Investigation of the Role of BMP2 and -4 in ASD, VSD and Complex Congenital Heart Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients and Controls
2.2. DNA Extraction and Sequencing
2.3. Multiple Sequence Alignment
2.4. RNA Extraction, Reverse Transcription and Real-Time Quantitative PCR (RT-qPCR)
2.5. Protein Extraction, Quantification and Assessment
2.6. Statistical Analysis
3. Results
3.1. Sequencing
3.2. mRNA Expression Analysis Results
3.2.1. Part A of mRNA Expression Analysis
Relative BMP2 and BMP4 Fold mRNA Expression Values in Normal and Defective Hearts
Pair-Wise Co-Expression Analysis of Relative Fold BMP2 and -4 mRNA Expression Values
3.2.2. Part B of mRNA Expression Analysis
Relative BMP2 and BMP4 Fold mRNA Expression Values in Normal and Defected Hearts
Pair-Wise Co-Expression Analysis of Relative Fold BMP2 and -4 mRNA Expression Levels
3.3. BMP-2 and BMP-4 Protein Levels in Normal and Defective Hearts
3.4. Pair-Wise Correlation of (a) BMP-2mRNA and BMP2 Protein and (b)BMP-4 2mRNA and BMP2 Protein Levels in Normal and Defective Hearts
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hoffman, J.I.; Kaplan, S. The incidence of congenital heart disease. J. Am. Coll. Cardiol. 2002, 39, 1890–1900. [Google Scholar] [CrossRef] [PubMed]
- Zomer, A.C.; Uiterwaal, C.S.; van der Velde, E.T.; Tijssen, J.G.; Mariman, E.C.; Verheugt, C.L.; Vaartjes, I.; Pieper, P.G.; Meijboom, F.J.; Grobbee, D.E.; et al. Mortality in adult congenital heart disease: Are national registries reliable for cause of death? Int. J. Cardiol. 2010, 152, 212–217. [Google Scholar] [CrossRef] [PubMed]
- Hoffman, J.I.; Kaplan, S.; Liberthson, R.R. Prevalence of congenital heart disease. Am. Heart. 2004, 147, 425–439. [Google Scholar] [CrossRef] [PubMed]
- Pierpont, M.E.; Basson, C.T.; Benson, D.W., Jr.; Gelb, B.D.; Giglia, T.M.; Goldmuntz, E.; McGee, G.; Sable, C.A.; Srivastava, D.; Webb, C.L. American Heart Association Congenital Cardiac Defects Committee. Council on Cardiovascular Disease in the Young Genetic basis for congenital heart defects: Current knowledge: A scientific statement from the American heart association congenital cardiac defects committee, council on cardiovascular disease in the young: Endorsed by the American academy of pediatrics. Circulation 2007, 115, 3015–3038. [Google Scholar]
- Van der Bom, T.; Zomer, A.C.; Zwinderman, A.H.; Meijboom, F.J.; Bouma, B.J.; Mulder, B.J. The changing epidemiology of congenital heart disease. Nat. Rev. Cardiol. 2011, 8, 50–60. [Google Scholar] [CrossRef]
- Richards, A.A.; Garg, V. Genetics of congenital heart disease. Curr. Cardiol. Rev. 2010, 6, 91–97. [Google Scholar] [CrossRef]
- Deng, X.; Zhou, J.; Li, F.F.; Yan, P.; Zhao, E.Y.; Hao, L.; Yu, K.J.; Liu, S.L. Characterization of nodal/TGF lefty signaling pathway gene variants for possible roles in congenital heart diseases. PLoS ONE 2014, 9, e104535. [Google Scholar] [CrossRef]
- Harvey, R.P. Patterning the vertebrate heart. Nat. Rev. Genet. 2002, 3, 544–556. [Google Scholar] [CrossRef]
- Buckingham, M.; Meilhac, S.; Zaffran, S. Building the mammalian heart from two sources of myocardial cells. Nat. Rev. Genet. 2005, 6, 826–835. [Google Scholar] [CrossRef]
- Van Weerd, J.H.; Koshiba-Takeuchi, K.; Kwon, C.; Takeuchi, J.K. Epigenetic factors and cardiac development. Cardiovasc. Res. 2011, 91, 203–211. [Google Scholar] [CrossRef]
- Fishman, M.C.; Olson, E.N. Parsing the heart: Genetic modules for organ assembly. Cell 1997, 91, 153–156. [Google Scholar] [CrossRef]
- Garside, V.; Chang, A.; Karsan, A.; Hoodless, P.A. Co-ordinating Notch, BMP, and TGFβ Signalling during Heart Valve Development. Cell. Mol. Life Sci. 2013, 70, 2899–2917. [Google Scholar] [CrossRef]
- Hogan, B.L. Bone morphogenetic proteins in development. Curr. Opin. Genet. Dev. 1996, 6, c432–c438. [Google Scholar] [CrossRef] [PubMed]
- Hogan, B.L. Bone morphogenetic proteins: Multifunctional regulators of vertebrate development. Genes Dev. 1996, 10, 1580–1594. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Greene, S.; Martin, J.F. Bmp signalling in Congenital Heart Disease: New Developments and Future Directions. Birth Defects Res. A Clin. Mol. Teratol. 2011, 91, 441–448. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Bradley, A. Mice deficient for BMP2 are nonviable and have defects in amnion/chorion and cardiac development. Development 1996, 122, 2977–2986. [Google Scholar] [CrossRef]
- Winnier, G.; Blessing, M.; Labosky, P.A.; Hogan, B.L. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev. 1995, 9, 2105–2116. [Google Scholar] [CrossRef] [PubMed]
- Jiao, K.; Kulessa, H.; Tompkins, K.; Zhou, Y.; Batts, L.; Baldwin, H.S.; Hogan, B.L. An essential role of Bmp4 in the atrioventricular septation of the mouse heart. Genes Dev. 2003, 17, 2362–2367. [Google Scholar] [CrossRef]
- Goldman, D.C.; Donley, N.; Christian, J.L. Genetic interaction between Bmp2 and Bmp4 reveals shared functions during multiple aspects of mouse organogenesis. Mech. Dev. 2009, 126, 117–127. [Google Scholar] [CrossRef]
- Uchimura, T.; Komatsu, Y.; Tanaka, M.; McCann, K.L.; Mishina, Y. Bmp2 and Bmp4 genetically interact to support multiple aspects of mouse development including functional heart development. Genesis 2009, 47, 374–384. [Google Scholar] [CrossRef]
- Beppu, H.; Malhotra, R.; Beppu, Y.; Lepore, J.J.; Parmacek, M.S.; Bloch, K.D. BMP type II receptor regulates positioning of outflow tract and remodeling of atrioventricular cushion during cardiogenesis. Dev. Biol. 2009, 331, 167–175. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCq method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Li, F.F.; Deng, X.; Zhou, J.; Yan, P.; Zhao, E.Y.; Liu, S.L. Characterization of human bone morphogenetic protein gene variants for possible roles in congenital heart disease. Mol. Med. Rep. 2016, 14, 1459–1464. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Katsev, S.; Cai, C.; Evans, S. BMP signaling is required for heart formation in vertebrates. Dev. Biol. 2000, 224, 226–237. [Google Scholar] [CrossRef] [PubMed]
- Walters, M.J.; Wayman, G.A.; Christian, J.L. Bone morphogenetic protein function is required for terminal differentiation of the heart but not for early expression of cardiac marker genes. Mech. Dev. 2001, 100, 263–273. [Google Scholar] [CrossRef]
- Ladd, A.N.; Yatskievych, T.A.; Antin, P.B. Regulation of avian cardiac myogenesis by activin/TGFbeta and bone morphogenetic proteins. Dev. Biol. 2008, 204, 407–419. [Google Scholar] [CrossRef]
- Waldo, K.L.; Kumiski, D.H.; Wallis, K.T.; Stadt, H.A.; Hutson, M.R.; Platt, D.H.; Kirby, M.L. Conotruncal myocardium arises from a secondary heart field. Development 2001, 128, 3179–3188. [Google Scholar] [CrossRef] [PubMed]
- Leung, A.W.; Morest, D.K.; Li, J.Y. Differential BMP signaling controls formation and differentiation of multipotent preplacodal ectoderm progenitors from human embryonic stem cells. Dev. Biol. 2013, 379, 208–220. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Li, J.; Tan, Z.; Wang, C.; Liu, T.; Chen, L.; Yong, J.; Jiang, W.; Sun, X.; Du, L.; et al. Short-term BMP-4 treatment initiates mesoderm induction in human embryonic stem cells. Blood 2008, 111, 1933–1941. [Google Scholar] [CrossRef] [PubMed]
- Teo, A.K.; Ali, Y.; Wong, K.Y.; Chipperfield, H.; Sadasivam, A.; Poobalan, Y.; Tan, E.K.; Wang, S.T.; Abraham, S.; Tsuneyoshi, N.; et al. Activin and BMP4 synergistically promote formation of definitive endoderm in human embryonic stem cells. Stem Cells 2012, 30, 631–642. [Google Scholar] [CrossRef] [PubMed]
- Yu, P.; Pan, G.; Yu, J.; Thomson, J.A. FGF2 sustains NANOG and switches the outcome of BMP4-induced human embryonic stem cell differentiation. Cell Stem Cell. 2011, 8, 326–334. [Google Scholar] [CrossRef] [PubMed]
- Wagner, N.; Wagner, K.D. Transcriptional regulation of cardiac development and disease. Int. J. Mol. Sci. 2022, 23, 2945. [Google Scholar] [CrossRef] [PubMed]
- Li, F.F.; Zhou, J.; Zhao, D.D.; Yan, P.; Li, X.; Han, Y.; Li, X.S.; Wang, G.Y.; Yu, K.J.; Liu, S.L. Characterization of SMAD3 gene variants for possible roles in ventricular septal defects and other congenital heart diseases. PLoS ONE 2015, 10, e0131542. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Lu, M.F.; Schwartz, R.J.; Martin, J.F. Bmp2 is essential for cardiac cushion epithelial-mesenchymal transition and myocardial patterning. Development 2005, 132, 5601–5611. [Google Scholar] [CrossRef]
- Rivera-Feliciano, J.; Tabin, C. BMP2 instructs cardiac progenitors to form the heart-valve-inducing field. Dev. Biol. 2006, 295, 580–588. [Google Scholar] [CrossRef] [PubMed]
- Liu, W. BMP4 signaling is required for outflow-tract septation and branchial-arch artery remodeling. Proc. Natl. Acad. Sci. USA 2004, 101, 4489–4494. [Google Scholar] [CrossRef]
- Erhardt, S.; Zheng, M.; Zhao, X.; Le, T.P.; Findley, T.O.; Wang, J. The cardiac neural crest cells in heart development and congenital heart defects. J. Cardiovasc. Dev. Dis. 2021, 8, 89. [Google Scholar] [CrossRef]
- Wang, J.; Greene, S.B.; Bonilla-Claudio, M.; Tao, Y.; Xhang, J.; Bai, Y.; Huang, Z.; Black, B.L.; Wang, F.; Martin, J.F.; et al. BMP signaling regulates myocardial differentiation from cardiac progenitors through a MicroRNA-mediated mechanism. Dev. Cell. 2010, 19, 903–912. [Google Scholar] [CrossRef]
- Dyer, L.A.; Kirby, M.L. The role of secondary heart field in cardiac development. Dev. Biol. 2009, 336, 137–144. [Google Scholar] [CrossRef]
- Zaffran, S.; Kelly, R.G. New developments in the second heart field. Differentiation 2012, 84, 17–24. [Google Scholar] [CrossRef]
- Lin, J.Y.; Chen, Y.J.; Huang, Y.I.; Tang, G.P.; Zhang, L.; Deng, B.; Li, M.; Ma, H.; Luan, R.S. Association of bone morphogenetic protein 4 gene polymorphisms with nonsyndromic cleft lip with or without cleft palate in Chinese children. DNA Cell. Biol. 2008, 27, 601–605. [Google Scholar] [CrossRef] [PubMed]
- Qian, B.; Mo, R.; Da, M.; Peng, W.; Hu, Y.; Mo, X. Common variants in BMP4confer genetic susceptibility to sporadic Congenital Heart Disease in a Han Chinese Population. Pediatr. Cardiol. 2014, 35, 1442–1447. [Google Scholar] [CrossRef] [PubMed]
Congenital Defects | No of Cases |
---|---|
VSD | 12 |
ASD | 7 |
Fallot | 10 |
Complex/other | 23 |
Total No of cases | 52 |
Age | Years |
---|---|
Mean | 5.7 years |
Median | 1.5 years |
Range | 1 day–44 years |
Growth Factor | Primer Pair Sequence (5′-3′) | Annealing (°C) |
---|---|---|
BMP2 exon2 | AACGTTTGAGCTTCGGTCGGTCTT CTTTTGCCCTCATCTTCCCCATCA | 60 |
BMP2 exon3A | GCTTCACCATTTCCCCCATTA CCCACCTGCTTGCATTCTGAT | 61 |
BMP2 exon3B | TTCTTCCCTGTTTTTCTCTATCAA GACACCCACAACCCTCCAC | 57 |
BMP4 exon1 | GGGCGGCTGGAGGGGAGGATGT GCAACGCGTTCAGCCCAAGACC | 66 |
BMP4 exon2A | GCCGGGTTCGAGCTGGGAGACG CAGGGGTGGTGAGGGCAGAGTGAA | 66 |
BMP4 exon2B | GGCGGGCGCGGAGGTTGG CCGACGGAAGGGACAGC | 64 |
BMP4 exon3 | CTTTCCATCTTGCCCCTCCATTTC CACCTCCCCCTCTGTCTCCA | 61 |
BMP4 exon4A | GCTTATTTTCCCCCAGTAGGTTTC GAGTGGCGCCGGGAGTTCTTATTC | 61 |
BMP4 exon4B | CCTGGGCACCTCATCACACGACTA AGCGGCACCCACATCCCTCTACTA | 66 |
BMP4 exon4C | GCGGGCCAGGAAGAAGAATAAGAA CAACAGGTGAGTGAAACAGAAGA | 61 |
Growth Factor | Primer Pair Sequence (5′-3′) | Annealing (°C) |
---|---|---|
BMP2 mRNA | CGTGTCCCCGCGTGCTTCTTAG CCTGCTGGGGGTGGGTCTCTGT | 59 |
BMP4 mRNA | CCGCCCGCAGCCTAGCAAGAGT TAAAGAGGAAACGAAAAGCAGAGT | 137 |
GAPDH | GGAAGGTGAAGGTCGGAGTCA GTCATTGATGGCAACAATATCCACT | 60 |
b-actin | CGGCATCGTCACCAACTG GGCACACGCAGCTCATTG | 60 |
18S RNA | AGTCCCTGCCCTTTGTACACA GATCCGAGGGCCTCACTAAAC | 60 |
Control * | All CHD * | VSD | ASD | Fallot | Complex/ Other | p * | |
---|---|---|---|---|---|---|---|
BMP2 | 1.78 ± 0.50 | 3.22 ± 0.37 | 1.66 ± 0.62 | 4.36 ± 0.76 ** | 2.77 ± 0.80 | 2.86 ± 0.65 | 0.19 |
BMP4 | 1.40 ± 1.31 | 1.84 ± 0.26 | 0.90 ± 0.22 | 0.87 ± 0.25 | 1.40 ± 0.53 | 1.99 ± 0.52 | 0.47 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bobos, D.; Soufla, G.; Angouras, D.C.; Lekakis, I.; Georgopoulos, S.; Melissari, E. Investigation of the Role of BMP2 and -4 in ASD, VSD and Complex Congenital Heart Disease. Diagnostics 2023, 13, 2717. https://doi.org/10.3390/diagnostics13162717
Bobos D, Soufla G, Angouras DC, Lekakis I, Georgopoulos S, Melissari E. Investigation of the Role of BMP2 and -4 in ASD, VSD and Complex Congenital Heart Disease. Diagnostics. 2023; 13(16):2717. https://doi.org/10.3390/diagnostics13162717
Chicago/Turabian StyleBobos, Dimitrios, Giannoula Soufla, Dimitrios C. Angouras, Ioannis Lekakis, Sotirios Georgopoulos, and Euthemia Melissari. 2023. "Investigation of the Role of BMP2 and -4 in ASD, VSD and Complex Congenital Heart Disease" Diagnostics 13, no. 16: 2717. https://doi.org/10.3390/diagnostics13162717
APA StyleBobos, D., Soufla, G., Angouras, D. C., Lekakis, I., Georgopoulos, S., & Melissari, E. (2023). Investigation of the Role of BMP2 and -4 in ASD, VSD and Complex Congenital Heart Disease. Diagnostics, 13(16), 2717. https://doi.org/10.3390/diagnostics13162717