Molecular Analysis of Aggregatibacter actinomycetemcomitans ApiA, a Multi-Functional Protein
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
2.2. Cloning of Full-Length apiA and Variants into pET-29(b)+
2.3. Construction of ApiA Deletion Strain in A. actinomycetemcomitans IDH781
2.4. Immunofluorescence Microscopy
2.5. Electron Microscopy
2.6. Auto-Aggregation Assay
2.7. Buccal Epithelial Cell Culture
2.8. Epithelial Cell Binding by Thymidine-Radiolabeled Bacteria
2.9. Complement Resistance Assays
2.10. ELISA to Identify the ApiA Passenger Domain That Binds to Recombinant Factor H
2.11. Peptide Effects on Complement Sensitivity Due to Factor H Binding
2.12. Growth Conditions for RNA Extractions
2.13. RNA Extractions and qRT-PCR
2.14. Quantitative RT-PCR
2.15. Statistical Analysis
3. Results
3.1. Immunofluorescence and Transmission Electron Microscopy
3.2. Auto-Aggregation Assay
3.3. Buccal Epithelial Cell Binding by Thymidine-Radiolabeled Bacteria
3.4. Complement Resistance Assays
3.5. ELISA to Identify the ApiA Passenger Domain That Binds to Recombinant Factor H
3.6. Peptides’ Effects on Complement Sensitivity
3.7. Quantitative RT-PCR of Cells Grown with and Without Serum
4. Discussion
5. Conclusions
- (1)
- Studies designed to examine the specific region in the A. actinomycetemcomitans apiA gene responsible for complement resistance were assessed using an E. coli vector to examine its complement resistance. Sequential gene deletions in apiA were examined by immunofluorescence and immunogold transmission electron microscopy for surface expression and were confirmed by measuring auto-aggregation and buccal epithelial binding to assess the functional surface expression of apiA;
- (2)
- E. coli-deleted regions (∆34–80 and ∆186–217) failed to show epithelial cell binding (∆34–80) and complement resistance (∆186–217);
- (3)
- Factor H binding, critical for complement resistance via the alternative pathway, was used to probe the region(s) most likely responsible for complement resistance, and a 32-amino-acid protein within the ∆186–217 deletion was identified;
- (4)
- Peptides were designed for further testing within this 32-amino-acid region, and a 13-amino-acid segment provided preliminary evidence that this area was responsible for complement resistance;
- (5)
- apiA was deleted in A. actinomycetemcomitans IDH781, and qRT-PCR was used to identify several other relevant genes in A. actinomycetemcomitans that were either up- or downregulated in the presence or absence of serum in wild-type A. actinomycetemcomitans or in ΔapiA. actinomycetemcomitans. It was proposed that apiA could be associated with global regulation or some other regulatory manner that could affect the expression of prominent stress-related genes that could play a role in overall A. actinomycetemcomitans adaptability and stress survival;
- (6)
- This is the first study to identify a specific region within apiA responsible for complement resistance via the alternative pathway and, as such, provides a good starting point for future studies that can achieve a more in-depth model of complement resistance and the role of apiA in the global regulation of A. actinomycetemcomitans.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Marsh, P.D.; Zaura, E. Dental biofilm: Ecological interactions in health and disease. J. Clin. Periodontol. 2017, 44 (Suppl. S18), S12–S22. [Google Scholar] [CrossRef] [PubMed]
- Hajishengallis, G.; Lamont, R.J.; Koo, H. Oral polymicrobial communities: Assembly, function, and impact on diseases. Cell Host Microbe 2023, 31, 528–538. [Google Scholar] [CrossRef] [PubMed]
- Bamashmous, S.; Kotsakis, G.A.; Kerns, K.A.; Leroux, B.G.; Zenobia, C.; Chen, D.; Trivedi, H.M.; McLean, J.S.; Darveau, R.P. Human variation in gingival inflammation. Proc. Natl. Acad. Sci. USA 2021, 118, e2012578118. [Google Scholar] [CrossRef] [PubMed]
- Socransky, S.S.; Haffajee, A.D.; Cugini, M.A.; Smith, C.; Kent, R.L., Jr. Microbial complexes in subgingival plaque. J. Clin. Periodontol. 1998, 25, 134–144. [Google Scholar] [CrossRef]
- Shaddox, L.M.; Spencer, W.P.; Velsko, I.M.; Al-Kassab, H.; Huang, H.; Calderon, N.; Aukhil, I.; Wallet, S.M. Localized aggressive periodontitis immune response to healthy and diseased subgingival plaque. J. Clin. Periodontol. 2016, 43, 746–753. [Google Scholar] [CrossRef]
- Zambon, J.J. Actinobacillus actinomycetemcomitans in human periodontal disease. J. Clin. Periodontol. 1985, 12, 707–711. [Google Scholar] [CrossRef]
- Fine, D.H.; Schreiner, H.; Velusamy, S.K. Aggregatibacter, A Low Abundance Pathobiont That Influences Biogeography, Microbial Dysbiosis, and Host Defense Capabilities in Periodontitis: The History of A Bug, And Localization of Disease. Pathogens 2020, 9, 179. [Google Scholar] [CrossRef]
- Planet, P.J.; Kachlany, S.C.; Fine, D.H.; DeSalle, R.; Figurski, D.H. The widespread colonization island of Actinobacillus actinomycetemcomitans. Nat. Genet. 2003, 34, 193–198. [Google Scholar] [CrossRef]
- Kachlany, S.C.; Fine, D.H.; Figurski, D.H. Secretion of RTX leukotoxin by Actinobacillus actinomycetemcomitans. Infect. Immun. 2000, 68, 6094–6100. [Google Scholar] [CrossRef]
- Schreiner, H.; Li, Y.; Cline, J.; Tsiagbe, V.K.; Fine, D.H. A comparison of Aggregatibacter actinomycetemcomitans (Aa) virulence traits in a rat model for periodontal disease. PLoS ONE 2013, 8, e69382. [Google Scholar] [CrossRef]
- Kaplan, J.B.; Meyenhofer, M.F.; Fine, D.H. Biofilm growth and detachment of Actinobacillus actinomycetemcomitans. J. Bacteriol. 2003, 185, 1399–1404. [Google Scholar] [CrossRef] [PubMed]
- Kaplan, J.B. Biofilm dispersal: Mechanisms, clinical implications and potential therapeutic uses. J. Dent. Res. 2010, 89, 205–218. [Google Scholar] [CrossRef] [PubMed]
- Shanmugam, M.; Gopal, P.; El Abbar, F.; Schreiner, H.C.; Kaplan, J.B.; Fine, D.H.; Ramasubbu, N. Role of exopolysaccharide in Aggregatibacter actinomycetemcomitans-induced bone resorption in a rat model for periodontal disease. PLoS ONE 2015, 10, e0117487. [Google Scholar] [CrossRef] [PubMed]
- Fine, D.H.; Velliyagounder, K.; Furgang, D.; Kaplan, J.B. The Actinobacillus actinomycetemcomitans autotransporter adhesin Aae exhibits specificity for buccal epithelial cells from humans and old world primates. Infect. Immun. 2005, 73, 1947–1953. [Google Scholar] [CrossRef] [PubMed]
- Yue, G.; Kaplan, J.B.; Furgang, D.; Mansfield, K.G.; Fine, D.H. A second Aggregatbacter actinomycetemcomitans autotransporter adhesin that exhibits specificity for buccal epithelial cells of humans and Old World Primates. Infect. Immun. 2007, 75, 4440–4448. [Google Scholar] [CrossRef]
- Cugini, C.; Mei, Y.; Furgang, D.; George, N.; Ramasubbu, N.; Fine, D.H. Utilization of Variant and Fusion Proteins To Functionally Map the Aggregatibacter actinomycetemcomitans Trimeric Autotransporter Protein ApiA. Infect. Immun. 2018, 86, e00697-17. [Google Scholar] [CrossRef]
- Lindholm, M.; Min Aung, K.; Nyunt Wai, S.; Oscarsson, J. Role of OmpA1 and OmpA2 in Aggregatibacter actinomycetemcomitans and Aggregatibacter aphrophilus serum resistance. J. Oral. Microbiol. 2019, 11, 1536192. [Google Scholar] [CrossRef]
- Fine, D.H.; Patil, A.G.; Velusamy, S.K. Aggregatibacter actinomycetemcomitans (Aa) Under the Radar: Myths and Misunderstandings of Aa and Its Role in Aggressive Periodontitis. Front. Immunol. 2019, 10, 728. [Google Scholar] [CrossRef]
- Loesche, W.J.; Gusberti, F.; Mettraux, G.; Higgins, T.; Syed, S. Relationship between oxygen tension and subgingival bacterial flora in untreated human periodontal pockets. Infect. Immun. 1983, 42, 659–667. [Google Scholar] [CrossRef]
- Ebersole, J.L.; Cappelli, D.; Sandoval, M.N. Subgingival distribution of A. actinomycetemcomitans in periodontitis. J. Clin. Periodontol. 1994, 21, 65–75. [Google Scholar] [CrossRef]
- Kononen, E.; Muller, H.P. Microbiology of aggressive periodontitis. Periodontol. 2000 2014, 65, 46–78. [Google Scholar] [CrossRef] [PubMed]
- Aberg, C.H.; Kelk, P.; Johansson, A. Aggregatibacter actinomycetemcomitans: Virulence of its leukotoxin and association with aggressive periodontitis. Virulence 2015, 6, 188–195. [Google Scholar] [CrossRef] [PubMed]
- Shillitoe, E.J.; Lehner, T. Immunoglobulins and complement in crevicular fluid, serum and saliva in man. Arch. Oral. Biol. 1972, 17, 241–247. [Google Scholar] [CrossRef] [PubMed]
- Lambris, J.D.; Ricklin, D.; Geisbrecht, B.V. Complement evasion by human pathogens. Nat. Rev. Microbiol. 2008, 6, 132–142. [Google Scholar] [CrossRef] [PubMed]
- Potempa, J.; Pike, R.N. Corruption of innate immunity by bacterial proteases. J. Innate Immun. 2009, 1, 70–87. [Google Scholar] [CrossRef]
- Blom, A.M.; Hallstrom, T.; Riesbeck, K. Complement evasion strategies of pathogens-acquisition of inhibitors and beyond. Mol. Immunol. 2009, 46, 2808–2817. [Google Scholar] [CrossRef]
- Hovingh, E.S.; van den Broek, B.; Jongerius, I. Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion. Front. Microbiol. 2016, 7, 2004. [Google Scholar] [CrossRef]
- Zipfel, P.F.; Hallstrom, T.; Riesbeck, K. Human complement control and complement evasion by pathogenic microbes--tipping the balance. Mol. Immunol. 2013, 56, 152–160. [Google Scholar] [CrossRef]
- Asakawa, R.; Komatsuzawa, H.; Goncalves, R.B.; Izumi, S.; Fujiwara, T.; Nakano, Y.; Suzuki, N.; Uchida, Y.; Ouhara, K.; Shiba, H.; et al. Outer membrane protein 100, a versatile virulence factor of Actinobacillus actinomycetemcomitans. Mol. Microbiol. 2003, 50, 1125–1139. [Google Scholar] [CrossRef]
- Walport, M.J. Complement. Second of two parts. N. Engl. J. Med. 2001, 344, 1140–1144. [Google Scholar] [CrossRef]
- Janeway, C.J.; Travers, P.; Walport, M.; Shlomchik, M. The Immune System in Healthb and Disease, 5th ed.; Garland Science: New York, NY, USA, 2001. [Google Scholar]
- Ripoche, J.; Day, A.J.; Harris, T.J.; Sim, R.B. The complete amino acid sequence of human complement factor H. Biochem. J. 1988, 249, 593–602. [Google Scholar] [CrossRef] [PubMed]
- Kopp, A.; Hebecker, M.; Svobodova, E.; Jozsi, M. Factor h: A complement regulator in health and disease, and a mediator of cellular interactions. Biomolecules 2012, 2, 46–75. [Google Scholar] [CrossRef] [PubMed]
- Schenkein, H.A. The role of complement in periodontal diseases. Crit. Rev. Oral. Biol. Med. 1991, 2, 65–81. [Google Scholar] [CrossRef] [PubMed]
- Mei, Y. Functional Mapping of Aggregatibacter Actinomycetcomitans Autotransporter Adhesin Protein, ApiA. Ph.D. Thesis, Rutgers School of Dental Medicine, Newark, NJ, USA, 2014. [Google Scholar]
- Komatsuzawa, H.; Kawai, T.; Wilson, M.E.; Taubman, M.A.; Sugai, M.; Suginaka, H. Cloning of the gene encoding the Actinobacillus actinomycetemcomitans serotype b OmpA-like outer membrane protein. Infect. Immun. 1999, 67, 942–945. [Google Scholar] [CrossRef] [PubMed]
- Cugini, C.; Ramasubbu, N.; Tsiagbe, V.K.; Fine, D.H. Dysbiosis From a Microbial and Host Perspective Relative to Oral Health and Disease. Front. Microbiol. 2021, 12, 617485. [Google Scholar] [CrossRef]
- Oscarsson, J.; Claesson, R.; Lindholm, M.; Hoglund Aberg, C.; Johansson, A. Tools of Aggregatibacter actinomycetemcomitans to Evade the Host Response. J. Clin. Med. 2019, 8, 1079. [Google Scholar] [CrossRef]
- Ouhara, K.; Komatsuzawa, H.; Shiba, H.; Uchida, Y.; Kawai, T.; Sayama, K.; Hashimoto, K.; Taubman, M.A.; Kurihara, H.; Sugai, M. Actinobacillus actinomycetemcomitans outer membrane protein 100 triggers innate immunity and production of beta-defensin and the 18-kilodalton cationic antimicrobial protein through the fibronectin-integrin pathway in human gingival epithelial cells. Infect. Immun. 2006, 74, 5211–5220. [Google Scholar] [CrossRef]
- Olsen, I.; Lambris, J.D.; Hajishengallis, G. Porphyromonas gingivalis disturbs host-commensal homeostasis by changing complement function. J. Oral. Microbiol. 2017, 9, 1340085. [Google Scholar] [CrossRef]
- McDowell, J.V.; Frederick, J.; Miller, D.P.; Goetting-Minesky, M.P.; Goodman, H.; Fenno, J.C.; Marconi, R.T. Identification of the primary mechanism of complement evasion by the periodontal pathogen, Treponema denticola. Mol. Oral. Microbiol. 2011, 26, 140–149. [Google Scholar] [CrossRef]
- Miller, D.P.; McDowell, J.V.; Rhodes, D.V.; Allard, A.; Caimano, M.; Bell, J.K.; Marconi, R.T. Sequence divergence in the Treponema denticola FhbB protein and its impact on factor H binding. Mol. Oral. Microbiol. 2013, 28, 316–330. [Google Scholar] [CrossRef]
- Miller, D.P.; McDowell, J.V.; Bell, J.K.; Goetting-Minesky, M.P.; Fenno, J.C.; Marconi, R.T. Analysis of the complement sensitivity of oral treponemes and the potential influence of FH binding, FH cleavage and dentilisin activity on the pathogenesis of periodontal disease. Mol. Oral. Microbiol. 2014, 29, 194–207. [Google Scholar] [CrossRef] [PubMed]
- Amano, A.; Chen, C.; Honma, K.; Li, C.; Settem, R.P.; Sharma, A. Genetic characteristics and pathogenic mechanisms of periodontal pathogens. Adv. Dent. Res. 2014, 26, 15–22. [Google Scholar] [CrossRef] [PubMed]
- Courts, F.J.; Boackle, R.J.; Fudenberg, H.H.; Silverman, M.S. Detection of functional complement components in gingival crevicular fluid from humans with periodontal diseases. J. Dent. Res. 1977, 56, 327–331. [Google Scholar] [CrossRef] [PubMed]
- Komatsuzawa, H.; Asakawa, R.; Kawai, T.; Ochiai, K.; Fujiwara, T.; Taubman, M.A.; Ohara, M.; Kurihara, H.; Sugai, M. Identification of six major outer membrane proteins from Actinobacillus actinomycetemcomitans. Gene 2002, 288, 195–201. [Google Scholar] [CrossRef] [PubMed]
- May, A.C.; Ehrlich, R.L.; Balashov, S.; Ehrlich, G.D.; Shanmugam, M.; Fine, D.H.; Ramasubbu, N.; Mell, J.C.; Cugini, C. Complete Genome Sequence of Aggregatibacter actinomycetemcomitans Strain IDH781. Genome Announc. 2016, 4, e01285-16. [Google Scholar] [CrossRef]
- Juarez-Rodriguez, M.D.; Torres-Escobar, A.; Demuth, D.R. Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans. Plasmid 2013, 69, 211–222. [Google Scholar] [CrossRef]
- Velusamy, S.K.; Sampathkumar, V.; Godboley, D.; Fine, D.H. Profound Effects of Aggregatibacter actinomycetemcomitans Leukotoxin Mutation on Adherence Properties Are Clarified in in vitro Experiments. PLoS ONE 2016, 11, e0151361. [Google Scholar] [CrossRef]
- Shanmugam, M.; El Abbar, F.; Ramasubbu, N. Transcriptome Profiling of Wild-Type and pga-Knockout Mutant Strains Reveal the Role of Exopolysaccharide in Aggregatibacter actinomycetemcomitans. PLoS ONE 2015, 10, e0134285. [Google Scholar] [CrossRef]
- Belibasakis, G.N.; Maula, T.; Bao, K.; Lindholm, M.; Bostanci, N.; Oscarsson, J.; Ihalin, R.; Johansson, A. Virulence and Pathogenicity of Aggregatibacter actinomycetemcomitans. Pathogens 2019, 8, 222. [Google Scholar] [CrossRef]
- Fives-Taylor, P.M.; Meyer, D.H.; Mintz, K.P.; Brissette, C. Virulence factors of Actinobacillus actinomycetemcomitans. Periodontol. 2000 1999, 20, 136–167. [Google Scholar] [CrossRef]
- Fine, D.H.; Kaplan, J.B.; Kachlany, S.C.; Schreiner, H.C. How we got attached to Actinobacillus actinomycetemcomitans: A model for infectious diseases. Periodontol. 2000 2006, 42, 114–157. [Google Scholar] [CrossRef] [PubMed]
- Rose, J.E.; Meyer, D.H.; Fives-Taylor, P.M. Aae, an autotransporter involved in adhesion of Actinobaciillus actinomyctemcomitans to epithelial cells. Infect. Immun. 2003, 71, 2384–2393. [Google Scholar] [CrossRef] [PubMed]
- Casadevall, A.; Pirofski, L.A. Host-pathogen interactions: Redefining the basic concepts of virulence and pathogenicity. Infect. Immun. 1999, 67, 3703–3713. [Google Scholar] [CrossRef] [PubMed]
- Casadevall, A.; Pirofski, L.A. Microbiology: Ditch the term pathogen. Nature 2014, 516, 165–166. [Google Scholar] [CrossRef]
- Shenker, B.J.; Walker, L.P.; Zekavat, A.; Korostoff, J.; Boesze-Battaglia, K. Aggregatibacter actinomycetemcomitans Cytolethal Distending Toxin-Induces Cell Cycle Arrest in a Glycogen Synthase Kinase (GSK)-3-Dependent Manner in Oral Keratinocytes. Int. J. Mol. Sci. 2022, 23, 11831. [Google Scholar] [CrossRef]
- Lally, E.T.; Golub, E.E.; Kieba, I.R.; Taichman, N.S.; Rosenblum, J.; Rosenblum, J.C.; Gibson, C.W.; Demuth, D.R. Analysis of the Actinobacillus actinomycetemcomitans leukotoxin gene. J. Biol. Chem. 1989, 264, 15451–15456. [Google Scholar] [CrossRef]
- Kachlany, S.C. Aggregatibacter actinomycetemcomitans leukotoxin from threat to therapy. J. Dent. Res. 2010, 89, 561–570. [Google Scholar] [CrossRef]
- Hajishengallis, G.; Lamont, R.J. Beyond the red complex and into more complexity: The polymicrobial synergy and dysbiosis (PSD) model of periodontal disease etiology. Mol. Oral. Microbiol. 2012, 27, 409–419. [Google Scholar] [CrossRef]
- Hallstrom, T.; Zipfel, P.F.; Blom, A.M.; Lauer, N.; Forsgren, A.; Riesbeck, K. Haemophilus influenzae interacts with the human complement inhibitor factor H. J. Immunol. 2008, 181, 537–545. [Google Scholar] [CrossRef]
- Taylor, P.W. Bactericidal and bacteriolytic activity of serum against gram-negative bacteria. Microbiol. Rev. 1983, 47, 46–83. [Google Scholar] [CrossRef]
- Meri, T.; Amdahl, H.; Lehtinen, M.J.; Hyvarinen, S.; McDowell, J.V.; Bhattacharjee, A.; Meri, S.; Marconi, R.; Goldman, A.; Jokiranta, T.S. Microbes bind complement inhibitor factor H via a common site. PLoS Pathog. 2013, 9, e1003308. [Google Scholar] [CrossRef]
- Galindo, C.L.; Rosenzweig, J.A.; Kirtley, M.L.; Chopra, A.K. Pathogenesis of Y. enterocolitica and Y. pseudotuberculosis in Human Yersiniosis. J. Pathog. 2011, 2011, 182051. [Google Scholar] [CrossRef] [PubMed]
- McNeil, L.K.; Zagursky, R.J.; Lin, S.L.; Murphy, E.; Zlotnick, G.W.; Hoiseth, S.K.; Jansen, K.U.; Anderson, A.S. Role of factor H binding protein in Neisseria meningitidis virulence and its potential as a vaccine candidate to broadly protect against meningococcal disease. Microbiol. Mol. Biol. Rev. 2013, 77, 234–252. [Google Scholar] [CrossRef] [PubMed]
- McDowell, J.V.; Lankford, J.; Stamm, L.; Sadlon, T.; Gordon, D.L.; Marconi, R.T. Demonstration of factor H-like protein 1 binding to Treponema denticola, a pathogen associated with periodontal disease in humans. Infect. Immun. 2005, 73, 7126–7132. [Google Scholar] [CrossRef] [PubMed]
- Haubek, D.; Ennibi, O.K.; Poulsen, K.; Vaeth, M.; Poulsen, S.; Kilian, M. Risk of aggressive periodontitis in adolescent carriers of the JP2 clone of Aggregatibacter (Actinobacillus) actinomycetemcomitans in Morocco: A prospective longitudinal cohort study. Lancet 2008, 371, 237–242. [Google Scholar] [CrossRef] [PubMed]
- Haubek, D.; Poulsen, K.; Kilian, M. Microevolution and patterns of dissemination of the JP2 clone of Aggregatibacter (Actinobacillus) actinomycetemcomitans. Infect. Immun. 2007, 75, 3080–3088. [Google Scholar] [CrossRef]
- Schindler, M.K.; Schutz, M.S.; Muhlenkamp, M.C.; Rooijakkers, S.H.; Hallstrom, T.; Zipfel, P.F.; Autenrieth, I.B. Yersinia enterocolitica YadA mediates complement evasion by recruitment and inactivation of C3 products. J. Immunol. 2012, 189, 4900–4908. [Google Scholar] [CrossRef]






| E. coli Strains | Relevant Characteristics | Reference or Source |
|---|---|---|
| NEB5α | fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 | New England Biolabs |
| Mach1-T1R | F- φ80(lacZ)∆M15 ∆lacX74 hsdR(rK-mK+) ∆recA1398 endA1 tonA | Invitrogen |
| Stellar | F–, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔ M15, Δ(lacZYA-argF) U169, Δ(mrr-hsdRMS-mcrBC), ΔmcrA, λ– | Clontech |
| BL21(DE3) | fhuA2 [lon] ompT gal (λ DE3) [dcm] ∆hsdS λ DE3 = λ sBamHIo ∆EcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 ∆nin5 | New England Biolabs |
| SJ100 | BL21(DE3) containing plasmid pET29b (+) | This study |
| A. actinomycetemcomitans strains | Relevant characteristics | Reference or source |
| IDH781 | Wild-type human A. actinomycetemcomitans, serotype d, spectinomycin-resistant | [47] |
| IDH781∆apiA | Gene deletion of apiA in strain IDH781; SJ13 | This study |
| Plasmid | Relevant characteristics | Reference or source |
| pJT1 | Suicide vector, Spectinomycin-resistant | [48] |
| pET29b (+) | Expression vector, T7 promoter, Kanamycin-resistant | Novagen |
| pSJ101 | pET29b+ containing full-length apiA; designated ApiA in text | [35] |
| pSJ102 | pET29b+ containing truncated apiA; amino acids 28–33 deleted; designated ∆28–33 in text | This study |
| pSJ103 | pET29b+ containing truncated apiA; amino acids 34–80 deleted; designated ∆34–80 in text | This study |
| pSJ104 | pET29b+ containing truncated apiA; amino acids 81–100 deleted; designated ∆81–100 in text | This study |
| pSJ105 | pET29b+ containing truncated apiA; amino acids 101–185 deleted; designated ∆101–185 in text | This study |
| pSJ106 | pET29b+ containing truncated apiA; amino acids 186–217 deleted; designated ∆186–217 in text | [35] |
| pSJ107 | pET29b+ containing truncated apiA; amino acids 81–185 deleted; designated ∆81–185 in text | This study |
| pSJ108 | pET29b+ containing truncated apiA; amino acids 28–185 deleted; designated ∆28–185 in text | This study |
| Oligonucleotides | Sequence (5′→3′) | Source |
|---|---|---|
| Primers to amplify full-length apiA | ||
| ApiA-NdeI-F | GGAATTCCATATGACATATCAATTATTTAA | [35] |
| ApiA-EcoRI-R | CGGAATTCTTACCACTCAAAGTTTAAACCG | [35] |
| Amino acid 28–33 deletion in ApiA to construct pSJ102 | ||
| DNF 2 | GTCGATGCATTGGCTAAAGACTCTGCTAATCTTCCACAACAA | This study |
| DNR 2 | TTGTTGTGGAAGATTAGCAGAGTCTTTAGCCAATGCATCGAC | This study |
| Amino acid 34–80 deletion in ApiA to construct pSJ103 | ||
| 103F 2 | GCTGAAAATCCTGGGGGGATCGATAGATTAGCTAAG | This study |
| 103R 2 | CTTTGCATTTCTATCGATCCCCCCAGGATTTTCAGC | This study |
| Amino acid 81–185 deletion in ApiA to construct pSJ107 | ||
| DNF 3 | GTATAGAAAAAGATGTTATGCGTAACACTTTTAGATCTTCAAGC | This study |
| DNR 3 | GCTTGAAGATCTAAAAGTGTTACGCATAACATCTTTTTCTATAC | This study |
| Amino acid 81–100 deletion in ApiA to construct pSJ104 | ||
| DNF 4 | GTATAGAAAAAGATGTTATGCGTAACACTGAGTTAGATATTCAG | This study |
| DNR 4 | CTGAATATCTAACTCAGTGTTACGCATAACATCTTTTTCTATAC | This study |
| Amino acid 101–185 deletion in ApiA to construct pSJ105 | ||
| DNF 5 | GATTACTAAAAATTTTAGATCTTCAAGCCAAAACATCGCG | This study |
| DNR 5 | CGCGATGTTTTGGCTTGAAGATCTAAAATTTTTAGTAATC | This study |
| pSJ13 sequence confirmation primers | ||
| pJT1 F | CCT TGC CTA GGG CTA GCA TC | This study |
| pJT1 R | GGC TGC AGT AAC GAA TAC TAG | This study |
| apiA gene deletion primers | ||
| UF NotI | GGGCCCAATTAATGGCCGGTTTGAAATGCACGGTGG | This study |
| DR XhoI | TACTAGTTCGAATAACAGGCGCAG GAATCCGCC | This study |
| DF | TTAAGGATGAATTTTCACTTAAAGTGCGGTC | This study |
| UR | GACCGCACTTTAAGTGAAAATTCATCCTTAA | This study |
| apiA gene deletion screening primers | ||
| apiA^ F | GATATAGCCAGGTGTCTTCGGTGTCG | This study |
| apiA^ R | GAATCTTGACCGCGGTGAAGGCATTC | This study |
| qPCR primers | ||
| pgaCF | GACGGTGATGCGGTATTGG | This study |
| pgaCR | GACCGATGATGGAGCTGAA | This study |
| apiAqF | GCCGAGTCAATGAATTAGACAAAG | This study |
| apiAqR | CAACAGCTGCACTCAAGTTAAGG | This study |
| rcpAF | TGGGCATTAACTGGAGCCAC | This study |
| rcpAR | ATCCACCTCCGAAACCGAAG | This study |
| ompA1F | GAGATGGCTTGTTGAGAAAC | This study |
| ompA1R | AGGTTATACAGACCGTATCG | This study |
| ompA2 F | CAATATCCGGAGAATAGCGA | This study |
| ompA2 R | GGCATTACGTTTGGAGTATC | This study |
| oxyR F | CTGTAAGGTCGGTACGATATG | This study |
| oxyR R | GCAACCAAGGCAAAGATATG | This study |
| katA F | GTTCAGCGATCGTGGTATTC | This study |
| katA R | CGTTGTCGGCATTGATAAAG | This study |
| 5SrRNAF | GCGGGGATCCTGGCGGTGACCTACT | This study |
| 5SrRNAR | GCGATCTAGACCACCTGAAACCATACC | This study |
| ApiA Construct | 0 Min | 35 Min | 45 Min | 60 Min |
|---|---|---|---|---|
| pET29b+ | 0.82 ± 04 | 0.91 ± 03 | 0.82 ± 04 | 0.83 ± 05 |
| ApiA WT | 0.39 ± 05 | 0.32 ± 03 | 0.32 ± 0.1 | 0.11 ± 12 |
| ∆28–33 | 0.62 ± 08 | 0.67 ± 14 | 0.62 ± 0.1 | 0.52 ± 28 |
| ∆34–80 | 0.62 ± 06 | 0.60 ± 04 | 0.52 ± 06 | 0.51 ± 03 |
| ∆81–100 | 0.45 ± 06 | 0.14 ± 07 | 0.16 ± 11 | 0.19 ± 0.1 |
| ∆101–185 | 0.56 ± 02 | 0.55 ± 06 | 0.61 ± 09 | 0.59 ± 26 |
| ∆186–217 | 0.30+0.23 | 0.13 ± 08 | 0.15 ± 07 | 0.17 ± 05 |
| ∆81–185 | 0.58 ± 08 | 0.43 ± 36 | 0.53 ± 24 | 0.47 ± 18 |
| ∆28–185 | 0.49 ± 07 | 0.50 ± 09 | 0.58 ± 04 | 0.50 ± 09 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jacob, S.; Gusmao, L.; Godboley, D.; Velusamy, S.K.; George, N.; Schreiner, H.; Cugini, C.; Fine, D.H. Molecular Analysis of Aggregatibacter actinomycetemcomitans ApiA, a Multi-Functional Protein. Pathogens 2024, 13, 1011. https://doi.org/10.3390/pathogens13111011
Jacob S, Gusmao L, Godboley D, Velusamy SK, George N, Schreiner H, Cugini C, Fine DH. Molecular Analysis of Aggregatibacter actinomycetemcomitans ApiA, a Multi-Functional Protein. Pathogens. 2024; 13(11):1011. https://doi.org/10.3390/pathogens13111011
Chicago/Turabian StyleJacob, Sera, Luciana Gusmao, Dipti Godboley, Senthil Kumar Velusamy, Nisha George, Helen Schreiner, Carla Cugini, and Daniel H. Fine. 2024. "Molecular Analysis of Aggregatibacter actinomycetemcomitans ApiA, a Multi-Functional Protein" Pathogens 13, no. 11: 1011. https://doi.org/10.3390/pathogens13111011
APA StyleJacob, S., Gusmao, L., Godboley, D., Velusamy, S. K., George, N., Schreiner, H., Cugini, C., & Fine, D. H. (2024). Molecular Analysis of Aggregatibacter actinomycetemcomitans ApiA, a Multi-Functional Protein. Pathogens, 13(11), 1011. https://doi.org/10.3390/pathogens13111011

