Molecular Reports of Ruminant Babesia in Southeast Asia
Abstract
:1. Introduction
2. Livestock in Southeast Asia and Relevance of Babesiosis
3. Applicability of PCR Assays for the Detection of Babesia in Ruminants
Organism | Target Gene | PCR Assay Type | Target Size (bp) | Primers (5′→> 3′) | References |
---|---|---|---|---|---|
Babesia bigemina | Apical membrane antigen-1 (ama-1) | Nested PCR | 738 | GTATCAGCCGCCGACCTCCGTAAGT | [31] |
GGCGTCAGACTCCAACGGGGAACCG | |||||
211 | TACTGTGACGAGGACGGATC | ||||
CCTCAAAAGCAGATTCGAGT | |||||
Rhoptry-associated protein-1a (rap-1a) | Nested PCR | 879 | GAGTCTGCCAAATCCTTAC | [34] | |
TCCTCTACAGCTGCTTCG | |||||
412 | AGCTTGCTTTCACAACTCGCC | [35] | |||
TTGGTGCTTTGACCGACGACAT | |||||
18S rRNA | Conventional PCR | 689 | TAGTTGTATTTCAGCCTCGCG | [36] | |
AACATCCAAGCAGCTAHTTAG | |||||
Babesia bovis | Rhoptry-associated protein-1 (rap-1) | Conventional PCR | 356 | CACGAGCAAGGAACTACCGATGTTGA | [27] |
CCAAGGACCTTCAACGTACGAGGTCA | |||||
Spherical body protein-2 (sbp-2) | Nested PCR | 1236 | CCGAATTCCTGGAAGTGGATCTCATGCAACC | [32] | |
ATCTCGAGTCACGAGCACTCTACGGCTTTGCAG | |||||
580 | CGAATCTAGGCATATAAGGCAT | ||||
ATCCCCTCCTAAGGTTGGCTAC | |||||
Spherical body protein-4 (sbp-4) | Nested PCR | 907 | AGTTGTTGGAGGAGGCTAAT | [33] | |
TCCTTCTCGGCGTCCTTTTC | |||||
503 | GAAATCCCTGTTCCAGAG | ||||
TCGTTGATAACACTGCAA | |||||
Variant erythrocyte surface antigen-1α (vesa-1α) | Conventional PCR | 166 | CAAGCATACAACCAGGTGG | [37] | |
ACCCCAGGCACATCCAGCTA | |||||
Babesia ovata | Apical membrane antigen-1 (ama-1) | Conventional PCR | 504 | GATACGAGGCTGTCGGTAGC | [38] |
AGTATAGGTGAGCATCAGTG | |||||
Babesia sp. Mymensingh | Apical membrane antigen-1 (ama-1) | Conventional PCR | 371 | TGGCGCCGACTTCCTGGAGCCCATCTCCAA | [39] |
AGCTGGGGCCCTCCTTCGATGAACCGTCGG | |||||
Babesia ovis | 18S rRNA | Conventional PCR | 549 | TGGGCAGGACCTTGGTTCTTCT | [40] |
CCGCGTAGCGCCGGCTAAATA |
4. Molecular Reports of Babesia in Ruminants in Southeast Asia
4.1. Bovine Babesiosis
Country | Pathogen | Conventional PCR | Nested PCR | ||||
---|---|---|---|---|---|---|---|
Detection Rate (%) * | Samples (n) | References | Detection Rate (%) * | Samples (n) | References | ||
Vietnam | Babesia bigemina | 5.20–22.60 | 96–258 | [20,41,42,43] | 16.00 | 94 | [44] |
Babesia bovis | 4.20–12.30 | 120–258 | [20,43,45] | 15.60–21.30 | 94–96 | [41,44] | |
Babesia sp. Hue | 1.20 | 258 | [42] | n. r. | |||
Babesia ovata | 0.00 | 184 | [29] | n. r. | |||
Babesia sp. Mymensingh | 9.60 | 460 | [30] | n. r. | |||
Philippines | Babesia bigemina | 15.40–61.70 | 339–408 | [46,47] | 0–10.80 | 48–412 | [48,49,50,51] |
Babesia bovis | 10.00–45.40 | 339–408 | [46,47] | 0–11.50 | 48–412 | [48,49,50,51] | |
Babesia ovata | 0.00 | 300 | [29] | n. r. | |||
Babesia sp. Mymensingh | 11.30 | 408 | [30] | n. r. | |||
Babesia spp. | 2.00 | 246 | [52] | n. r. | |||
Thailand | Babesia bigemina | n. r. | 2.90–38.90 | 96–329 | [34,53,54,55,56] | ||
Babesia bovis | n. r. | 1.40–24.50 | 53–1824 | [34,53,54,55,57] | |||
Babesia ovata | 2.50 | 200 | [29] | n. r. | |||
Indonesia | Babesia bigemina | 14.20 | 141 | [58] | 19.10 | 487 | [59] |
Babesia bovis | 34.80 | 141 | [58] | 50.70 | 487 | [59] | |
Myanmar | Babesia bigemina | 9.80 | 713 | [60] | n. r. | ||
Babesia bovis | n. r. | 17.10 | 713 | [60] | |||
Malaysia | Babesia bigemina | 30.50 | 1,045 | [61,62] | n. r. | ||
Babesia bovis | 32.50 | 1045 | [62] | n. r. |
4.2. Bubaline Babesiosis
Country | Pathogen | Conventional PCR | Nested PCR | ||||
---|---|---|---|---|---|---|---|
Detection Rate (%) * | Samples (n) | References | Detection Rate (%) * | Samples (n) | References | ||
Vietnam | Babesia bigemina | 0–4.10 | 43–49 | [41,42] | 0 | 43 | [44] |
Babesia bovis | 32.70 | 49 | [45] | 9.30–23.30 | 43; 43 | [41,44] | |
Babesia ovata | 0 | 49 | [42] | n. r. | |||
Babesia sp. Mymensingh | 2.30–18.40 | 43–49 | [30] | n. r. | |||
Philippines | Babesia bigemina | 4.40 | 272 | [78] | 0–3.00 | 65–114 | [49,50,51,79] |
Babesia bovis | n. r. | 0–21.00 | 65–114 | [49,50,51,79] | |||
Babesia ovata | 0 | 100 | [79] | n. r. | |||
Thailand | Babesia bigemina | n. r. | 3.60 | 305 | [33] | ||
Babesia bovis | n. r. | 11.20 | 305 | [33] | |||
Indonesia | Babesia bigemina | 17.50 | 57 | [58] | n. r. | ||
Babesia bovis | 21.10 | 57 | [58] | n. r. |
4.3. Caprine and Ovine Babesiosis
Country | Host | Pathogen | Detection Rate (%) * | Samples (n) | References |
---|---|---|---|---|---|
Vietnam | goat | Babesia bigemina | 0.80 | 127 | [41] |
sheep | Babesia bigemina | 0 | 51 | [41] | |
goat | Babesia bovis | 0 | 127 | [41] | |
sheep | Babesia bovis | 0 | 51 | [41] | |
goat | Babesia sp. Mymensingh | 1.60 | 127 | [30] | |
sheep | Babesia sp. Mymensingh | 2.00 | 51 | [30] | |
Philippines | goat | Babesia ovis | 1.50 | 396 | [91] |
goat | Babesia spp. | 0 | 100 | [93] | |
Thailand | goat | Babesia spp. | 2.00 | 100 | [92] |
goat | Babesia ovis | 0 | 262 | [94] |
5. Factors Associated with Ruminant Babesia Infection in SEA
6. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Uilenberg, G. Babesia—A historical overview. Vet. Parasitol. 2006, 138, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Schnittger, L.; Rodriguez, A.E.; Florin-Christensen, M.; Morrison, D.A. Babesia: A world emerging. Infect. Genet. Evol. 2012, 12, 1788–1809. [Google Scholar] [CrossRef] [PubMed]
- Hurtado, O.J.B.; Giraldo-Ríos, C. Economic and health impact of the ticks in production animals. In Ticks and Tick-Borne Pathogens; Abubakar, M.K., Perera, P., Eds.; IntechOpen: London, UK, 2019. [Google Scholar]
- Leinbach, T.; Frederick, W. Southeast Asia. Encycl. Br. 2020. Available online: https://www.britannica.com/place/Southeast-Asia (accessed on 1 October 2021).
- OECD. Food and Agriculture Organization of the United Nations. In OECD-FAO Agricultural Outlook 2017–2026; OECD: Paris, France, 2017. [Google Scholar]
- Perera, B.; Oswin, M.A. Livestock production-current status in South and South-east Asia, future directions and priority areas for research. In Animal Production and Health Newsletter; Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, Animal Production and Health Section: Vienna, Austria, 2014; Volume 59, p. 44. Available online: https://www.osti.gov/etdeweb/biblio/22190329 (accessed on 28 October 2021).
- Food and Agriculture Organization. Food and Agriculture Organization. Food and agriculture corporate statistical database 2019. In FAOSTAT Database; Food and Agriculture Organization: Rome, Italy, 2021; Available online: http://faostat.fao.org/ (accessed on 30 October 2021).
- Lee, T.; Hansen, J. Southeast Asia’s growing meat demand and its implications for feedstuffs imports. 2019. Available online: https://www.ers.usda.gov/amber-waves/2019/april/southeast-asia-s-growing-meat-demand-and-its-implications-for-feedstuffs-imports/ (accessed on 22 October 2021).
- Kedkovid, R.; Sirisereewan, C.; Thanawongnuwech, R. Major swine viral diseases: An Asian perspective after the African swine fever introduction. Porc. Health Manag. 2020, 6, 20. [Google Scholar] [CrossRef] [PubMed]
- Rushton, J.; Viscarra, R.; Guerne Bleich, E.; Mcleod, A. Impact of avian influenza outbreaks in the poultry sectors of five South East Asian countries (Cambodia, Indonesia, Lao PDR, Thailand, Viet Nam) outbreak costs, responses and potential long term control. Worlds Poult. Sci. J. 2005, 61, 491–514. [Google Scholar] [CrossRef]
- Park, C.-Y.; Kumar, U.; San Andres, E.A. Food Security in Asia and the Pacific; Asian Development Bank: Mandaluyong City, Philippines, 2013. [Google Scholar]
- Tan, L.P.; Hamdan, R.H.; Hassan, B.N.H.; Reduan, M.F.H.; Okene, I.A.-A.; Loong, S.K.; Khoo, J.J.; Samsuddin, A.S.; Lee, S.H. Rhipicephalus tick: A contextual review for Southeast Asia. Pathogens 2021, 10, 821. [Google Scholar] [CrossRef]
- Jonsson, N.N.; Bock, R.E.; Jorgensen, W.K.; Morton, J.M.; Stear, M.J. Is endemic stability of tick-borne disease in cattle a useful concept? Trends Parasitol. 2012, 28, 85–89. [Google Scholar] [CrossRef] [PubMed]
- Ortega, A.D.S.; Mujitaba, M.A.; Xayalath, S.; Gutierrez, W.; Soriano, A.C.; Szabó, C. Perspectives of the livestock sector in the Philippines: A review. Acta Agrar. Debr. 2021, 1, 175–188. [Google Scholar] [CrossRef]
- Bunmee, T.; Chaiwang, N.; Kaewkot, C.; Jaturasitha, S. Current situation and future prospects for beef production in Thailand —A review. Asian-Australas. J. Anim. Sci. 2018, 31, 968–975. [Google Scholar] [CrossRef]
- Hostiou, N.; Duy, K.P.; Cesaro, J.-D.; Thanh, H.L.T.; Duteurtre, G.; Tien, D.N.; Bonnet, P.; Cournut, S. The Transition of Animal Farming in Vietnam: From Semi-Subsistence to Commercial Systems; Centre de Coopération Internationale en Recherche Agronomique pour le Développement (CIRAD): Montpellier, France, 2016; Available online: https://agritrop.cirad.fr/583049/1/P31.pdf (accessed on 22 October 2021).
- Eybpoosh, S.; Haghdoost, A.A.; Mostafavi, E.; Bahrampour, A.; Azadmanesh, K.; Zolala, F. Molecular epidemiology of infectious diseases. Electron. Physician 2017, 9, 5149–5158. [Google Scholar] [CrossRef]
- Mosqueda, J.; Olvera-Ramirez, A.; Aguilar-Tipacamu, G.; Canto, G.J. Current advances in detection and treatment of babesiosis. Curr. Med. Chem. 2012, 19, 1504–1518. [Google Scholar] [CrossRef] [PubMed]
- Alvarez, J.A.; Rojas, C.; Figueroa, J.V. Diagnostic tools for the identification of Babesia sp. in persistently infected cattle. Pathogens 2019, 8, 143. [Google Scholar] [CrossRef] [PubMed]
- Hau, N.V.; Thu, N.V.; Hanh, H.T.; Sat, L.M. A preliminary study on application of polymerase chain reaction in diagnosis of haemosporidiosis in cattle. Vet. Sci. Tech. 1999, 6, 48–52. [Google Scholar]
- Allsopp, M.T.E.P.; Allsopp, B.A. Molecular sequence evidence for the reclassification of some Babesia species. Ann. N. Y. Acad. Sci. 2006, 1081, 509–517. [Google Scholar] [CrossRef]
- Jalovecka, M.; Sojka, D.; Ascencio, M.; Schnittger, L. Babesia life cycle—When phylogeny meets biology. Trends Parasitol. 2019, 35, 356–368. [Google Scholar] [CrossRef] [PubMed]
- Ruef, B.J.; Dowling, S.C.; Conley, P.G.; Perryman, L.E.; Brown, W.C.; Jasmer, D.P.; Rice-Ficht, A.C. A unique Babesia bovis spherical body protein is conserved among geographic isolates and localizes to the infected erythrocyte membrane. Mol. Biochem. Parasitol. 2000, 105, 1–12. [Google Scholar] [CrossRef]
- Gohil, S.; Kats, L.M.; Sturm, A.; Cooke, B.M. Recent insights into alteration of red blood cells by Babesia bovis: Moovin’ forward. Trends Parasitol. 2010, 26, 591–599. [Google Scholar] [CrossRef] [PubMed]
- Allred, D. Variable and variant protein multigene families in Babesia bovis persistence. Pathogens 2019, 8, 76. [Google Scholar] [CrossRef] [PubMed]
- Simas, P.V.M.; Bassetto, C.C.; Giglioti, R.; Okino, C.H.; de Oliveira, H.N.; de Sena Oliveira, M.C. Use of molecular markers can help to understand the genetic diversity of Babesia bovis. Infect. Genet. Evol. 2020, 79, 104161. [Google Scholar] [CrossRef]
- Figueroa, J.V.; Chieves, L.P.; Johnson, G.S.; Buening, G.M. Multiplex polymerase chain reaction based assay for the detection of Babesia bigemina, Babesia bovis and Anaplasma marginale DNA in bovine blood. Vet. Parasitol. 1993, 50, 69–81. [Google Scholar] [CrossRef]
- Rittipornlertrak, A.; Nambooppha, B.; Simking, P.; Punyapornwithaya, V.; Tiwananthagorn, S.; Jittapalapong, S.; Chung, Y.-T.; Sthitmatee, N. Low levels of genetic diversity associated with evidence of negative selection on the Babesia bovis apical membrane antigen 1 from parasite opulations in Thailand. Infect. Genet. Evol. 2017, 54, 447–454. [Google Scholar] [CrossRef] [PubMed]
- Yoshinari, T.; Sivakumar, T.; Asada, M.; Battsetseg, B.; Huang, X.; Lan, D.T.B.; Inpankaew, T.; Ybañez, A.P.; Alhassan, A.; Thekisoe, O.M.M.; et al. A PCR based survey of Babesia ovata in cattle from various Asian, African and South American countries. J. Vet. Med. Sci. 2013, 75, 211–214. [Google Scholar] [CrossRef] [PubMed]
- Sivakumar, T.; Tuvshintulga, B.; Kothalawala, H.; Silva, S.S.P.; Lan, D.T.B.; Long, P.T.; Ybañez, A.P.; Ybañez, R.H.D.; Francisco Benitez, D.; Tayebwa, D.S.; et al. Host range and geographical distribution of Babesia sp. Mymensingh. Transbound. Emerg. Dis. 2020, 67, 2233–2239. [Google Scholar] [CrossRef]
- Sivakumar, T.; Altangerel, K.; Battsetseg, B.; Battur, B.; AbouLaila, M.; Munkhjargal, T.; Yoshinari, T.; Yokoyama, N.; Igarashi, I. Genetic detection of Babesia bigemina from Mongolian cattle using apical membrane antigen-1 gene-based PCR assay. Vet. Parasitol. 2012, 187, 17–22. [Google Scholar] [CrossRef] [PubMed]
- AbouLaila, M.; Yokoyama, N.; Igarashi, I. Development and evaluation of a nested PCR based on spherical body protein 2 gene for the diagnosis of Babesia bovis infection. Vet. Parasitol. 2010, 169, 45–50. [Google Scholar] [CrossRef] [PubMed]
- Terkawi, M.A.; Huyen, N.X.; Shinuo, C.; Inpankaew, T.; Maklon, K.; Aboulaila, M.; Ueno, A.; Goo, Y.-K.; Yokoyama, N.; Jittapalapong, S.; et al. Molecular and serological prevalence of Babesia bovis and Babesia bigemina in water buffaloes in the northeast region of Thailand. Vet. Parasitol. 2011, 178, 201–207. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.; Aboge, G.O.; Terkawi, M.A.; Yu, L.; Kamyingkird, K.; Luo, Y.; Li, Y.; Goo, Y.-K.; Yamagishi, J.; Nishikawa, Y.; et al. Molecular detection and identification of Babesia bovis and Babesia bigemina in cattle in northern Thailand. Parasitol. Res. 2012, 111, 1259–1266. [Google Scholar] [CrossRef] [PubMed]
- Petrigh, R.; Ruybal, P.; Thompson, C.; Neumann, R.; Moretta, R.; Wilkowsky, S.; Draghi, G.; Echaide, I.; de Echaide, S.T.; Farber, M. Improved molecular tools for detection of Babesia bigemina. Ann. N. Y. Acad. Sci. 2008, 1149, 155–157. [Google Scholar] [CrossRef] [PubMed]
- Ellis, J.; Hefford, C.; Baverstock, P.R.; Dalrymple, B.P.; Johnson, A.M. Ribosomal DNA sequence comparison of Babesia and Theileria. Mol. Biochem. Parasitol. 1992, 54, 87–95. [Google Scholar] [CrossRef]
- Bilgiç, H.B.; Karagenç, T.; Simuunza, M.; Shiels, B.; Tait, A.; Eren, H.; Weir, W. Development of a multiplex PCR assay for simultaneous detection of Theileria annulata, Babesia bovis and Anaplasma marginale in cattle. Exp. Parasitol. 2013, 133, 222–229. [Google Scholar] [CrossRef]
- Sivakumar, T.; Tagawa, M.; Yoshinari, T.; Ybañez, A.P.; Igarashi, I.; Ikehara, Y.; Hata, H.; Kondo, S.; Matsumoto, K.; Inokuma, H.; et al. PCR detection of Babesia ovata from cattle reared in Japan and clinical significance of coinfection with Theileria orientalis. J. Clin. Microbiol. 2012, 50, 2111–2113. [Google Scholar] [CrossRef]
- Sivakumar, T.; Tuvshintulga, B.; Zhyldyz, A.; Kothalawala, H.; Yapa, P.R.; Kanagaratnam, R.; Vimalakumar, S.C.; Abeysekera, T.S.; Weerasingha, A.S.; Yamagishi, J.; et al. Genetic analysis of Babesia isolates from cattle with clinical babesiosis in Sri Lanka. J. Clin. Microbiol. 2018, 56, e00895-18. [Google Scholar] [CrossRef]
- Aktaş, M.; Altay, K.; Dumanlı, N. Development of a polymerase chain reaction method for diagnosis of Babesia ovis infection in sheep and goats. Vet. Parasitol. 2005, 133, 277–281. [Google Scholar] [CrossRef] [PubMed]
- Sivakumar, T.; Lan, D.T.B.; Long, P.T.; Yoshinari, T.; Tattiyapong, M.; Guswanto, A.; Okubo, K.; Igarashi, I.; Inoue, N.; Xuan, X.; et al. PCR detection and genetic diversity of bovine hemoprotozoan parasites in Vietnam. J. Vet. Med. Sci. 2013, 75, 1455–1462. [Google Scholar] [CrossRef] [PubMed]
- Weerasooriya, G.; Sivakumar, T.; Lan, D.T.B.; Long, P.T.; Takemae, H.; Igarashi, I.; Inoue, N.; Yokoyama, N. Epidemiology of bovine hemoprotozoa parasites in cattle and water buffalo in Vietnam. J. Vet. Med. Sci. 2016, 78, 1361–1367. [Google Scholar] [CrossRef] [PubMed]
- Sivakumar, T.; Lan, D.T.B.; Long, P.T.; Viet, L.Q.; Weerasooriya, G.; Kume, A.; Suganuma, K.; Igarashi, I.; Yokoyama, N. Serological and molecular surveys of Babesia bovis and Babesia bigemina among native cattle and cattle imported from Thailand in Hue, Vietnam. J. Vet. Med. Sci. 2018, 80, 333–336. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Luo, Y.; Cao, S.; Terkawi, M.A.; Lan, D.T.B.; Long, P.T.; Yu, L.; Zhou, M.; Gong, H.; Zhang, H.; et al. Molecular and seroepidemiological survey of Babesia bovis and Babesia bigemina infections in cattle and water buffaloes in the central region of Vietnam. Trop. Biomed. 2014, 31, 406–413. [Google Scholar] [PubMed]
- Yokoyama, N.; Sivakumar, T.; Tuvshintulga, B.; Hayashida, K.; Igarashi, I.; Inoue, N.; Long, P.T.; Lan, D.T.B. Genetic variations in merozoite surface antigen genes of Babesia bovis detected in Vietnamese cattle and water buffaloes. Infect. Genet. Evol. 2015, 30, 288–295. [Google Scholar] [CrossRef]
- Ochirkhuu, N.; Konnai, S.; Mingala, C.N.; Okagawa, T.; Villanueva, M.; Pilapil, F.M.I.R.; Murata, S.; Ohashi, K. Molecular epidemiological survey and genetic analysis of vector-borne infections of cattle in Luzon island, the Philippines. Vet. Parasitol. 2015, 212, 161–167. [Google Scholar] [CrossRef]
- Ybañez, A.P.; Sivakumar, T.; Ybañez, R.H.D.; Vincoy, M.R.B.; Tingson, J.A.; Perez, Z.O.; Gabotero, S.R.; Buchorno, L.P.; Inoue, N.; Matsumoto, K.; et al. Molecular survey of bovine vector-borne pathogens in Cebu, Philippines. Vet. Parasitol. 2013, 196, 13–20. [Google Scholar] [CrossRef]
- Yu, L.; Terkawi, M.A.; Cruz-Flores, M.J.; Claveria, F.G.; Aboge, G.O.; Yamagishi, J.; Goo, Y.-K.; Cao, S.; Masatani, T.; Nishikawa, Y.; et al. Epidemiological survey of Babesia bovis and Babesia bigemina infections of cattle in Philippines. J. Vet. Med. Sci. 2013, 75, 995–998. [Google Scholar] [CrossRef]
- Herrera, P.C.; Viloria, V.; Balbin, M.; Mingala, C. Prevalence of babesiosis (Babesia bovis and Babesia bigemina) in cattle and water buffalo in Nueva Ecija, Philippines using nested polymerase chain reaction. Ann. Parasitol. 2017, 63, 309–316. [Google Scholar] [CrossRef] [PubMed]
- Galon, E.M.S.; Ybañez, R.H.D.; Adjou Moumouni, P.F.; Tumwebaze, M.A.; Fabon, R.J.A.; Callanta, M.R.R.; Labutong, K.J.E.; Salazar, G.B.; Liu, M.; Li, J.; et al. Molecular survey of tick-borne pathogens infecting backyard cattle and water buffaloes in Quezon province, Philippines. J. Vet. Med. Sci. 2020, 82, 886–890. [Google Scholar] [CrossRef] [PubMed]
- Prado, I.C.B.; Capuno, L.X.B.; Collera, P.D.L.P.; Cabralda, A.P.D.; De Ramos, K.A.S.; Bernardo, J.M.G.; Divina, B.P.; Masatani, T.; Tanaka, T.; Galay, R.L. Molecular detection and characterization of Babesia and Theileria in cattle and water buffaloes from southern Luzon, Philippines. Microorganisms 2022, 10, 678. [Google Scholar] [CrossRef] [PubMed]
- Foronda, J.; Baticados, W.; Baticados, A. Molecular evidence of Babesia spp. in cattle in the Philippines. Online J. Vet. Res. 2010, 14, 188–193. [Google Scholar]
- Simking, P.; Yatbantoong, N.; Saetiew, N.; Saengow, S.; Yodsri, W.; Chaiyarat, R.; Wongnarkpet, S.; Jittapalapong, S. Prevalence and risk factors of Babesia infections in cattle trespassing natural forest areas in Salakpra wildlife sanctuary, Kanchanaburi province. J. Trop. Med. Parasitol. 2014, 37, 10–19. [Google Scholar]
- Jirapattharasate, C.; Adjou Moumouni, P.F.; Cao, S.; Iguchi, A.; Liu, M.; Wang, G.; Zhou, M.; Vudriko, P.; Changbunjong, T.; Sungpradit, S.; et al. Molecular epidemiology of bovine Babesia spp. and Theileria orientalis parasites in beef cattle from northern and northeastern Thailand. Parasitol. Internat. 2016, 65, 62–69. [Google Scholar] [CrossRef]
- Jirapattharasate, C.; Adjou Moumouni, P.F.; Cao, S.; Iguchi, A.; Liu, M.; Wang, G.; Zhou, M.; Vudriko, P.; Efstratiou, A.; Changbunjong, T.; et al. Molecular detection and genetic diversity of bovine Babesia spp., Theileria orientalis, and Anaplasma marginale in beef cattle in Thailand. Parasitol. Res. 2017, 116, 751–762. [Google Scholar] [CrossRef] [PubMed]
- Rittisut, B.; Sarkaou, P.; Na-Lampang, K. Detection of blood parasites infection in native cattle in Chiang Mai under the participatory one health disease and detection project. J. Agric. Res. Ext. 2018, 35, 32–45. [Google Scholar]
- Simking, P.; Saengow, S.; Bangphoomi, K.; Sarataphan, N.; Wongnarkpet, S.; Inpankaew, T.; Jittapalapong, S.; Munkhjargal, T.; Sivakumar, T.; Yokoyama, N.; et al. The molecular prevalence and MSA-2b gene-based genetic dversity of Babesia bovis in dairy cattle in Thailand. Vet. Parasitol. 2013, 197, 642–648. [Google Scholar] [CrossRef]
- Sawitri, D.H.; Wardhana, A.H.; Ekawasti, F.; Dewi, D.A. Parasitological and molecular detection of babesiosis in cattle and buffalo in west and central Java. In Proceedings of the 9th International Seminar on Tropical Animal Production (ISTAP 2021), Yogyakarta, Indonesia, 21–22 September 2021; Atlantis Press: Amsterdam, The Netherlands, 2021. [Google Scholar] [CrossRef]
- Guswanto, A.; Allamanda, P.; Mariamah, E.S.; Sodirun, S.; Wibowo, P.E.; Indrayani, L.; Nugroho, R.H.; Wirata, I.K.; Jannah, N.; Dias, L.P.; et al. Molecular and serological detection of bovine babesiosis in Indonesia. Parasites Vectors 2017, 10, 550. [Google Scholar] [CrossRef]
- Bawm, S.; Htun, L.L.; Maw, N.N.; Ngwe, T.; Tosa, Y.; Kon, T.; Kaneko, C.; Nakao, R.; Sakurai, T.; Kato, H.; et al. Molecular survey of Babesia infections in cattle from different areas of Myanmar. Ticks Tick-Borne Dis. 2016, 7, 204–207. [Google Scholar] [CrossRef]
- Ola-Fadunsin, S.D.; Sharma, R.S.K.; Abdullah, D.A.; Gimba, F.I.; Abdullah, F.F.J.; Sani, R.A. The molecular prevalence, distribution and risk factors associated with Babesia bigemina infection in Peninsular Malaysia. Ticks Tick-Borne Dis. 2021, 12, 101653. [Google Scholar] [CrossRef] [PubMed]
- Ola-Fadunsin, S.D.; Maizatul, A.M.; Ibrahim, A.R.; Amlizawathy, A.; Chandrawathani, P.; Jesse, F.F.A.; Sani, R.A.; Sharma, R.S.K. Molecular prevalence and species co-Infection of bovine haemoparasites in Peninsular Malaysia. Malays. J. Vet. Res. 2017, 8, 13–22. [Google Scholar]
- Bock, R.; Jackson, L.; De Vos, A.; Jorgensen, W. Babesiosis of cattle. Parasitology 2004, 129, S247–S269. [Google Scholar] [CrossRef] [PubMed]
- McLeod, R.; Kristjanson, P. Final report of joint eSYS/ILRI/ACIAR Tick Cost project—Economic impact of ticks and tick-borne diseases to livestock in Africa, Asia and Australia. Int. Livest. Res. Inst. Nairobi. 1999, 3. [Google Scholar]
- Ganzinelli, S.; Rodriguez, A.; Schnittger, L.; Florin-Christensen, M. Babesia in domestic ruminants. In Parasitic Protozoa of Farm Animals and Pets; Florin-Christensen, M., Schnittger, L., Eds.; Springer International Publishing: Cham, Switzerland, 2018; pp. 215–239. [Google Scholar]
- Ohta, M.; Tsuji, M.; Tsuji, N.; Fujisaki, K. Morphological, serological and antigenic characteristics, and protein profile of newly isolated Japanese bovine Babesia parasite with particular reference to those of B. ovata. J. Vet. Med. Sci. 1995, 57, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Yin, H.; Liu, Z.; Yang, D.; Guan, G.; Liu, A.; Ma, M.; Dang, S.; Lu, B.; Sun, C.; et al. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences. Vet. Parasitol. 2005, 133, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Roy, B.C.; Krücken, J.; Ahmed, J.S.; Majumder, S.; Baumann, M.P.; Clausen, P.-H.; Nijhof, A.M. Molecular identification of tick-borne pathogens infecting cattle in Mymensingh district of Bangladesh reveals emerging species of Anaplasma and Babesia. Transbound. Emerg. Dis. 2018, 65, e231–e242. [Google Scholar] [CrossRef]
- Schnittger, L.; Ganzinelli, S.; Bhoora, R.; Omondi, D.; Nijhof, A.M.; Florin-Christensen, M. The piroplasmida Babesia, Cytauxzoon, and Theileria in farm and companion animals: Species compilation, molecular phylogeny, and evolutionary insights. Parasitol. Res. 2022, 121, 1207–1245. [Google Scholar] [CrossRef] [PubMed]
- Zintl, A.; Mulcahy, G.; Skerrett, H.E.; Taylor, S.M.; Gray, J.S. Babesia divergens, a bovine blood parasite of veterinary and zoonotic importance. Clin. Microbiol. Rev. 2003, 16, 622–636. [Google Scholar] [CrossRef]
- Sivakumar, T.; Igarashi, I.; Yokoyama, N. Babesia ovata: Taxonomy, phylogeny and epidemiology. Vet. Parasitol. 2016, 229, 99–106. [Google Scholar] [CrossRef] [PubMed]
- Decaro, N.; Larocca, V.; Parisi, A.; Losurdo, M.; Lia, R.P.; Greco, M.F.; Miccolis, A.; Ventrella, G.; Otranto, D.; Buonavoglia, C. Clinical bovine piroplasmosis caused by Babesia occultans in Italy. J. Clin. Microbiol. 2013, 51, 2432–2434. [Google Scholar] [CrossRef] [PubMed]
- Noaman, V.; Ghadimipour, R.; Nabavi, R. First report of Babesia occultans in two symptomatic cows in Iran. Parasitol. Res. 2021, 120, 1915–1919. [Google Scholar] [CrossRef] [PubMed]
- Borghese, A.; Mazzi, M. Buffalo population and strategies in the world. In Buffalo Production and Research; FAO regional office for Europe interregional cooperative research network on buffalo (ESCORENA): Rome, Italy, 2005; pp. 1–2. [Google Scholar]
- Singla, L.D.; Singh, J.; Aulakh, G.S. Babesiosis in an unusual case of Murrah buffalo with six functional teats. Buffalo Bull. 2002, 21, 55–58. [Google Scholar]
- Benitez, D.; Mesplet, M.; Echaide, I.; de Echaide, S.T.; Schnittger, L.; Florin-Christensen, M. Mitigated clinical disease in water buffaloes experimentally infected with Babesia bovis. Ticks Tick-borne Dis. 2018, 9, 1358–1363. [Google Scholar] [CrossRef]
- He, L.; Liu, Q.; Yao, B.; Zhou, Y.; Hu, M.; Fang, R.; Zhao, J. A historical overview of research on Babesia orientalis, a protozoan parasite infecting water buffalo. Front. Microbiol. 2017, 8, 1323. [Google Scholar] [CrossRef] [PubMed]
- Mingala, C.N.; Konnai, S.; Cruz, L.C.; Onuma, M.; Ohashi, K. Comparative moleculo-immunological analysis of swamp- and riverine-type water buffaloes responses. Cytokine 2009, 46, 273–282. [Google Scholar] [CrossRef]
- Galon, E.M.S.; Adjou Moumouni, P.F.; Ybañez, R.H.D.; Ringo, A.E.; Efstratiou, A.; Lee, S.-H.; Liu, M.; Guo, H.; Gao, Y.; Li, J.; et al. First molecular detection and characterization of tick-borne pathogens in water buffaloes in Bohol, Philippines. Ticks Tick-Borne Dis. 2019, 10, 815–821. [Google Scholar] [CrossRef]
- Mazinani, M.; Rude, B. Population, world production and quality of sheep and goat products. Am. J. Anim. Vet. Sci. 2020, 15, 291–299. [Google Scholar] [CrossRef]
- Kumar, S.; Roy, M.M. Small ruminant’s role in sustaining rural livelihoods in arid and semiarid regions and their potential for commercialization. In New Paradigms in Livestock Production from Traditional to Commercial Farming and Beyond; Agrotech Publishing Academy: Udaipur, India, 2013; pp. 57–80. [Google Scholar]
- Sargison, N. The critical importance of planned small ruminant livestock health and production in addressing global challenges surrounding food production and poverty alleviation. N. Z. Vet. J. 2020, 68, 136–144. [Google Scholar] [CrossRef] [PubMed]
- Mcleod, R.S. Costs of major parasites to the Australian livestock industries. Int. J. Parasitol. 1995, 25, 1363–1367. [Google Scholar] [CrossRef]
- Lempereur, L.; Beck, R.; Fonseca, I.; Marques, C.; Duarte, A.; Santos, M.; Zúquete, S.; Gomes, J.; Walder, G.; Domingos, A.; et al. Guidelines for the detection of Babesia and Theileria parasites. Vector Borne Zoonotic Dis. 2017, 17, 51–65. [Google Scholar] [CrossRef]
- Yeruham, I.; Hadani, A.; Galker, F. Some epizootiological and clinical aspects of ovine babesiosis caused by Babesia ovis—A review. Vet. Parasitol. 1998, 74, 153–163. [Google Scholar] [CrossRef]
- Hashemi-Fesharki, R. Tick-borne diseases of sheep and goats and their related vectors in Iran. Parassitologia 1997, 39, 115–117. [Google Scholar] [PubMed]
- Stuen, S. Haemoparasites—Challenging and wasting infections in small ruminants: A review. Animals 2020, 10, 2179. [Google Scholar] [CrossRef] [PubMed]
- Smith, M.C.; Sherman, D.M. Goat Medicine; John Wiley and Sons: Hoboken, NJ, USA, 2011. [Google Scholar]
- Hasherni-Fesharki, R.; Uilenberg, G. Babesia crassa n. sp. (Sporozoa, Babesiidae) of domestic sheep in Iran. Vet. Q. 1981, 3, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Friedhoff, K.T. Tick-borne diseases of sheep and goats caused by Babesia, Theileria or Anaplasma spp. Parassitologia 1997, 39, 99–109. [Google Scholar]
- National Research Center for Protozoan Diseases; Galon, E.M.; Ybañez, R.H.; Macalanda, A.M.; Liu, M.; Tumwebaze, M.A.; Byamukama, B.; Ji, S.; Zafar, I.; Li, J.; et al. First Molecular Confirmation of Caprine Piroplasma in the Philippine; Obihiro University of Agriculture and Veterinary Medicine: Obihiro, Japan, 2022; submitted. [Google Scholar]
- Tu, H.L.C.; Nugraheni, Y.R.; Tiawsirisup, S.; Saiwichai, T.; Thiptara, A.; Kaewthamasorn, M. Development of a novel multiplex PCR assay for the detection and differentiation of Plasmodium caprae from Theileria luwenshuni and Babesia spp. in goats. Acta Trop. 2021, 220, 105957. [Google Scholar] [CrossRef] [PubMed]
- Ybañez, A.P.; Arrabis, O.V.; Alvarez, D.J.M.; Galon, E.M.S.; Jayag, R.M.P.; Delan, E.S.; Ybañez, R.H.D.; Xuan, X. Evaluation on the presence of Anaplasma, Ehrlichia, and Babesia spp. in goats (Capra hircus) in Cebu, the Philippines. Vet. World 2019, 12, 774–777. [Google Scholar] [CrossRef] [PubMed]
- Udonsom, R.; Mahittikorn, A.; Jirapattharasate, C. Molecular detection and genetic diversity of tick-borne pathogens in goats from the southern part of Thailand. Pathogens 2022, 11, 477. [Google Scholar] [CrossRef]
Country | Cattle | Water Buffalo | Goat | Sheep | Ruminant Population per Country |
---|---|---|---|---|---|
Brunei Darussalam | 617 | 2292 | 1016 | 4649 * | 8574 |
Cambodia | 2,848,846 * | 605,638 * | n. a. | n. a. | 3,454,484 |
Indonesia | 17,118,650 | 1,141,298 | 18,975,955 | 17,794,344 | 55,030,247 |
Laos | 2,092,344 * | 1,209,712 * | 639,715 * | n. a. | 3,941,771 |
Malaysia | 683,501 | 107,347 | 371,747 | 127,796 | 1,290,391 |
Myanmar | 18,583,932 * | 4,082,914 * | 10,940,257 * | 1,309,307 * | 34,916,410 |
Philippines | 2,535,414 | 2,873,561 | 3,755,879 | 30,000 | 9,194,854 |
Singapore | 169 * | n. a. | 755 * | n. a. | 924 |
Thailand | 4,600,000 # | 897,368 * | 478,559 * | 39,662 * | 6,015,589 |
Timor-Leste | 213,235 * | 126,066 * | 66,504 * | 42,593 * | 448,398 |
Vietnam | 6,060,024 | 2,387,887 | 2,609,198 | n. a. | 11,057,109 |
Total Ruminant Population in Southeast Asia | 54,736,732 | 13,434,083 | 37,839,585 | 19,348,351 | 125,358,751 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galon, E.M.; Zafar, I.; Ji, S.; Li, H.; Ma, Z.; Xuan, X. Molecular Reports of Ruminant Babesia in Southeast Asia. Pathogens 2022, 11, 915. https://doi.org/10.3390/pathogens11080915
Galon EM, Zafar I, Ji S, Li H, Ma Z, Xuan X. Molecular Reports of Ruminant Babesia in Southeast Asia. Pathogens. 2022; 11(8):915. https://doi.org/10.3390/pathogens11080915
Chicago/Turabian StyleGalon, Eloiza May, Iqra Zafar, Shengwei Ji, Hang Li, Zhuowei Ma, and Xuenan Xuan. 2022. "Molecular Reports of Ruminant Babesia in Southeast Asia" Pathogens 11, no. 8: 915. https://doi.org/10.3390/pathogens11080915