Functional Analysis of Genes Encoding Juvenile Hormone Receptor Met and Transcription Factor Kr-h1 in the Reproductive Capacity of Coccinella septempunctata Males
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. Artificial and Aphid Diets
2.3. Expression of Met and Kr-h1
2.4. RNAi of Met and Kr-h1
2.4.1. dsRNA Synthesis
2.4.2. dsRNA Injection
2.4.3. Effects of RNAi on Male Adults
2.5. Statistical Analysis
3. Results
3.1. Effects of JH on Met and Kr-h1 Transcription in Adult Male Ladybugs
3.2. Effects of dsRNA Injection on Met and Kr-h1 Expression
3.3. Effects of dsRNA Injection on Testes Development
3.4. Effects of dsRNA Injection on Egg Production
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Liu, Y.; Sheng, Z.T.; Liu, H.H.; Wen, D.; He, Q.Y.; Wang, S.; Shao, W.; Jiang, R.J.; An, S.H.; Sun, Y.N.; et al. Juvenile hormone counteracts the bHLH-PAS transcription factors MET and GCE to prevent caspase-dependent programmed cell death in Drosophila. Development 2009, 136, 2015–2025. [Google Scholar] [CrossRef] [PubMed]
- Santos, C.G.; Humann, F.C.; Hartfelder, K. Juvenile hormone signaling in insect oogenesis. Curr. Opin. Insect Sci. 2019, 31, 43–48. [Google Scholar] [CrossRef]
- Shpigler, H.Y.; Cohen, T.M.; Ben-Shimol, E.; Ben-Betzalel, R.; Levin, E. Juvenile hormone functions as a metabolic rate accelerator in bumble bees (Bombus terrestris). Horm. Behav. 2021, 136, 105073. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.S.; Li, S.; Liu, S.N. juvenile hormone Studies in Drosophila melanogaster. Front. Physiol. 2022, 12, 785320. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Wu, Z.; Wang, Z.; Deng, S.; Zhou, S. Krüppel-homolog 1 mediates juvenile hormone action to promote vitellogenesis and oocyte maturation in the migratory locust. Insect Biochem. Mol. Biol. 2014, 52, 94–101. [Google Scholar] [CrossRef] [PubMed]
- Roy, S.; Saha, T.T.; Zou, Z.; Raikhel, A.S. Regulatory pathways controlling female insect reproduction. Annu. Rev. Entomol. 2018, 63, 489–511. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.X.; Yang, L.B.; He, Q.J.; Zhou, S.T. Regulatory mechanisms of vitellogenesis in insects. Front. Cell Dev. Biol. 2021, 8, 593613–593623. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.L.; Luo, Y.H.; Li, Y.; Luo, W.; Liu, S.N. Research progress on juvenile hormone regulating reproduction in insects. J. Environ. Entomol. 2023, 45, 1483–1491. [Google Scholar]
- Zhang, J.; Liu, X.X.; Liu, Y.C.; An, Y.Q.; Fang, H.B.; Michaud, J.P.; Zhang, H.J.; Li, Y.S.; Zhang, Q.W.; Li, Z. Molecular characterization of primary juvenile hormone responders methoprene-tolerant (Met) and krüppel homolog1 (Kr-h1) in Grapholita molesta (Lepidoptera: Tortricidae) with Clarification of their roles in metamorphosis and reproduction. J. Mol. Entomol. 2019, 112, 2369–2380. [Google Scholar]
- Gijbels, M.; Lenaerts, C.; Broeck, J.V.; Marchal, E. Juvenile hormone receptor Met is essential for ovarian maturation in the desert locust, Schistocerca gregaria. Sci. Rep. 2019, 9, 10797. [Google Scholar] [CrossRef] [PubMed]
- Miao, L.J.; Zhang, N.; Jiang, H.; Dong, F.; Wang, J.J. Involvement of two paralogous methoprene-tolerant genes in the regulation of vitellogenin and vitellogenin receptor expression in the rice stem borer, Chilo suppressalis. Front. Genet. 2020, 11, 609–618. [Google Scholar] [CrossRef]
- Huangfu, N.B.; Zhu, X.Z.; Chang, G.F.; Wang, L.; Li, D.Y.; Zhang, K.X.; Gao, X.K.; Ji, J.C.; Luo, J.Y.; Cui, J.J. Dynamic transcriptome analysis and Methoprene-tolerant gene knockdown reveal that juvenile hormone regulates oogenesis and vitellogenin synthesis in Propylea japonica. Genomics 2021, 113, 2877–2889. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.T. Effects of Juvenile Hormone Analogue on Reproduction and the Development and Predation of F1 Generation in Harmonia axyridis. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2016. [Google Scholar]
- Han, H.; Feng, Z.Y.; Zhang, S.; He, Y.Z. Effects of exogenous juvenile hormone on the ovarian development and transcription levels of the reproduction-related genes in Harmonia axyridis (Coleoptera: Coccinellidae). Acta Entomol. Sin. 2022, 65, 1090–1097. [Google Scholar]
- Adnan, S.M.; Farhana, I.; Rempoulakis, P.; Taylor, P.W. Methoprene-induced matings of young Queensland fruit fly males are effective at inducing sexual inhibition in females. J. Appl. Entomol. 2020, 144, 500–508. [Google Scholar] [CrossRef]
- Parthasarathy, R.; Tan, A.; Sun, Z.; Chen, Z.; Rankin, M.; Palli, S.R. Juvenile hormone regulation of male accessory gland activity in the red flour beetle, Tribolium castaneum. Mech. Dev. 2009, 126, 563–579. [Google Scholar] [CrossRef]
- Lyu, X.Y.; Wang, X.L.; Geng, D.Q.; Jiang, H.; Zou, Z. Juvenile hormone acts on male accessory gland function via regulating L-asparaginase expression and triacylglycerol mobilization in Aedes aegypti. Insect Sci. 2023, 30, 81–94. [Google Scholar] [CrossRef]
- Gassias, E.; Maria, A.; Couzi, P.; Demondion, E.; Durand, N.; Bozzolan, F.; Aguilar, P.; Debernard, S. Involvement of Methoprene-tolerant and Krüppel homolog1 in juvenile hormone-signaling regulating the maturation of male accessory glands in the moth Agrotis ipsilon. Insect Biochem. Mol. Biol. 2021, 132, 103566. [Google Scholar] [CrossRef] [PubMed]
- Coudron, T.A.; Wittmeyer, J.; Kim, Y. Life history and cost analysis for continuous rearing of Podisus maculiventris (Say) (Heteroptera: Pentatomidae) on a zoophytophagous artificial diet. J. Econ. Entomol. 2002, 95, 1159–1168. [Google Scholar] [CrossRef]
- Cheng, Y.; Zhou, Y.H.; Li, F.L. Cloning and spatio-temporal expression of CsKr-h1 encoding the juvenile hormone response gene in Coccinella septempunctata L. Bull. Entomol. Res. 2024, 114, 99–106. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.L.; Chen, Z.H. The concentration of juvenile hormone in female adults of Coccinella septempunctata during ovarian development. Acta Entomol. Sin. 1984, 27, 268–274. [Google Scholar]
- Cheng, Y.; Zhou, Y.H.; Ran, H.Y.; Li, F.L. Effects of different hormones as dietary supplements on biological characteristics of Coccinella septempunctata L. J. Appl. Entomol. 2023, 147, 888–894. [Google Scholar] [CrossRef]
- Cheng, Y.; Zhou, Y.H.; Li, C.; Jin, J.X. Cloning and functional analysis of the juvenile hormone receptor gene CsMet in Coccinella septempunctata. J. Insect Sci. 2024, 24, ieae065. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.H.; Cheng, Y.; Jin, J.X.; Li, W.H.; Li, F.L. Large scale production and release application of Coccinella septempunctata. Southwest China J. Agric. Sci. 2017, 30, 602–605. [Google Scholar]
- Liu, M.Y.; Wang, J.; Wang, M.Z.; Gao, F.; Zhang, H.Z.; Li, Y.Y.; Zang, L.S.; Zhang, L.S. Cloning and expression analysis of juvenile hormone epoxide hydrolase in Coccinella septempunctata. Plant Prot. 2019, 45, 156–162. [Google Scholar]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic. Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.Y.; Zhang, C.X. Data Processing System (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci. 2013, 20, 254–260. [Google Scholar] [CrossRef]
- He, Q.Y.; Wen, D.; Jia, Q.Q.; Cui, L.C.; Wang, J.; Palli, S.R.; Li, S. Heat shock protein 83 (Hsp83) facilitates methoprene-tolerant (Met) nuclear import to modulate juvenile hormone signaling. J. Biol. Chem. 2014, 40, 27874–27885. [Google Scholar] [CrossRef] [PubMed]
- He, Q.Y.; Zhang, Y.X.; Zhang, X.; Xu, D.D.; Dong, W.T.; Li, S.; Wu, R. Nucleoporin Nup358 facilitates nuclear import of methoprene-tolerant (Met) in an importin β-and Hsp83-dependent manner. Insect Biochem. Mol. Biol. 2017, 81, 10–18. [Google Scholar] [CrossRef]
- Aguilar, P.; Bourgeois, T.; Maria, A.; Couzi, P.; Demondion, E.; Bozzolan, F.; Gassias, E.; Force, E.; Debernard, S. Methoprene-tolerant and Krüppel homolog1 are actors of juvenile hormone-signaling controlling the development of male sexual behavior in the moth Agrotis ipsilon. Horm. Behav. 2023, 150, 105330. [Google Scholar] [CrossRef] [PubMed]
- Hejnikova, M.; Paroulek, M.; Hodkova, M. Decrease in Methoprene tolerant and Taiman expression reduces juvenile hormone effects and enhances the levels of juvenile hormone circulating in males of the linden bug Pyrrhocoris apterus. J. Insect Physiol. 2016, 94, 72–80. [Google Scholar] [CrossRef] [PubMed]
- Wilson, T.G.; DeMoor, S.; Lei, J. Juvenile hormone involvement in Drosophila melanogaster male reproduction as suggested by the methoprene-tolerant27 mutant phenotype. Insect Biochem. Mol. Biol. 2003, 33, 1167–1175. [Google Scholar] [CrossRef]
- Chen, J.X.; Geng, B.; He, J.Y. Advances in insect juvenile hormone receptor. J. Environ. Entomol. 2023, 45, 1167–1173. [Google Scholar]
- Li, Y.; Zhang, J.J.; Zhao, S.D.; Wu, X.F. BmNPV-induced hormone metabolic disorder in silkworm leads to enhanced locomotory behavior. Dev. Comp. Immunol. 2021, 121, 104036. [Google Scholar] [CrossRef] [PubMed]
- Bilen, J.; Atallah, J.; Azanchi, R.; Levine, J.D.; Riddiford, L.M. Regulation of onset of female mating and sex pheromone production by juvenile hormone in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 2013, 110, 18321–18326. [Google Scholar] [CrossRef] [PubMed]
- Duportets, L.; Bozzolan, F.; Abrieux, A.; Maria, A.; Gadenne, C.; Debernard, S. The transcription factor Krüppel homolog 1 is linked to the juvenile hormone-dependent maturation of sexual behavior in the male moth, Agrotis ipsilon. Gen. Comp. Endocrinol. 2012, 176, 158–166. [Google Scholar] [CrossRef]
- Ding, K.T. Endocrine Hormones and Their Role in Regulating Reproduction of Spodoptera frugiperda Applied Research. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2023. [Google Scholar]
Primer Name | Primer Sequence | Annealing Temperature |
---|---|---|
Met-F Met-R | GGGTGAGAGTGATGAGCGTT GCAGCCAAATGTCGTTACCC | 58.9 |
Kr-h1-F Kr-h1-R | AACCTTTCGAGTGCCCTGAAT ATGCCTCCTCCTGAACCTACT | 58.3 |
Met-dsRNA-F Met-dsRNA-R | taatacgactcactatagggGATGAATCGACCGGAAAAGA taatacgactcactatagggAGCAAGGAGACGACGGTAGA | |
Kr-h1-dsRNA-F Kr-h1-dsRNA-R | taatacgactcactatagggAAGGATCTCACCACCGACAC taatacgactcactatagggGGCTCCGTTTGTTCTGGTAA | |
GFP-dsRNA-F GFP-dsRNA-R | taatacgactcactatagggGCCAACACTTGTCACTACTT taatacgactcactatagggGGAGTATTTTGTTGATAATGGTCTG | |
Actin-F Actin-R | GATTCGCCATCCAGGACATCTC TCCTTGCTCAGCTTGTTGTAGTC | 60.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, Y.; Zhou, Y.; Li, C. Functional Analysis of Genes Encoding Juvenile Hormone Receptor Met and Transcription Factor Kr-h1 in the Reproductive Capacity of Coccinella septempunctata Males. Insects 2025, 16, 49. https://doi.org/10.3390/insects16010049
Cheng Y, Zhou Y, Li C. Functional Analysis of Genes Encoding Juvenile Hormone Receptor Met and Transcription Factor Kr-h1 in the Reproductive Capacity of Coccinella septempunctata Males. Insects. 2025; 16(1):49. https://doi.org/10.3390/insects16010049
Chicago/Turabian StyleCheng, Ying, Yuhang Zhou, and Cao Li. 2025. "Functional Analysis of Genes Encoding Juvenile Hormone Receptor Met and Transcription Factor Kr-h1 in the Reproductive Capacity of Coccinella septempunctata Males" Insects 16, no. 1: 49. https://doi.org/10.3390/insects16010049
APA StyleCheng, Y., Zhou, Y., & Li, C. (2025). Functional Analysis of Genes Encoding Juvenile Hormone Receptor Met and Transcription Factor Kr-h1 in the Reproductive Capacity of Coccinella septempunctata Males. Insects, 16(1), 49. https://doi.org/10.3390/insects16010049