Semi-Scavenging Poultry as Carriers of Avian Influenza Genes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Location
2.2. Field Sampling Procedures
2.3. Viral RNA Extraction, Molecular Detection, and Subtyping of AIV Isolates
2.4. Virus Isolation in Embryonated Chicken Eggs
2.5. Statistical Analysis
3. Results
3.1. Identification of Avian Influenza Virus (AIV) Type A
3.2. Prevalence of Avian Influenza Type A (AIV) in Semi-Scavenging Domestic Ducks
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization (WHO). Global Influenza Strategy 2019–2030; World Health Organization (WHO): Geneva, Switzerland, 2019.
- El Zowalaty, M.E.; Bustin, S.A.; Husseiny, M.I.; Ashour, H.M. Avian influenza: Virology, diagnosis and surveillance. Future Microbiol. 2013, 8, 1209–1227. [Google Scholar] [CrossRef]
- Muzemil, A.; Fasanmi, O.G.; Fasina, F.O. African perspectives: Modern complexities of emerging, re-emerging, and endemic zoonoses. J. Glob. Health 2018, 8, 020310. [Google Scholar] [CrossRef] [PubMed]
- Parvin, R.; Nooruzzaman, M.; Kabiraj, C.K.; Begum, J.A.; Chowdhury, E.H.; Islam, M.R.; Harder, T. Controlling avian influenza virus in Bangladesh: Challenges and recommendations. Viruses 2020, 12, 751. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization (WHO). Cumulative Number of Confirmed Human Cases for Avian Influenza a (H5N1) Reported to WHO, 2003–2016; World Health Organization (WHO): Geneva, Switzerland, 2016.
- Xu, X.; Subbarao, K.; Cox, N.J.; Guo, Y. Genetic characterization of the pathogenic influenza a/goose/guangdong/1/96 (H5n1) Virus: Similarity of its hemagglutinin gene to those of H5n1 viruses from the 1997 outbreaks in Hong Kong. Virology 1999, 261, 15–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Organization for Animal Health (OIE). “OIE Situation Report for Highly Pathogenic Avian Influenza.” (2018). Available online: https://www.oie.int/fileadmin/Home/eng/Animal_Health_in_the_World/docs/pdf/OIE_AI_situation_report/OIE_SituationReport_AI_August2018.pdf. (accessed on 17 December 2021).
- World Health Organization (WHO). Cumulative number of confirmed human cases for avian influenza a(H5n1) reported to WHO, 2003–2021, 15 April 2021. In Emergency Situational Updates; World Health Organization (WHO): Geneva, Switzerland, 2021. [Google Scholar]
- World Organization for Animal Health (OIE). “Update on Avian Influenza in Animals (Types H5 and H7)”. Available online: http://www.oie.int/animal-health-in-the-world/update-on-avian-influenza/ (accessed on 27 April 2021).
- Mateus-Anzola, J.; Martinez-Lopez, B.; Espinosa-Garcia, A.C.; Ojeda-Flores, R. Global subtype diversity, spatial distribution patterns, and phylogenetic analysis of avian influenza virus in water. Transbound. Emerg. Dis. 2021, 1–12. [Google Scholar] [CrossRef]
- Ip, H.S.; Torchetti, M.K.; Crespo, R.; Kohrs, P.; DeBruyn, P.; Mansfield, K.G.; Baszler, T.; Badcoe, L.; Bodenstein, B.; Shearn-Bochsler, V.; et al. Novel Eurasian highly pathogenic avian influenza a H5 viruses in Wild Birds, Washington, USA, 2014. Emerg. Infect. Dis. 2015, 21, 886–890. [Google Scholar] [CrossRef]
- Dhingra, M.S.; Artois, J.; Dellicour, S.; Lemey, P.; Dauphin, G.; Von Dobschuetz, S.; Van Boeckel, T.P.; Castellan, D.M.; Morzaria, S.; Gilbert, M. Geographical and historical patterns in the emergences of novel highly pathogenic avian influenza (HPAI) H5 and H7 viruses in poultry. Front. Vet. Sci. 2018, 5, 84. [Google Scholar] [CrossRef] [Green Version]
- Capua, I.; Grossele, B.; Bertoli, E.; Cordioli, P. Monitoring for highly pathogenic avian influenza in Wild Birds in Italy. Vet. Rec. 2000, 147, 640. [Google Scholar]
- Slemons, R.D.; Johnson, D.C.; Osborn, J.S.; Hayes, F. Type-a influenza viruses isolated from wild free-flying ducks in California. Avian Dis. 1974, 18, 119–124. [Google Scholar] [CrossRef]
- Stallknecht, D.E. Ecology and epidemiology of avian influenza viruses in wild bird populations: Waterfowl, shorebirds, pelicans, cormorants, Etc. Avian Dis. 2003, 47, 61–69. [Google Scholar]
- Luczo, J.M.; Prosser, D.J.; Pantin-Jackwood, M.J.; Berlin, A.M.; Spackman, E. The pathogenesis of a North American H5n2 clade 2.3.4.4 group a highly pathogenic avian influenza virus in surf scoters (melanitta perspicillata). BMC Vet. Res. 2020, 16, 351. [Google Scholar] [CrossRef] [PubMed]
- Slemons, R.D.; Easterday, B.C. Virus replication in the digestive tract of ducks exposed by aerosol to type-a influenza. Avian Dis. 1978, 22, 367–377. [Google Scholar] [CrossRef] [PubMed]
- Wigginton, K.R.; Boehm, A.B. Environmental engineers and scientists have important roles to play in stemming outbreaks and pandemics caused by enveloped viruses. Environ. Sci. Technol. 2020, 54, 3736–3739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Newman, S.H.; Hill, N.J.; Spragens, K.A.; Janies, D.; Voronkin, I.O.; Prosser, D.J.; Yan, B.; Lei, F.; Batbayar, N.; Natsagdorj, T.; et al. Eco-virological approach for assessing the role of wild birds in the spread of avian influenza H5N1 along the central asian flyway. PLoS ONE 2012, 7, e30636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blagodatski, A.; Trutneva, K.; Glazova, O.; Mityaeva, O.; Shevkova, L.; Kegeles, E.; Onyanov, N.; Fede, K.; Maznina, A.; Khavina, E.; et al. Avian influenza in wild birds and poultry: Dissemination pathways, monitoring methods, and virus ecology. Pathogens 2021, 10, 630. [Google Scholar] [CrossRef]
- Amonsin, A.; Choatrakol, C.; Lapkuntod, J.; Tantilertcharoen, R.; Thanawongnuwech, R.; Suradhat, S.; Suwannakarn, K.; Theamboonlers, A.; Poovorawan, Y. Influenza virus (H5N1) in live bird markets and food markets, Thailand. Emerg. Infect. Dis. 2008, 14, 1739–1742. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; He, S.; Walker, D.; Zhou, N.; Perez, D.R.; Mo, B.; Li, F.; Huang, X.; Webster, R.G.; Webby, R.J. The influenza virus gene pool in a poultry market in South Central China. Virology 2003, 305, 267–275. [Google Scholar] [CrossRef] [PubMed]
- Shortridge, K.F.; Zhou, N.N.; Guan, Y.; Gao, P.; Ito, T.; Kawaoka, Y.; Kodihalli, S.; Krauss, S.; Markwell, D.; Murti, K.G.; et al. Characterization of avian H5n1 influenza viruses from poultry in Hong Kong. Virology 1998, 252, 331–342. [Google Scholar] [CrossRef] [Green Version]
- Yu, Z.; Song, Y.; Zhou, H.; Xu, X.; Hu, Q.; Wu, H.; Zhang, A.; Zhou, Y.; Chen, J.; Dan, H.; et al. Avian influenza (H5n1) virus in waterfowl and chickens, Central China. Emerg. Infect. Dis. 2007, 13, 772–775. [Google Scholar] [CrossRef]
- Turner, J.C.; Feeroz, M.M.; Hasan, M.K.; Akhtar, S.; Walker, D.; Seiler, P.; Barman, S.; Franks, J.; Jones-Engel, L.; McKenzie, P.S.; et al. Insight into live bird markets of Bangladesh: An overview of the dynamics of transmission of H5n1 and H9n2 avian influenza viruses. Emerg. Microbes Infect. 2017, 6, e12. [Google Scholar] [CrossRef] [Green Version]
- Hassan, M.M.; Hoque, M.A.; Debnath, N.C.; Yamage, M.; Klaassen, M. Are poultry or wild birds the main reservoirs for avian influenza in Bangladesh? Ecohealth 2017, 14, 490–500. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Biswas, P.K.; Giasuddin, M.; Hasan, M.; Mahmud, R.; Chang, Y.M.; Essen, S.; Samad, M.A.; Lewis, N.S.; Brown, I.H.; et al. Prevalence of avian influenza a(H5) and a(H9) viruses in live bird markets, Bangladesh. Emerg. Infect. Dis. 2018, 24, 2309–2316. [Google Scholar] [CrossRef]
- Khan, S.U.; Gurley, E.S.; Gerloff, N.; Rahman, M.Z.; Simpson, N.; Rahman, M.; Haider, N.; Chowdhury, S.; Balish, A.; Zaman, R.U.; et al. Avian influenza surveillance in domestic waterfowl and environment of live bird markets in Bangladesh, 2007–2012. Sci. Rep. 2018, 8, 9396. [Google Scholar] [CrossRef]
- Liang, W.S.; He, Y.C.; Wu, H.D.; Li, Y.T.; Shih, T.H.; Kao, G.S.; Guo, H.Y.; Chao, D.Y. Ecological factors associated with persistent circulation of multiple highly pathogenic avian influenza viruses among poultry farms in taiwan during 2015–2017. PLoS ONE 2020, 15, e0236581. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations; World Organization for Animal Health; World Health Organization. FAO-OIE-WHO Technical Update: Current Evolution of Avian Influenza H5N1 Viruses; World Health Organization (WHO): Geneva, Switzerland, 2011; pp. 1–6.
- Centers for Disease Control and Prevention (CDC). “Highly Pathogenic Asian Avian Influenza a(H5N1) Virus.” U.S. Department of Health & Human Services. Available online: https://www.cdc.gov/flu/avianflu/h5n1-virus.htm (accessed on 20 December 2021).
- Ahmed, S.S.; Themudo, G.E.; Christensen, J.P.; Biswas, P.K.; Giasuddin, M.; Samad, M.A.; Toft, N.; Ersboll, A.K. Molecular epidemiology of circulating highly pathogenic avian influenza (H5N1) virus in chickens, in Bangladesh, 2007–2010. Vaccine 2012, 30, 7381–7390. [Google Scholar] [CrossRef]
- Biswas, P.K.; Giasuddin, M.; Nath, B.K.; Islam, M.Z.; Debnath, N.C.; Yamage, M. Biosecurity and circulation of influenza a (H5N1) virus in live-bird markets in Bangladesh, 2012. Transbound. Emerg. Dis. 2015, 64, 883–891. [Google Scholar] [CrossRef]
- Haider, N.; Sturm-Ramirez, K.; Khan, S.U.; Rahman, M.Z.; Sarkar, S.; Poh, M.K.; Shivaprasad, H.L.; Kalam, M.A.; Paul, S.K.; Karmakar, P.C.; et al. Unusually high mortality in waterfowl caused by highly pathogenic avian influenza a(H5n1) in Bangladesh. Transbound. Emerg. Dis. 2017, 64, 144–156. [Google Scholar] [CrossRef] [Green Version]
- Gerloff, N.A.; Khan, S.U.; Zanders, N.; Balish, A.; Haider, N.; Islam, A.; Chowdhury, S.; Rahman, M.Z.; Haque, A.; Hosseini, P.; et al. Genetically diverse low pathogenicity avian influenza a virus subtypes co-circulate among poultry in Bangladesh. PLoS ONE 2016, 11, e0152131. [Google Scholar] [CrossRef] [Green Version]
- Khatun, A.; Giasuddin, M.; Islam, K.M.; Khanom, S.; Samad, M.A.; Islam, M.R.; Noor, M.; Bhuiyan, J.U.; Kim, W.I.; Eo, S.K.; et al. Surveillance of avian influenza virus type a in semi-scavenging ducks in Bangladesh. BMC Vet. Res. 2013, 9, 196. [Google Scholar] [CrossRef] [Green Version]
- Parvin, R.; Begum, J.A.; Chowdhury, E.H.; Islam, M.R.; Beer, M.; Harder, T. Co-subsistence of avian influenza virus subtypes of low and high pathogenicity in Bangladesh: Challenges for diagnosis, risk assessment and control. Sci. Rep. 2019, 9, 8306. [Google Scholar] [CrossRef] [Green Version]
- Ripa, R.N.; Sealy, J.E.; Raghwani, J.; Das, T.; Barua, H.; Masuduzzaman, M.d.; Saifuddin, A.K.M.; Huq, M.d.R.; Uddin, M.I.; Iqbal, M.; et al. Molecular epidemiology and pathogenicity of H5N1 and H9N2 avian influenza viruses in clinically affected chickens on farms in Bangladesh. Emerg. Microbes Infect. 2021, 10, 2223–2234. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization (WHO). Avian Influenza: Food Safety Issues; World Health Organization (WHO): Geneva, Switzerland, 2007.
- Sarker, R.D.; Giasuddin, M.; Chowdhury, E.H.; Islam, M.R. Serological and virological surveillance of avian influenza virus in domestic ducks of the north-east region of Bangladesh. BMC Vet. Res. 2017, 13, 180. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.-N.; Lee, D.-H.; Cheon, S.-H.; Park, Y.-R.; Baek, Y.-G.; Si, Y.-J.; Kye, S.-J.; Lee, E.-K.; Heo, G.-B.; Bae, Y.-C.; et al. Genetic characteristics and pathogenesis of H5 low pathogenic avian influenza viruses from wild birds and domestic ducks in South Korea. Sci. Rep. 2020, 10, 1–11. [Google Scholar] [CrossRef]
- Ma, C.; Lam, T.T.; Chai, Y.; Wang, J.; Fan, X.; Hong, W.; Zhang, Y.; Li, L.; Liu, Y.; Smith, D.K.; et al. Emergence and evolution of H10 subtype influenza viruses in poultry in China. J. Virol. 2015, 89, 3534–3541. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, S.; Xie, Z.; Li, M.; Li, D.; Xie, L.; Huang, J.; Zhang, M.; Zeng, T.; Wang, S.; Fan, Q.; et al. Survey of low pathogenic avian influenza viruses in live poultry markets in Guangxi Province, Southern China, 2016–2019. Sci. Rep. 2021, 11, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Department of Livestock Services (DLS). Livestock Economy at a Glance 2017–2018; Department of Livestock Services (DLS): Dhaka, Bangladesh, 2020.
- Barman, S.; Turner, J.C.M.; Hasan, M.K.; Akhtar, S.; El-Shesheny, R.; Franks, J.; Walker, D.; Seiler, P.; Friedman, K.; Kercher, L.; et al. Continuing evolution of highly pathogenic H5N1 viruses in Bangladeshi live poultry markets. Emerg. Microbes Infect. 2019, 8, 650–661. [Google Scholar] [CrossRef]
- Ahmed, S.S.; Ersboll, A.K.; Biswas, P.K.; Christensen, J.P.; Hannan, A.S.; Toft, N. Ecological determinants of highly pathogenic avian influenza (H5N1) outbreaks in Bangladesh. PLoS ONE 2012, 7, e33938. [Google Scholar] [CrossRef] [Green Version]
- El-Shesheny, R.; Franks, J.; Turner, J.; Seiler, P.; Walker, D.; Friedman, K.; Mukherjee, N.; Kercher, L.; Hasan, M.K.; Feeroz, M.M.; et al. Continued evolution of H5Nx avian influenza viruses in Bangladeshi live poultry markets: Pathogenic potential in poultry and mammalian models. J. Virol. 2020, 94, e01141-20. [Google Scholar] [CrossRef]
- Heine, H.G.; Foord, A.J.; Wang, J.; Valdeter, S.; Walker, S.; Morrissy, C.; Wong, F.Y.; Meehan, B. Detection of highly pathogenic zoonotic influenza virus H5N6 by reverse-transcriptase quantitative polymerase chain reaction. Virol. J. 2015, 12, 1–4. [Google Scholar] [CrossRef] [Green Version]
- Kalthoff, D.; Bogs, J.; Harder, T.; Grund, C.; Pohlmann, A.; Beer, M.; Hoffmann, B. Nucleic acid-based detection of influenza a virus subtypes H7 and N9 with a special emphasis on the avian H7n9 virus. Eurosurveillance 2014, 19, 20731. [Google Scholar] [CrossRef] [Green Version]
- Monne, I.; Ormelli, S.; Salviato, A.; De Battisti, C.; Bettini, F.; Salomoni, A.; Drago, A.; Zecchin, B.; Capua, I.; Cattoli, G. Development and validation of a one-step real-time pcr assay for simultaneous detection of subtype H5, H7, and H9 avian influenza viruses. J. Clin. Microbiol. 2008, 46, 1769–1773. [Google Scholar] [CrossRef] [Green Version]
- Shanmuganatham, K.; Feeroz, M.M.; Jones-Engel, L.; Smith, G.J.D.; Fourment, M.; Walker, D.; McClenaghan, L.; Alam, S.M.R.; Hasan, M.K.; Seiler, P.; et al. Antigenic and molecular characterization of avian influenza a(H9n2) viruses, Bangladesh. Emerg. Infect. Dis. 2013, 19, 1393. [Google Scholar] [CrossRef]
- El Zowalaty, M.E.; Abin, M.; Chander, Y.; Redig, P.T.; Goyal, S.M. Isolation of H5 avian influenza viruses from waterfowl in the upper midwest region of the United States. Avian Dis. 2011, 55, 259–262. [Google Scholar] [CrossRef]
- Hierholzer, J.C.; Suggs, M.T.; Hall, E.C. Standardized viral hemagglutination and hemagglutination-inhibition tests. Ii. description and statistical evaluation. Appl. Microbiol. 1969, 18, 824–833. [Google Scholar] [CrossRef]
- Hirst, G.K. The agglutination of red cells by allantoic fluid of chick embryos infected with influenza virus. Science 1941, 94, 22–23. [Google Scholar] [CrossRef]
- Gulyaeva, M.; Huettmann, F.; Shestopalov, A.; Okamatsu, M.; Matsuno, K.; Chu, D.H.; Sakoda, Y.; Glushchenko, A.; Milton, E.; Bortz, E. Data mining and model-predicting a global disease reservoir for low-pathogenic avian influenza (a) in the wider pacific rim using big data sets. Sci. Rep. 2020, 10, 16817. [Google Scholar] [CrossRef]
- Negovetich, N.J.; Feeroz, M.M.; Jones-Engel, L.; Walker, D.; Alam, S.M.R.; Hasan, K.; Seiler, P.; Ferguson, A.; Friedman, K.; Barman, S.; et al. Live bird markets of Bangladesh: H9n2 viruses and the near absence of highly pathogenic H5N1 influenza. PLoS ONE 2011, 6, e19311. [Google Scholar] [CrossRef] [Green Version]
- Ansari, W.K.; Parvej, M.d.S.; El Zowalaty, M.E.; Jackson, S.; Bustin, S.A.; Ibrahim, A.K.; El Zowalaty, A.E.; Rahman, M.d.T.; Zhang, H.; Khan, M.F.R.; et al. Surveillance, epidemiological, and virological detection of highly pathogenic H5N1 avian influenza viruses in duck and poultry from Bangladesh. Vet. Microbiol. 2016, 193, 49–59. [Google Scholar] [CrossRef] [Green Version]
- Park, A.W.; Glass, K. Dynamic patterns of avian and human influenza in East and Southeast Asia. Lancet Infect. Dis. 2007, 7, 543–548. [Google Scholar] [CrossRef]
- Hassan, M.M.; El Zowalaty, M.E.; Islam, A.; Khan, S.A.; Rahman, M.K.; Jarhult, J.D.; Hoque, M.A. Prevalence and diversity of avian influenza virus hemagglutinin sero-subtypes in poultry and wild birds in Bangladesh. Vet. Sci. 2020, 7, 73. [Google Scholar] [CrossRef]
- Fourment, M.; Darling, A.E.; Holmes, E.C. The impact of migratory flyways on the spread of avian influenza virus in North America. BMC Evol. Biol. 2017, 17, 118. [Google Scholar] [CrossRef] [Green Version]
District | Wintering Site | Sample Classifications | M-Gene-Positive Pooled Samples (n) | M-Gene-Positive Pooled Samples (%) | |||
---|---|---|---|---|---|---|---|
Cloacal Samples | Pooled Samples (n) | ||||||
Collected Samples (n) | Discarded Samples (Low Quality) (n) | Total Tested Samples (n) | |||||
Sylhet | Tamabill | 70 | 0 | 70 | 14 | 1 | 7.1 |
Sylhet | Sathbilabill | 70 | 0 | 70 | 14 | 0 | 0 |
Sylhet | Medholbill | 65 | 5 | 60 | 12 | 0 | 0 |
Sunamgong | Tanguar haor | 150 | 0 | 150 | 30 | 5 | 16.7 |
Sunamgong | Khorchar haor | 152 | 2 | 150 | 30 | 2 | 6.7 |
Sunamgong | Shonir haor | 150 | 6 | 144 | 29 | 3 | 10.3 |
Moulavibazar | Hakaluki haor | 203 | 3 | 200 | 40 | 5 | 12.5 |
All wintering sites (combined) | 860 | 16 | 844 | 169 | 16 | 9.5 |
Type | Oligo Name | Sequence (5′-3′) | Final Conc. (nM) | Reference |
---|---|---|---|---|
AIV type A | [48] | |||
Forward | IVA D161M | AGATGAGYCTTCTAACCGAGGTCG | 900 | |
Reverse 1 | IVA D162M1 | TGCAAAAACATCYTCAAGTCTCTG | 225 | |
Reverse 2 | IVA D162M2 | TGCAAACACATCYTCAAGTCTCTG | 225 | |
Reverse 3 | IVA D162M3 | TGCAAAGACATCYTCAAGTCTCTG | 225 | |
Reverse 4 | IVA D162M4 | TGCAAATACATCYTCAAGTCTCTG | 225 | |
Probe | IVA Ma | FAM-TCAGGCCCCCTCAAAGCCGA-TAMRA | 250 | |
H5 duplex | [48] | |||
Forward 1 | IVA D148H5 | AAACAGAGAGGAAATAAGTGGAGTAAAATT | 675 | |
Forward 2 | IVA D204 | ATGGCTCCTCGGRAACCC | 675 | |
Reverse 1 | IVA D149H5 | AAAGATAGACCAGCTACCATGATTGC | 675 | |
Reverse 2 | IVA D205 | TTYTCCACTATGTAAGACCATTCCG | 675 | |
Probe 1 | IVA H5A | FAM-TCAACAGTGGCGAGTTCCCTAGCA-TAMRA | 300 | |
Probe 2 | IVA D215 | FAM-ATGTGTGACGAATTCMT-MGB-NFQ | 300 | |
H7 | [49] | |||
Forward | IAV-HA7-1593 | AYA GAA TAC AGA TWG ACC CAG T | 20,000 | |
Reverse | IAV-HA7-1740 | TAG TGC ACY GCA TGT TTC CA | 20,000 | |
Probe | AIV-HA7-1649 | FAM-TGG TTT AGC TTC GGG GCA TCA TG-BHQ1 | 2500 | |
H9 | [50] | |||
Forward | H9 Fwd | ATGGGGTTTGCTGCC | 900 | |
Reverse | H9 Rev | TTATATACAAATGTTGCAC(T)CTG | 900 | |
Probe | H9 Probe | TTCTGGGCCATGTCCAATGG | 250 |
Study Area (District) | Wintering Sites | Total Number of Samples | RT–PCR-Positive Samples of AIV Type A | HA/HI-Positive Samples | Prevalence of AIV Type A (%) in Each Site | Prevalence of AIV Type A (%) in Each District |
---|---|---|---|---|---|---|
Sylhet | Tamabill | 70 | 1 | 1 | 1.4 | 0.5 (Sylhet) |
Sylhet | Sathbilabill | 70 | 0 | 0 | 0 | |
Sylhet | Medholbill | 60 | 0 | 0 | 0 | |
Sunamgong | Tanguar haor | 150 | 7 | 7 | 4.7 | 3.15 (Sunamgong) |
Sunamgong | Khorchar haor | 150 | 3 | 3 | 2.0 | |
Sunamgong | Shonir haor | 144 | 4 | 4 | 2.78 | |
Moulavibazar | Hakaluki haor | 200 | 6 | 6 | 3.0 | 3.0 (Moulavibazar) |
Total | 844 | 21 | 21 | 2.5 | 2.5 | |
Study Area (District) | Wintering sites | AIV Type A positive | AIV H5 positive (%) | AIV H7 positive (%) | AIV H9 positive (%) | Other AIV H positive (%) |
Sylhet | Tamabill | 1 | 0 (0) | 0 (0) | 1 (100) | 0 (0) |
Sylhet | Sathbilabill | 0 | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
Sylhet | Medholbill | 0 | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
Sunamgong | Tanguar haor | 7 | 2 (28.6) | 0 (0) | 2 (28.6) | 3 (42.8) |
Sunamgong | Khorchar haor | 3 | 1 (33.3) | 0 (0) | 1 (33.3) | 1 (33.3) |
Sunamgong | Shonir haor | 4 | 1 (25.0) | 0 (0) | 2 (50.0) | 1 (25.0) |
Moulavibazar | Hakaluki haor | 6 | 1 (16.7) | 0 (0) | 3 (50.0) | 2 (33.3) |
Rel. prevalence in the positive samples | 21 | 5 (23.8) | 0 (0) | 9 (42.9) | 7 (33.3) | |
Overall prevalence (n = 844) | 5 (0.6) | 0 (0) | 9 (1.1) | 7 (0.8) |
Season | District | Number of Samples | Number of AIV Isolates | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
AIV Type A Positive | Seasonal Prevalence (%) | AIV H5 Positive | Seasonal Prevalence (%) | AIV H7 Positive | Seasonal Prevalence (%) | AIV H9 Positive | Seasonal Prevalence (%) | Other Subtype Positive | Seasonal Prevalence (%) | |||
Winter (Nov-Feb) | Sylhet | 70 | 1 | 4.1 (W) | 0 | 1.4 (W) | 0 | 0 (W) | 1 | 1.7 (W) | 0 | 1.0 (W) |
Sunamgong | 150 | 8 | 3 | 0 | 3 | 2 | ||||||
Moulavibazar | 70 | 3 | 1 | 0 | 1 | 1 | ||||||
Summer (Mar-Jun) | Sylhet | 65 | 0 | 2.5 (S) | 0 | 0.4 (S) | 0 | 0 (S) | 0 | 1.1 (S) | 0 | 1.1 (S) |
Sunamgong | 150 | 5 | 1 | 0 | 2 | 2 | ||||||
Moulavibazar | 65 | 2 | 0 | 0 | 1 | 1 | ||||||
Rainy (Jul-Oct) | Sylhet | 65 | 0 | 0.7 (R) | 0 | 0 (R) | 0 | 0 (R) | 0 | 0.4 (R) | 0 | 0.4 (R) |
Sunamgong | 144 | 1 | 0 | 0 | 0 | 1 | ||||||
Moulavibazar | 65 | 1 | 0 | 0 | 1 | 0 | ||||||
Total | 844 | 21 | 2.5 | 5 | 0.6 | 0 | 0 | 9 | 1.1 | 7 | 0.8 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Badruzzaman, A.T.M.; Rahman, M.M.; Hasan, M.; Hossain, M.K.; Husna, A.; Hossain, F.M.A.; Giasuddin, M.; Uddin, M.J.; Islam, M.R.; Alam, J.; et al. Semi-Scavenging Poultry as Carriers of Avian Influenza Genes. Life 2022, 12, 320. https://doi.org/10.3390/life12020320
Badruzzaman ATM, Rahman MM, Hasan M, Hossain MK, Husna A, Hossain FMA, Giasuddin M, Uddin MJ, Islam MR, Alam J, et al. Semi-Scavenging Poultry as Carriers of Avian Influenza Genes. Life. 2022; 12(2):320. https://doi.org/10.3390/life12020320
Chicago/Turabian StyleBadruzzaman, A T M, Md. Masudur Rahman, Mahmudul Hasan, Mohammed Kawser Hossain, Asmaul Husna, Ferdaus Mohd Altaf Hossain, Mohammed Giasuddin, Md Jamal Uddin, Mohammad Rafiqul Islam, Jahangir Alam, and et al. 2022. "Semi-Scavenging Poultry as Carriers of Avian Influenza Genes" Life 12, no. 2: 320. https://doi.org/10.3390/life12020320