; Kisiday, J.D. Adult ovine connective tissue cells resemble mesenchymal stromal cells in their propensity for extensive ex vivo expansion. Connect. Tissue Res. 2021, 62, 671–680. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Zeiter, S.; Schmid, T.; Sakai, D.; Iatridis, J.C.; Zhou, G.; Richards, R.G.; Alini, M.; Grad, S.; Li, Z. Effect of the CCL5-Releasing Fibrin Gel for Intervertebral Disc Regeneration. Cartilage 2020, 11, 169–180. [Google Scholar] [CrossRef]
- Bateman, A.H.; Balkovec, C.; Akens, M.K.; Chan, A.H.; Harrison, R.D.; Oakden, W.; Yee, A.J.; McGill, S.M. Closure of the annulus fibrosus of the intervertebral disc using a novel suture application device-in vivo porcine and ex vivo biomechanical evaluation. Spine J. 2016, 16, 889–895. [Google Scholar] [CrossRef]
- Bialorucki, C.; Subramanian, G.; Elsaadany, M.; Yildirim-Ayan, E. In situ osteoblast mineralization mediates post-injection mechanical properties of osteoconductive material. J. Mech. Behav. Biomed. Mater. 2014, 38, 143–153. [Google Scholar] [CrossRef]
- Baylan, N.; Bhat, S.; Ditto, M.; Lawrence, J.G.; Lecka-Czernik, B.; Yildirim-Ayan, E. Polycaprolactone nanofiber interspersed collagen type-I scaffold for bone regeneration: A unique injectable osteogenic scaffold. Biomed. Mater. 2013, 8, 045011. [Google Scholar] [CrossRef] [PubMed]
- Kanan, M.; Eby, O.; Kelkar, A.; Serhan, H.; Zodak, Y.; Aldoohan, S.; Elsamaloty, H.; Goel, V.; Yildirim-Ayan, E. Electrical Stimulation-Mediated Tissue Healing in Porcine Intervertebral Disc Under Mechanically Dynamic Organ Culture Conditions. Spine 2022, 47, 764–772. [Google Scholar] [CrossRef] [PubMed]
- Daly, C.; Ghosh, P.; Jenkin, G.; Oehme, D.; Goldschlager, T. A Review of Animal Models of Intervertebral Disc Degeneration: Pathophysiology, Regeneration, and Translation to the Clinic. Biomed. Res. Int. 2016, 2016, 5952165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lim, K.Z.; Daly, C.D.; Ghosh, P.; Jenkin, G.; Oehme, D.; Cooper-White, J.; Naidoo, T.; Goldschlager, T. Ovine Lumbar Intervertebral Disc Degeneration Model Utilizing a Lateral Retroperitoneal Drill Bit Injury. J. Vis. Exp. 2017, e55753. [Google Scholar] [CrossRef] [PubMed]
- Long, R.G.; Zderic, I.; Gueorguiev, B.; Ferguson, S.J.; Alini, M.; Grad, S.; Iatridis, J.C. Effects of Level, Loading Rate, Injury and Repair on Biomechanical Response of Ovine Cervical Intervertebral Discs. Ann. Biomed. Eng. 2018, 46, 1911–1920. [Google Scholar] [CrossRef]
- Hom, W.W.; Tschopp, M.; Lin, H.A.; Nasser, P.; Laudier, D.M.; Hecht, A.C.; Nicoll, S.B.; Iatridis, J.C. Composite biomaterial repair strategy to restore biomechanical function and reduce herniation risk in an ex vivo large animal model of intervertebral disc herniation with varying injury severity. PLoS ONE 2019, 14, e0217357. [Google Scholar] [CrossRef]
- Elsaadany, M.; Harris, M.; Yildirim-Ayan, E. Design and Validation of Equiaxial Mechanical Strain Platform, EQUicycler, for 3D Tissue Engineered Constructs. Biomed. Res. Int. 2017, 2017, 3609703. [Google Scholar] [CrossRef] [Green Version]
- del Palomar, A.P.; Calvo, B.; Doblare, M. An accurate finite element model of the cervical spine under quasi-static loading. J. Biomech. 2008, 41, 523–531. [Google Scholar] [CrossRef]
- Jaworski, L.M.; Kleinhans, K.L.; Jackson, A.R. Effects of Oxygen Concentration and Culture Time on Porcine Nucleus Pulposus Cell Metabolism: An in vitro Study. Front. Bioeng. Biotechnol. 2019, 7, 64. [Google Scholar] [CrossRef]
- Kommareddy, M.; McAllister, R.M.; Ganjam, V.K.; Turk, J.R.; Laughlin, M.H. Upregulation of Cyclooxygenase-2 Expression in Porcine Macula Densa With Chronic Nitric Oxide Synthase Inhibition. Vet. Pathol. 2011, 48, 1125–1133. [Google Scholar] [CrossRef]
- Vandenbroucke, V.; Croubels, S.; Martel, A.; Verbrugghe, E.; Goossens, J.; Van Deun, K.; Boyen, F.; Thompson, A.; Shearer, N.; De Backer, P.; et al. The Mycotoxin Deoxynivalenol Potentiates Intestinal Inflammation by Salmonella Typhimurium in Porcine Ileal Loops. PLoS ONE 2011, 6, e23871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Subramanian, G.; Bialorucki, C.; Yildirim-Ayan, E. Nanofibrous yet injectable polycaprolactone-collagen bone tissue scaffold with osteoprogenitor cells and controlled release of bone morphogenetic protein-2. Mater. Sci. Eng. C Mater. Biol. Appl. 2015, 51, 16–27. [Google Scholar] [CrossRef] [PubMed]
- Nakamichi, R.; Ito, Y.; Inui, M.; Onizuka, N.; Kayama, T.; Kataoka, K.; Suzuki, H.; Mori, M.; Inagawa, M.; Ichinose, S. Mohawk promotes the maintenance and regeneration of the outer annulus fibrosus of intervertebral discs. Nat. Commun. 2016, 7, 12503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, L.; Shimmer, A.L.; Li, X. The challenge and advancement of annulus fibrosus tissue engineering. Eur. Spine J. 2013, 22, 1090–1100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sugimoto, Y.; Takimoto, A.; Akiyama, H.; Kist, R.; Scherer, G.; Nakamura, T.; Hiraki, Y.; Shukunami, C. Scx+/Sox9+ progenitors contribute to the establishment of the junction between cartilage and tendon/ligament. Development 2013, 140, 2280–2288. [Google Scholar] [CrossRef] [Green Version]
- Gruber, H.; Ingram, J.; Jr, E.H. Tenascin in the human intervertebral disc: Alterations with aging and disc degeneration. Biotech. Histochem. 2002, 77, 37–41. [Google Scholar] [CrossRef]
- Freburger, J.K.; Holmes, G.M.; Agans, R.P.; Jackman, A.M.; Darter, J.D.; Wallace, A.S.; Castel, L.D.; Kalsbeek, W.D.; Carey, T.S. The rising prevalence of chronic low back pain. Arch. Intern. Med. 2009, 169, 251–258. [Google Scholar] [CrossRef] [Green Version]
- Ghezelbash, F.; Eskandari, A.H.; Shirazi-Adl, A.; Kazempour, M.; Tavakoli, J.; Baghani, M.; Costi, J.J. Modeling of human intervertebral disc annulus fibrosus with complex multi-fiber networks. Acta Biomater. 2021, 123, 208–221. [Google Scholar] [CrossRef]
- Borem, R.; Madeline, A.; Walters, J.; Mayo, H.; Gill, S.; Mercuri, J. Angle-ply biomaterial scaffold for annulus fibrosus repair replicates native tissue mechanical properties, restores spinal kinematics, and supports cell viability. Acta Biomater. 2017, 58, 254–268. [Google Scholar] [CrossRef]
- Frauchiger, D.A.; May, R.D.; Bakirci, E.; Tekari, A.; Chan, S.C.W.; Woltje, M.; Benneker, L.M.; Gantenbein, B. Genipin-Enhanced Fibrin Hydrogel and Novel Silk for Intervertebral Disc Repair in a Loaded Bovine Organ Culture Model. J. Funct. Biomater. 2018, 9, 40. [Google Scholar] [CrossRef]
- Chuong, C.-M.; Chen, H.-M. Enhanced expression of neural cell adhesion molecules and tenascin (cytotactin) during wound healing. Am. J. Pathol. 1991, 138, 427. [Google Scholar]
- Midwood, K.S.; Chiquet, M.; Tucker, R.P.; Orend, G. Tenascin-C at a glance. J. Cell Sci. 2016, 129, 4321–4327. [Google Scholar] [CrossRef] [Green Version]
- Nishio, T.; Kawaguchi, S.; Yamamoto, M.; Iseda, T.; Kawasaki, T.; Hase, T. Tenascin-C regulates proliferation and migration of cultured astrocytes in a scratch wound assay. Neuroscience 2005, 132, 87–102. [Google Scholar] [CrossRef] [PubMed]
- McKenzie, J.A.; Buettmann, E.; Abraham, A.C.; Gardner, M.J.; Silva, M.J.; Killian, M.L. Loss of scleraxis in mice leads to geometric and structural changes in cortical bone, as well as asymmetry in fracture healing. FASEB J. 2017, 31, 882–892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gulotta, L.V.; Kovacevic, D.; Packer, J.D.; Deng, X.H.; Rodeo, S.A. Bone marrow–derived mesenchymal stem cells transduced with scleraxis improve rotator cuff healing in a rat model. Am. J. Sports Med. 2011, 39, 1282–1289. [Google Scholar] [CrossRef] [PubMed]
- Sivan, S.S.; Wachtel, E.; Roughley, P. Structure, function, aging and turnover of aggrecan in the intervertebral disc. Biochim. Biophys. Acta 2014, 1840, 3181–3189. [Google Scholar] [CrossRef]
- Roughley, P.; Martens, D.; Rantakokko, J.; Alini, M.; Mwale, F.; Antoniou, J. The involvement of aggrecan polymorphism in degeneration of human intervertebral disc and articular cartilage. Eur. Cells Mater. 2006, 11, 1–7. [Google Scholar] [CrossRef]
- Mohd Isa, I.L.; Mokhtar, S.A.; Abbah, S.A.; Fauzi, M.B.; Devitt, A.; Pandit, A. Intervertebral Disc Degeneration: Biomaterials and Tissue Engineering Strategies toward Precision Medicine. Adv. Healthc. Mater. 2022, 11, e2102530. [Google Scholar] [CrossRef]
- Uysal, O.; Arslan, E.; Gulseren, G.; Kilinc, M.C.; Dogan, I.; Ozalp, H.; Caglar, Y.S.; Guler, M.O.; Tekinay, A.B. Collagen Peptide Presenting Nanofibrous Scaffold for Intervertebral Disc Regeneration. ACS Appl. Bio Mater. 2019, 2, 1686–1695. [Google Scholar] [CrossRef] [Green Version]
- Vadala, G.; Di Giacomo, G.; Ambrosio, L.; Cicione, C.; Tilotta, V.; Russo, F.; Papalia, R.; Denaro, V. The Effect of Irisin on Human Nucleus Pulposus Cells: New Insights into the Biological Crosstalk between the Muscle and Intervertebral Disc. Spine 2022. [Google Scholar] [CrossRef]
- Pirvu, T.; Blanquer, S.B.; Benneker, L.M.; Grijpma, D.W.; Richards, R.G.; Alini, M.; Eglin, D.; Grad, S.; Li, Z. A combined biomaterial and cellular approach for annulus fibrosus rupture repair. Biomaterials 2015, 42, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Nukaga, T.; Sakai, D.; Schol, J.; Sato, M.; Watanabe, M. Annulus fibrosus cell sheets limit disc degeneration in a rat annulus fibrosus injury model. JOR Spine 2019, 2, e1050. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guillaume, O.; Daly, A.; Lennon, K.; Gansau, J.; Buckley, S.F.; Buckley, C.T. Shape-memory porous alginate scaffolds for regeneration of the annulus fibrosus: Effect of TGF-beta3 supplementation and oxygen culture conditions. Acta Biomater. 2014, 10, 1985–1995. [Google Scholar] [CrossRef] [PubMed]
- Shortridge, C.; Akbari Fakhrabadi, E.; Wuescher, L.M.; Worth, R.G.; Liberatore, M.W.; Yildirim-Ayan, E. Impact of Digestive Inflammatory Environment and Genipin Crosslinking on Immunomodulatory Capacity of Injectable Musculoskeletal Tissue Scaffold. Int. J. Mol. Sci. 2021, 22, 1134. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer | Reverse Primer | Ref. |
---|---|---|---|
Scleraxis | AGCAACCAGAGAAAGTTGAGCA | CTGCCTGTCTGTCCATTGGC | [50] |
Col I | TCCCTGGTGCTGTTGGTG | TACCAGGAGCGCCGTTG | [50] |
Col III | CGACTTCTCTCTAGCCGAGC | CCCCAGTGTGTTTAGTGCAAC | [51] |
Tenascin | AGGTTCCTGGAGACGATGGA | TCTGGGGTGGCATCTGAAAC | [52] |
Aggrecan | CAGGTGAAGACTTTGTGGACATC | GTGAGTAGCGGGAGGAGCCC | [50] |
MMP13 | CATGAGTTTGGCCATTCCTT | GTGGCTTTTGCCAGTGTAGG | [50] |
IL-10 | GCCTTCGGCCCAGTGAA | AGAGACCCGGTCAGCAACAA | [50] |
CD163 | TCTGTTGGCCATTTTCGTCG | TGGTGGACTAAGTTCTCTCCTCTTGA | [50] |
IL1β | CCAGTACGAATCTCGGACCACC | TTAGGAAGACACAAATTGCA | [50] |
MMP3 | TCCTGATGTTGGTTACTTCAGCAC | TTGACAATCCTGTAAGTGAGGTCATT | [50] |
CD206 | CTACAAGGGATCGGGTTTATGGA | TTGGCATTGCCTAGTAGCGTA | [50] |
GAPDH | GTTTGTGATGGGCGTGAACC | AGCTTGACGAAGTGGTCGTT | [50] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Roebke, E.; Jacho, D.; Eby, O.; Aldoohan, S.; Elsamaloty, H.; Yildirim-Ayan, E. Injectable Cell-Laden Nanofibrous Matrix for Treating Annulus Fibrosus Defects in Porcine Model: An Organ Culture Study. Life 2022, 12, 1866. https://doi.org/10.3390/life12111866
Roebke E, Jacho D, Eby O, Aldoohan S, Elsamaloty H, Yildirim-Ayan E. Injectable Cell-Laden Nanofibrous Matrix for Treating Annulus Fibrosus Defects in Porcine Model: An Organ Culture Study. Life. 2022; 12(11):1866. https://doi.org/10.3390/life12111866
Chicago/Turabian StyleRoebke, Evan, Diego Jacho, Oliver Eby, Sulaiman Aldoohan, Haitham Elsamaloty, and Eda Yildirim-Ayan. 2022. "Injectable Cell-Laden Nanofibrous Matrix for Treating Annulus Fibrosus Defects in Porcine Model: An Organ Culture Study" Life 12, no. 11: 1866. https://doi.org/10.3390/life12111866