A MicroRNA-Based Method for High-Viremia Detection—A New Approach on a Romanian Lot of Chronically Infected Patients with Hepatitis B Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patient Selection
2.2. Parameter Acquisition
2.3. MicroRNA Detection
2.4. Statistical Analysis
3. Results
3.1. Subjects’ Characteristics
3.2. Logistic Regression Analysis
3.3. Characteristics of the microRNA Subgroup Subjects
3.4. Logistic Regression Analysis of the microRNA Subgroup
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- World Health Organization. WHO Guidelines on Hepatitis B and C Testing; World Health Organization: Geneva, Switzerland, 2017. Available online: https://www.who.int/publications/i/item/9789241549981 (accessed on 10 June 2023).
- ECDC. Hepatitis B Annual Epidemiological Report for 2021. 2021. Available online: https://www.ecdc.europa.eu/en/publications-data/hepatitis-b-annual-epidemiological-report-2021 (accessed on 10 June 2023).
- Zhao, F.; Xie, X.; Tan, X.; Yu, H.; Tian, M.; Lv, H.; Qin, C.; Qi, J.; Zhu, Q. The Functions of Hepatitis B Virus Encoding Proteins: Viral Persistence and Liver Pathogenesis. Front. Immunol. 2021, 12, 691766. [Google Scholar] [CrossRef] [PubMed]
- Croagh, C.M.N.; Lubel, J.S. Natural History of Chronic Hepatitis B: Phases in a Complex Relationship. World J. Gastroenterol. 2014, 20, 10395–10404. [Google Scholar] [CrossRef] [PubMed]
- Lampertico, P.; Agarwal, K.; Berg, T.; Buti, M.; Janssen, H.L.A.; Papatheodoridis, G.; Zoulim, F.; Tacke, F. EASL 2017 Clinical Practice Guidelines on the Management of Hepatitis B Virus Infection. J. Hepatol. 2017, 67, 370–398. [Google Scholar] [CrossRef]
- Korean Association for the Study of the Liver (KASL). KASL Clinical Practice Guidelines for Management of Chronic Hepatitis B. Clin. Mol. Hepatol. 2019, 25, 93–159. [Google Scholar] [CrossRef] [PubMed]
- Terrault, N.A.; Lok, A.S.F.; McMahon, B.J.; Chang, K.-M.; Hwang, J.P.; Jonas, M.M.; Brown, R.S.J.; Bzowej, N.H.; Wong, J.B. Update on Prevention, Diagnosis, and Treatment of Chronic Hepatitis B: AASLD 2018 Hepatitis B Guidance. Hepatology 2018, 67, 1560. [Google Scholar] [CrossRef] [PubMed]
- Berzigotti, A.; Tsochatzis, E.; Boursier, J.; Castera, L.; Cazzagon, N.; Friedrich-Rust, M.; Petta, S.; Thiele, M. EASL Clinical Practice Guidelines on Non-Invasive Tests for Evaluation of Liver Disease Severity and Prognosis—2021 Update. J. Hepatol. 2021, 75, 659–689. [Google Scholar] [CrossRef]
- Zhu, L.; Li, T.; Ma, X.; Qiu, Y.; Ma, X.; Lin, Y.; Han, L.; Qin, C. A Simple Noninvasive Index Can Predict Hepatocellular Carcinoma in Patients with Chronic Hepatitis B. Sci. Rep. 2017, 7, 8954. [Google Scholar] [CrossRef]
- Teng, J.; Du, Y.; Visalath, P.; Zhou, T.; Du, B.; Zhang, Q.; Cai, W. A Noninvasive Model Discriminating Significant Histological Changes in Treatment-Naive Chronic Hepatitis B Patients with Normal ALT. Virol. J. 2023, 20, 7. [Google Scholar] [CrossRef]
- Li, X.; Wu, J.; Mao, W. Evaluation of the Neutrophil-to-Lymphocyte Ratio, Monocyte-to-Lymphocyte Ratio, and Red Cell Distribution Width for the Prediction of Prognosis of Patients with Hepatitis B Virus-Related Decompensated Cirrhosis. J. Clin. Lab. Anal. 2020, 34, e23478. [Google Scholar] [CrossRef]
- Appourchaux, K.; Dokmak, S.; Resche-Rigon, M.; Treton, X.; Lapalus, M.; Gattolliat, C.-H.; Porchet, E.; Martinot-Peignoux, M.; Boyer, N.; Vidaud, M.; et al. MicroRNA-Based Diagnostic Tools for Advanced Fibrosis and Cirrhosis in Patients with Chronic Hepatitis B and C. Sci. Rep. 2016, 6, 34935. [Google Scholar] [CrossRef]
- Liu, W.; He, X.; Huang, F. Analysis of Serum MicroRNA-122 Expression at Different Stages of Chronic Hepatitis B Virus Infection. Biomed. Res. Int. 2021, 2021, 9957440. [Google Scholar] [CrossRef] [PubMed]
- Matsuyama, H.; Suzuki, H.I. Systems and Synthetic MicroRNA Biology: From Biogenesis to Disease Pathogenesis. Int. J. Mol. Sci. 2019, 21, 132. [Google Scholar] [CrossRef] [PubMed]
- Sarkar, N.; Chakravarty, R. Hepatitis B Virus Infection, MicroRNAs and Liver Disease. Int. J. Mol. Sci. 2015, 16, 17746–17762. [Google Scholar] [CrossRef] [PubMed]
- Iacob, D.G.; Rosca, A.; Ruta, S.M. Circulating MicroRNAs as Non-Invasive Biomarkers for Hepatitis B Virus Liver Fibrosis. World J. Gastroenterol. 2020, 26, 1113–1127. [Google Scholar] [CrossRef]
- Yang, Z.; Peng, Y.; Yang, S. MicroRNA-146a Regulates the Transformation from Liver Fibrosis to Cirrhosis in Patients with Hepatitis B via Interleukin-6. Exp. Ther. Med. 2019, 17, 4670–4676. [Google Scholar] [CrossRef] [PubMed]
- Fang, Q.; Chen, W.; Jian, Y.; Li, Y.; Lian, W.; Wan, H.; Chen, S.; Li, F.; Chen, Y. Serum Expression Level of MicroRNA-122 and Its Significance in Patients with Hepatitis B Virus Infection. J. Healthc. Eng. 2022, 2022, 8430276. [Google Scholar] [CrossRef]
- Fang, Y.; Yan, D.; Wang, L.; Zhang, J.; He, Q. Circulating MicroRNAs (MiR-16, MiR-22, MiR-122) Expression and Early Diagnosis of Hepatocellular Carcinoma. J. Clin. Lab. Anal. 2022, 36, e24541. [Google Scholar] [CrossRef]
- Weis, A.; Marquart, L.; Calvopina, D.A.; Genz, B.; Ramm, G.A.; Skoien, R. Serum MicroRNAs as Biomarkers in Hepatitis C: Preliminary Evidence of a MicroRNA Panel for the Diagnosis of Hepatocellular Carcinoma. Int. J. Mol. Sci. 2019, 20, 864. [Google Scholar] [CrossRef]
- Eldosoky, M.A.; Hammad, R.; Elmadbouly, A.A.; Aglan, R.B.; Abdel-Hamid, S.G.; Alboraie, M.; Hassan, D.A.; Shaheen, M.A.; Rushdi, A.; Ahmed, R.M.; et al. Diagnostic Significance of Hsa-MiR-21-5p, Hsa-MiR-192-5p, Hsa-MiR-155-5p, Hsa-MiR-199a-5p Panel and Ratios in Hepatocellular Carcinoma on Top of Liver Cirrhosis in HCV-Infected Patients. Int. J. Mol. Sci. 2023, 24, 3157. [Google Scholar] [CrossRef]
- Shahriar, A.; Ghaleh-aziz Shiva, G.; Ghader, B.; Farhad, J.; Hosein, A.; Parsa, H. The Dual Role of Mir-146a in Metastasis and Disease Progression. Biomed. Pharmacother. 2020, 126, 110099. [Google Scholar] [CrossRef]
- Charytonowicz, D.; Aubrey, H.; Bell, C.; Ferret, M.; Tsui, K.; Atfield, R.; Coleman, N.; Murray, M.J.; Wilson, E.C.F. Cost Analysis of Noninvasive Blood-Based MicroRNA Testing Versus CT Scans for Follow-up in Patients with Testicular Germ-Cell Tumors. Clin. Genitourin. Cancer 2019, 17, e733–e744. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2022; Available online: https://www.R-project.org/ (accessed on 23 January 2023).
- Hu, J.; Wang, Y.; Jiang, G.; Zheng, J.; Chen, T.; Chen, Z.; Yang, M.; Zhang, X.; Zhao, H.; Li, L. Predictors of Inflammatory Activity in Treatment-Naive Hepatitis B e-Antigen-Negative Patients with Chronic Hepatitis B Infection. J. Int. Med. Res. 2020, 48, 300060520969582. [Google Scholar] [CrossRef] [PubMed]
- Koc, Ö.M.; Verbeek, J.; Koek, G.H.; Bielen, R.; Busschots, D.; Gamil, M.; Robaeys, G.; Nevens, F. A Long-Term Study of Liver-Related Events in Caucasian Hepatitis B Patients with Normal ALT Values and High Viremia. Acta Gastroenterol. Belg. 2022, 85, 56–61. [Google Scholar] [CrossRef]
- Stella, L.; Santopaolo, F.; Gasbarrini, A.; Pompili, M.; Ponziani, F.R. Viral Hepatitis and Hepatocellular Carcinoma: From Molecular Pathways to the Role of Clinical Surveillance and Antiviral Treatment. World J. Gastroenterol. 2022, 28, 2251–2281. [Google Scholar] [CrossRef] [PubMed]
- Harten, S.K.; Oey, H.; Bourke, L.M.; Bharti, V.; Isbel, L.; Daxinger, L.; Faou, P.; Robertson, N.; Matthews, J.M.; Whitelaw, E. The Recently Identified Modifier of Murine Metastable Epialleles, Rearranged L-Myc Fusion, Is Involved in Maintaining Epigenetic Marks at CpG Island Shores and Enhancers. BMC Biol. 2015, 13, 21. [Google Scholar] [CrossRef] [PubMed]
- Pozo, P.N.; Cook, J.G. Regulation and Function of Cdt1; A Key Factor in Cell Proliferation and Genome Stability. Genes 2016, 8, 2. [Google Scholar] [CrossRef]
- Kong, C.; Wang, D.; Wang, F.; Lv, Y.; Zhou, W.; Ye, P.; Gu, Y.; Jiang, X.; Zhu, L.; Ge, Z.; et al. PCAF Accelerates Vascular Senescence via the Hippo Signaling Pathway. Oxidative Med. Cell Longev. 2022, 2022, 1200602. [Google Scholar] [CrossRef]
- Pan, K.; Wang, Y.; Pan, P.; Xu, G.; Mo, L.; Cao, L.; Wu, C.; Shen, X. The Regulatory Role of MicroRNA-MRNA Co-Expression in Hepatitis B Virus-Associated Acute Liver Failure. Ann. Hepatol. 2019, 18, 883–892. [Google Scholar] [CrossRef]
- Yang, J.; Nie, J.; Ma, X.; Wei, Y.; Peng, Y.; Wei, X. Targeting PI3K in Cancer: Mechanisms and Advances in Clinical Trials. Mol. Cancer 2019, 18, 26. [Google Scholar] [CrossRef]
- Xie, J.; Weiskirchen, R. What Does the “AKT” Stand for in the Name “AKT Kinase”? Some Historical Comments. Front. Oncol. 2020, 10, 1329. [Google Scholar] [CrossRef]
- Keeton, A.B.; Salter, E.A.; Piazza, G.A. The RAS–Effector Interaction as a Drug Target. Cancer Res. 2017, 77, 221–226. [Google Scholar] [CrossRef] [PubMed]
- Gimple, R.C.; Wang, X. RAS: Striking at the Core of the Oncogenic Circuitry. Front. Oncol. 2019, 9, 965. [Google Scholar] [CrossRef]
- Yu, G.; Chen, X.; Chen, S.; Ye, W.; Hou, K.; Liang, M. MiR-19a, MiR-122 and MiR-223 Are Differentially Regulated by Hepatitis B Virus X Protein and Involve in Cell Proliferation in Hepatoma Cells. J. Transl. Med. 2016, 14, 122. [Google Scholar] [CrossRef] [PubMed]
- Kitab, B.; Alj, H.S.; Ezzikouri, S.; Benjelloun, S. MicroRNAs as Important Players in Host-Hepatitis B Virus Interactions. J. Clin. Transl. Hepatol. 2015, 3, 149–161. [Google Scholar] [CrossRef] [PubMed]
- Kapoor, R.; So, J.B.Y.; Zhu, F.; Too, H.-P.; Yeoh, K.-G.; Yoong, J.S.-Y. Evaluating the Use of MicroRNA Blood Tests for Gastric Cancer Screening in a Stratified Population-Level Screening Program: An Early Model-Based Cost-Effectiveness Analysis. Value Health 2020, 23, 1171–1179. [Google Scholar] [CrossRef]
- Nayagam, S.; Villiers, M.J.d.; Shimakawa, Y.; Lemoine, M.; Thursz, M.R.; Walsh, N.; Hallett, T.B. Impact and Cost-Effectiveness of Hepatitis B Virus Prophylaxis in Pregnancy: A Dynamic Simulation Modelling Study. Lancet Gastroenterol. Hepatol. 2023, 8, 635–645. [Google Scholar] [CrossRef]
- Lima, P.H.; Fan, B.; Bérubé, J.; Cerny, M.; Olivié, D.; Giard, J.-M.; Beauchemin, C.; Tang, A. Cost-Utility Analysis of Imaging for Surveillance and Diagnosis of Hepatocellular Carcinoma. Am. J. Roentgenol. 2019, 213, 17–25. [Google Scholar] [CrossRef]
- Carter, H.E.; Jeffrey, G.P.; Ramm, G.A.; Gordon, L.G. Cost-Effectiveness of a Serum Biomarker Test for Risk-Stratified Liver Ultrasound Screening for Hepatocellular Carcinoma. Value Health 2021, 24, 1454–1462. [Google Scholar] [CrossRef]
- Gnyawali, B.; Pusateri, A.; Nickerson, A.; Jalil, S.; Mumtaz, K. Epidemiologic and Socioeconomic Factors Impacting Hepatitis B Virus and Related Hepatocellular Carcinoma. World J. Gastroenterol. 2022, 28, 3793–3802. [Google Scholar] [CrossRef]
- Popovici, O.; Molnar, G.B.; Popovici, F.; Janţă, D.; Pistol, A.; Azoicăi, D. A Seroprevalence Study of Hepatitis B and C Virus Infections in a Hospitalized Population in Romania, an Opportunity for a Better National Prevention and Control Strategy. JGLD 2016, 25, 25–32. [Google Scholar] [CrossRef]
- Constantinescu, I.; Dinu, A.-A.; Boscaiu, V.; Niculescu, M. Hepatitis B Virus Core Promoter Mutations in Patients with Chronic Hepatitis B and Hepatocellular Carcinoma in Bucharest, Romania. Hepat. Mon. 2014, 14, e22072. [Google Scholar] [CrossRef] [PubMed]
- Voiculescu, M.; Iliescu, L.; Ionescu, C.; Micu, L.; Ismail, G.; Zilisteanu, D.; Micu, G.; Pertache, I. A Cross-Sectional Epidemiological Study of HBV, HCV, HDV and HEV Prevalence in the SubCarpathian and South-Eastern Regions of Romania. J. Gastrointest. Liver Dis. 2010, 19, 43–48. [Google Scholar]
- Aliabadi, E.; Urbanek-Quaing, M.; Maasoumy, B.; Bremer, B.; Grasshoff, M.; Li, Y.; Niehaus, C.E.; Wedemeyer, H.; Kraft, A.R.M.; Cornberg, M. Impact of HBsAg and HBcrAg Levels on Phenotype and Function of HBV-Specific T Cells in Patients with Chronic Hepatitis B Virus Infection. Gut 2022, 71, 2300–2312. [Google Scholar] [CrossRef] [PubMed]
- Seong, G.; Sinn, D.H.; Kang, W.; Gwak, G.-Y.; Choi, M.S.; Lee, J.H.; Koh, K.C.; Woon Paik, S.; Paik, Y.-H. Age and Fibrosis Index for the Prediction of Hepatocellular Carcinoma Risk in Patients with High Hepatitis B Virus DNA but Normal Alanine Aminotransferase. Eur. J. Gastroenterol. Hepatol. 2022, 34, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, A.C.; Figueiredo-Mendes, C.; Villela-Nogueira, C.A.; Marcellin, P. Staging Fibrosis in Chronic Viral Hepatitis. Viruses 2022, 14, 660. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Zong, Y.; Hu, Y.; Sheng, Y.; Xiao, G. High HBV-DNA Serum Levels Are Associated with Type 2 Diabetes in Adults with Positive HBsAg: An Observational Study. Front. Endocrinol. 2023, 14, 1146798. [Google Scholar] [CrossRef]
- Liu, C.; Wang, L.; Xie, H.; Zhang, L.; Wang, B.; Luo, C.; Wang, S.; Tang, M.; Fu, Z.; Ruan, H.; et al. The Relationship between Serum Hepatitis B Virus DNA Level and Liver Histology in Patients with Chronic HBV Infection. PLoS ONE 2018, 13, e0206060. [Google Scholar] [CrossRef]
- Wu, Y.; Gao, C.; Cai, S.; Xia, M.; Liao, G.; Zhang, X.; Peng, J. Circulating MiR-122 Is a Predictor for Virological Response in CHB Patients with High Viral Load Treated with Nucleos(t)Ide Analogs. Front. Genet 2019, 10, 243. [Google Scholar] [CrossRef]
- Jin, B.-X.; Zhang, Y.-H.; Jin, W.-J.; Sun, X.-Y.; Qiao, G.-F.; Wei, Y.-Y.; Sun, L.-B.; Zhang, W.-H.; Li, N. MicroRNA Panels as Disease Biomarkers Distinguishing Hepatitis B Virus Infection Caused Hepatitis and Liver Cirrhosis. Sci. Rep. 2015, 5, 15026. [Google Scholar] [CrossRef]
- Mjelle, R.; Dima, S.O.; Bacalbasa, N.; Chawla, K.; Sorop, A.; Cucu, D.; Herlea, V.; Sætrom, P.; Popescu, I. Comprehensive Transcriptomic Analyses of Tissue, Serum, and Serum Exosomes from Hepatocellular Carcinoma Patients. BMC Cancer 2019, 19, 1007. [Google Scholar] [CrossRef]
- Li, J.-F.; Dai, X.-P.; Zhang, W.; Sun, S.-H.; Zeng, Y.; Zhao, G.-Y.; Kou, Z.-H.; Guo, Y.; Yu, H.; Du, L.-Y.; et al. Upregulation of MicroRNA-146a by Hepatitis B Virus X Protein Contributes to Hepatitis Development by Downregulating Complement Factor H. mBio 2015, 6, e02459-14. [Google Scholar] [CrossRef] [PubMed]
- Hou, Z.; Zhang, J.; Han, Q.; Su, C.; Qu, J.; Xu, D.; Zhang, C.; Tian, Z. Hepatitis B Virus Inhibits Intrinsic RIG-I and RIG-G Immune Signaling via Inducing MiR146a. Sci. Rep. 2016, 6, 26150. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Hu, Q.; Ying, Y.; Lu, C.; Li, W.; Huang, C.; Xu, W.; Li, Q.; Qi, X.; Zhang, X.; et al. Using Next-Generation Sequencing to Identify Novel Exosomal MiRNAs as Biomarkers for Significant Hepatic Fibrosis. Discov. Med. 2021, 31, 147–159. [Google Scholar] [PubMed]
Assay Name | Assay ID | Mature miRNA Sequence | Chromosome Location |
---|---|---|---|
hsa-miR-21 | 000397 | UAGCUUAUCAGACUGAUGUUGA | Chr.17 |
hsa-miR-122 | 002245 | UGGAGUGUGACAAUGGUGUUUG | Chr.18 |
hsa-miR-146a | 000468 | UGAGAACUGAAUUCCAUGGGUU | Chr.5 |
Variable | Total [Interquartile] (n = 61) | High Viremia [Interquartile] (n = 28) | Low Viremia [Interquartile] (n = 20) | Controls [Interquartile] (n = 13) | p-Value ** |
---|---|---|---|---|---|
Age (years) | 46 (35, 56) | 41 (34.8, 49) | 44.5 (37.2, 59.0) | 52 (49, 60) | 0.064 |
Sex—male (%) | 27 (44.3) | 11 (39.3) | 12 (60.0) | 4 (30.8) | 0.197 |
ALT * (U/L) | 25 (19, 31) | 29.5 (24.5, 32.5) | 25.5 (18.8, 35.8) | 20 (16, 22) | 0.001 |
AST * (U/L) | 23 (21, 26) | 24 (22, 26) | 23 (21.0, 29.5) | 22 (18, 23) | 0.113 |
Total bilirubin (mg/dL) | 0.6 (0.5, 0.8) | 0.7 (0.6, 0.8) | 0.5 (0.5, 0.7) | 0.6 (0.4, 0.6) | 0.088 |
RDW * (%) | 12.8 (12.1, 13.2) | 12.6 (12.0, 12.9) | 13.1 (12.7, 13.7) | 13.1 (12.5, 13.4) | 0.049 |
Leucocyte count (×103 µL) | 6.5 (5.7, 7.7) | 6.1 (5.5, 7.3) | 6.9 (5.9, 7.5) | 6.1 (5.8, 7.9) | 0.486 |
Platelet count (×103 µL) | 247 (206, 305) | 258.5 (209.5, 289.2) | 230.5 (185.2, 276.5) | 274 (238, 314) | 0.132 |
Variables | OR * | 95% CI * | p-Value ** |
---|---|---|---|
Age (years) | 0.96 | 0.91, 1.00 | 0.044 |
Sex—male (%) | 0.69 | 0.24, 1.9 | 0.5 |
ALT * (U/L) | 1.03 | 0.99, 1.07 | 0.2 |
AST * (U/L) | 1.0 | 0.92, 1.07 | 0.9 |
Total Bilirubin (mg/dL) | 6.4 | 1.17, 48.1 | 0.047 |
RDW * (%) | 0.57 | 0.31, 0.92 | 0.039 |
Leucocyte count (×103 µL) | 0.91 | 0.65, 1.24 | 0.6 |
Platelet count (×103 µL) | 1.00 | 0.99, 1.01 | 0.8 |
Variable | Total [Interquartile] (n = 33) | Low Viremia [Interquartile] (n = 8) | High Viremia [Interquartile] (n = 19) | Controls [Interquartile] (n = 6) | p-Value ** |
---|---|---|---|---|---|
Age (years) | 46 (38, 59) | 49.5 (45.2, 60.0) | 42 (36.0, 50.5) | 56 (52.0, 64.5) | 0.076 |
Sex—male (%) | 16 (48.5) | 5 (62.5) | 9 (47.4) | 2 (33.3) | 0.551 |
ALT * (U/L) | 27 (21, 34) | 26.5 (22.5, 49.5) | 31 (26.5, 37.5) | 15.5 (14.2, 19.8) | 0.005 |
AST * (U/L) | 23 (21, 27) | 24.5 (22.0, 31.2) | 24 (21.5, 26.0) | 20 (17.5, 22.5) | 0.195 |
Total Bilirubin (mg/dL) | 0.6 [0.5, 0.8) | 0.6 [0.5, 0.8) | 0.7 [0.6, 0.8) | 0.6 [0.4, 0.6) | 0.275 |
RDW* (%) | 12.7 (12.0, 13.1) | 13.1 (12.6, 13.1) | 12.3 (12.1, 12.9) | 12.6 (12.1, 12.9) | 0.521 |
Leucocyte count (×103 µL) | 6.5 (5.8, 7.2) | 6.9 (6.5, 7.4) | 6.5 (5.7, 7.4) | 5.9 (5.5, 6.10 | 0.223 |
Platelet count (×103 µL) | 261 (210, 293) | 256.5 (200.5, 314.0] | 261 (215.0, 280.5) | 260 (240.0, 297.2) | 0.956 |
miR-122 | 1.8 (0.6, 8.4) | 1.6 (1.1, 3.9) | 4.6 (1.3, 10.2) | 0.2 (0.1, 0.4) | 0.001 |
miR-146a | 0.2 (0.2, 0.3) | 0.2 (0.2, 0.3) | 0.2 (0.2, 0.3) | 0.3 (0.3, 0.4) | 0.025 |
Variables | OR * | 95% CI * | p-Value ** |
---|---|---|---|
Age (years) | 0.93 | 0.87, 0.99 | 0.037 |
Sex—male (%) | 0.90 | 0.22, 3.63 | 0.9 |
ALT * (U/L) | 1.02 | 0.97, 1.09 | 0.4 |
AST * (U/L) | 1.0 | 0.90, 1.12 | >0.9 |
Total Bilirubin (mg/dL) | 4.6 | 0.59, 69.9 | 0.2 |
RDW * (%) | 0.98 | 0.32, 2.52 | >0.9 |
Leucocyte count (×103 µL) | 1.11 | 0.75, 1.78 | 0.6 |
Platelet count (×103 µL) | 1.00 | 0.99, 1.01 | 0.8 |
miR-122 | 1.31 | 1.07, 1.76 | 0.03 |
miR-146a | 0.00 | 0.00, 7.65 | 0.15 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Manea, M.; Apostol, D.; Constantinescu, I. A MicroRNA-Based Method for High-Viremia Detection—A New Approach on a Romanian Lot of Chronically Infected Patients with Hepatitis B Virus. Diagnostics 2023, 13, 3425. https://doi.org/10.3390/diagnostics13223425
Manea M, Apostol D, Constantinescu I. A MicroRNA-Based Method for High-Viremia Detection—A New Approach on a Romanian Lot of Chronically Infected Patients with Hepatitis B Virus. Diagnostics. 2023; 13(22):3425. https://doi.org/10.3390/diagnostics13223425
Chicago/Turabian StyleManea, Marina, Dimitri Apostol, and Ileana Constantinescu. 2023. "A MicroRNA-Based Method for High-Viremia Detection—A New Approach on a Romanian Lot of Chronically Infected Patients with Hepatitis B Virus" Diagnostics 13, no. 22: 3425. https://doi.org/10.3390/diagnostics13223425