Differential TLR-ERK1/2 Activity Promotes Viral ssRNA and dsRNA Mimic-Induced Dysregulated Immunity in Macrophages
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. Viral ssRNA and dsRNA Mimics Induce Differential Inflammatory and Antiviral Responses
3.2. Macrophages Express Differential Levels of Cell-Surface and Endosomal TLR3 and TLR7
3.3. R848 and Poly I:C Induce Differential MAPK and NF-kB Activation in Macrophages
3.4. Blocking ERK1/2 Reduces Inflammation and Improves IFN in Viral RNA Mimic-Treated Cells
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abdelwhab, E.M.; Mettenleiter, T.C. Zoonotic Animal Influenza Virus and Potential Mixing Vessel Hosts. Viruses 2023, 15, 980. [Google Scholar] [CrossRef] [PubMed]
- Woolhouse, M.E.J.; Gowtage-Sequeria, S. Host Range and Emerging and Reemerging Pathogens. Emerg. Infect. Dis. 2005, 11, 1842–1847. [Google Scholar] [CrossRef] [PubMed]
- Taylor, L.H.; Latham, S.M.; Woolhouse, M.E. Risk factors for human disease emergence. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2001, 356, 983–989. [Google Scholar] [CrossRef]
- Ge, X.-Y.; Li, J.-L.; Yang, X.-L.; Chmura, A.A.; Zhu, G.; Epstein, J.H.; Mazet, J.K.; Hu, B.; Zhang, W.; Peng, C.; et al. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature 2013, 503, 535–538. [Google Scholar] [CrossRef]
- Daep, C.A.; Muñoz-Jordán, J.L.; Eugenin, E.A. Flaviviruses, an expanding threat in public health: Focus on Dengue, West Nile, and Japanese encephalitis virus. J. Neurovirol. 2014, 20, 539–560. [Google Scholar] [CrossRef]
- Martina, B.E.; Osterhaus, A.D. “Filoviruses”: A real pandemic threat? EMBO Mol. Med. 2009, 1, 10–18. [Google Scholar] [CrossRef]
- Li, W.; Shi, Z.; Yu, M.; Ren, W.; Smith, C.; Epstein, J.H.; Wang, H.; Crameri, G.; Hu, Z.; Zhang, H.; et al. Bats Are Natural Reservoirs of SARS-Like Coronaviruses. Science 2005, 310, 676–679. [Google Scholar] [CrossRef]
- Lau, S.K.P.; Woo, P.C.Y.; Li, K.S.M.; Huang, Y.; Tsoi, H.-W.; Wong, B.H.L.; Wong, S.S.Y.; Leung, S.-Y.; Chan, K.-H.; Yuen, K.-Y. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc. Natl. Acad. Sci. USA 2005, 102, 14040–14045. [Google Scholar] [CrossRef]
- Wang, L.F.; Eaton, B.T. Bats, Civets and the Emergence of SARS. In Wildlife and Emerging Zoonotic Diseases: The Biology, Circumstances and Consequences of Cross-Species Transmission; Childs, J.E., Mackenzie, J.S., Richt, J.A., Eds.; Springer: Berlin/Heidelberg, Germany, 2007; pp. 325–344. [Google Scholar] [CrossRef]
- Plowright, R.K.; Eby, P.; Hudson, P.J.; Smith, I.L.; Westcott, D.; Bryden, W.L.; Middleton, D.; Reid, P.A.; McFarlane, R.A.; Martin, G.; et al. Ecological dynamics of emerging bat virus spillover. Proc. R. Soc. B: Biol. Sci. 2015, 282, 20142124. [Google Scholar] [CrossRef]
- Nelemans, T.; Kikkert, M. Viral Innate Immune Evasion and the Pathogenesis of Emerging RNA Virus Infections. Viruses 2019, 11, 961. [Google Scholar] [CrossRef]
- Channappanavar, R.; Fehr, A.R.; Vijay, R.; Mack, M.; Zhao, J.; Meyerholz, D.K.; Perlman, S. Dysregulated type I interferon and inflammatory monocyte-macrophage responses cause lethal pneumonia in SARS-CoV-infected mice. Cell Host Microbe 2016, 19, 181–193. [Google Scholar] [CrossRef] [PubMed]
- Peiris, J.; Hui, K.P.; Yen, H.L. Host response to influenza virus: Protection versus immunopathology. Curr. Opin. Immunol. 2010, 22, 475–481. [Google Scholar] [CrossRef] [PubMed]
- Blanco-Melo, D.; Nilsson-Payant, B.E.; Liu, W.-C.; Uhl, S.; Hoagland, D.; Møller, R.; Jordan, T.X.; Oishi, K.; Panis, M.; Sachs, D. Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell 2020, 181, 1036–1045.e9. [Google Scholar] [CrossRef] [PubMed]
- Werling, D.; Jungi, T.W. TOLL-like receptors linking innate and adaptive immune response. Vet. Immunol. Immunopathol. 2003, 91, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Saito, T.; Gale, M. Principles of intracellular viral recognition. Curr. Opin. Immunol. 2007, 19, 17–23. [Google Scholar] [CrossRef]
- Zhong, B.; Tien, P.; Shu, H.B. Innate immune responses: Crosstalk of signaling and regulation of gene transcription. Virology 2006, 352, 14–21. [Google Scholar] [CrossRef]
- Meylan, E.; Tschopp, J. Toll-Like Receptors and RNA Helicases: Two Parallel Ways to Trigger Antiviral Responses. Mol. Cell. 2006, 22, 561–569. [Google Scholar] [CrossRef]
- Majde, J.A.; Guha-Thakurta, N.; Chen, Z.; Bredow, S.; Krueger, J.M. Spontaneous release of stable viral double-stranded RNA into the extracellular medium by influenza virus-infected MDCK epithelial cells: Implications for the viral acute phase response. Arch. Virol. 1998, 143, 2371–2380. [Google Scholar] [CrossRef]
- Deng, X.; Hackbart, M.; Mettelman, R.C.; O’Brien, A.; Mielech, A.M.; Yi, G.; Kao, C.C.; Baker, S.C. Coronavirus nonstructural protein 15 mediates evasion of dsRNA sensors and limits apoptosis in macrophages. Proc. Natl. Acad. Sci. USA 2017, 114, E4251–E4260. [Google Scholar] [CrossRef]
- Genoyer, E.; Wilson, J.; Ames, J.M.; Stokes, C.; Moreno, D.; Etzyon, N.; Oberst, A.; Gale, M. Exposure of negative-sense viral RNA in the cytoplasm initiates innate immunity to West Nile virus. bioRxiv 2024. [Google Scholar] [CrossRef]
- Kato, H.; Sato, S.; Yoneyama, M.; Yamamoto, M.; Uematsu, S.; Matsui, K.; Tsujimura, T.; Takeda, K.; Fujita, T.; Takeuchi, O.; et al. Cell Type-Specific Involvement of RIG-I in Antiviral Response. Immunity 2005, 23, 19–28. [Google Scholar] [CrossRef] [PubMed]
- Andrejeva, J.; Childs, K.S.; Young, D.F.; Carlos, T.S.; Stock, N.; Goodbourn, S.; Randall, R.E. The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-β promoter. Proc. Natl. Acad. Sci. USA 2004, 101, 17264–17269. [Google Scholar] [CrossRef] [PubMed]
- Yoneyama, M.; Kikuchi, M.; Natsukawa, T.; Shinobu, N.; Imaizumi, T.; Miyagishi, M.; Taira, K.; Akira, S.; Fujita, T. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 2004, 5, 730–737. [Google Scholar] [CrossRef] [PubMed]
- Kanno, A.; Tanimura, N.; Ishizaki, M.; Ohko, K.; Motoi, Y.; Onji, M.; Fukui, R.; Shimozato, T.; Yamamoto, K.; Shibata, T.; et al. Targeting cell surface TLR7 for therapeutic intervention in autoimmune diseases. Nat. Commun. 2015, 6, 6119. [Google Scholar] [CrossRef]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen Recognition and Innate Immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef]
- Diebold, S.S.; Kaisho, T.; Hemmi, H.; Akira, S.; Reis e Sousa, C. Innate Antiviral Responses by Means of TLR7-Mediated Recognition of Single-Stranded RNA. Science 2004, 303, 1529–1531. [Google Scholar] [CrossRef]
- Lund, J.M.; Alexopoulou, L.; Sato, A.; Karow, M.; Adams, N.C.; Gale, N.W.; Iwasaki, A.; Flavell, R.A. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc. Natl. Acad. Sci. USA 2004, 101, 5598–5603. [Google Scholar] [CrossRef]
- Yamamoto, M.; Sato, S.; Mori, K.; Hoshino, K.; Takeuchi, O.; Takeda, K.; Akira, S. Cutting Edge: A Novel Toll/IL-1 Receptor Domain-Containing Adapter That Preferentially Activates the IFN-β Promoter in the Toll-Like Receptor Signaling1. J. Immunol. 2002, 169, 6668–6672. [Google Scholar] [CrossRef]
- Martin, M.U.; Kollewe, C. Interleukin-1 receptor-associated kinase-1 (IRAK-1): A self-regulatory adapter molecule in the signaling cascade of the Toll/IL-1 receptor family. Signal Transduct. 2001, 1, 37–50. [Google Scholar] [CrossRef]
- Morrison, D.K. MAP Kinase Pathways. Cold Spring Harb. Perspect. Biol. 2012, 4, a011254. [Google Scholar] [CrossRef]
- Reimann, T.; Büscher, D.; Hipskind, R.A.; Krautwald, S.; Lohmann-Matthes, M.L.; Baccarini, M. Lipopolysaccharide induces activation of the Raf-1/MAP kinase pathway. A putative role for Raf-1 in the induction of the IL-1 beta and the TNF-alpha genes. J. Immunol. 1994, 153, 5740–5749. [Google Scholar] [CrossRef] [PubMed]
- Hall, A.J.; Vos, H.L.; Bertina, R.M. Lipopolysaccharide Induction of Tissue Factor in THP-1 Cells Involves Jun Protein Phosphorylation and Nuclear Factor κB Nuclear Translocation. J. Biol. Chem. 1999, 274, 376–383. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, M.; Sato, S.; Hemmi, H.; Hoshino, K.; Kaisho, T.; Sanjo, H.; Takeuchi, O.; Sugiyama, M.; Okabe, M.; Takeda, K.; et al. Role of Adaptor TRIF in the MyD88-Independent Toll-Like Receptor Signaling Pathway. Science 2003, 301, 640–643. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Marshall, J.A.; Bowden, D.S. Characterization of Rubella Virus Replication Complexes Using Antibodies to Double-Stranded RNA. Virology 1994, 200, 307–312. [Google Scholar] [CrossRef]
- Stollar, B.D.; Stollar, V. Immunofluorescent demonstration of double-stranded RNA in the cytoplasm of sindbis virus-infected cells. Virology 1970, 42, 276–280. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. Innate immune recognition of viral infection. Nat. Immunol. 2006, 7, 131–137. [Google Scholar] [CrossRef]
- Gantier, M.P.; Williams, B.R.G. The response of mammalian cells to double-stranded RNA. Cytokine Growth Factor Rev. 2007, 18, 363–371. [Google Scholar] [CrossRef]
- Griffin, D.E. Why does viral RNA sometimes persist after recovery from acute infections? PLoS Biol. 2022, 20, e3001687. [Google Scholar] [CrossRef]
- Sow, M.S.; Etard, J.-F.; Baize, S.; Magassouba, N.; Faye, O.; Msellati, P.; Touré, A., II; Savane, I.; Barry, M.; Delaporte, E.; et al. New Evidence of Long-lasting Persistence of Ebola Virus Genetic Material in Semen of Survivors. J. Infect. Dis. 2016, 214, 1475–1476. [Google Scholar] [CrossRef]
- Lupi, L.; Vitiello, A.; Parolin, C.; Calistri, A.; Garzino-Demo, A. The Potential Role of Viral Persistence in the Post-Acute Sequelae of SARS-CoV-2 Infection (PASC). Pathogens 2024, 13, 388. [Google Scholar] [CrossRef]
- Chen, B.; Julg, B.; Mohandas, S.; Bradfute, S.B.; Force, R.M.P.T. Viral persistence, reactivation, and mechanisms of long COVID. eLife 2023, 12, e86015. [Google Scholar] [CrossRef] [PubMed]
- Zuo, W.; He, D.; Liang, C.; Du, S.; Hua, Z.; Nie, Q.; Zhou, X.; Yang, M.; Tan, H.; Xu, J.; et al. The persistence of SARS-CoV-2 in tissues and its association with long COVID symptoms: A cross-sectional cohort study in China. Lancet Infect. Dis. 2024, 24, 845–855. [Google Scholar] [CrossRef] [PubMed]
- Kumar, R.; Khandelwal, N.; Thachamvally, R.; Tripathi, B.N.; Barua, S.; Kashyap, S.K.; Maherchandani, S.; Kumar, N. Role of MAPK/MNK1 signaling in virus replication. Virus Res. 2018, 253, 48–61. [Google Scholar] [CrossRef] [PubMed]
- Parisien, J.-P.; Lau, J.F.; Rodriguez, J.J.; Sullivan, B.M.; Moscona, A.; Parks, G.D.; Lamb, R.A.; Horvath, C.M. The V Protein of Human Parainfluenza Virus 2 Antagonizes Type I Interferon Responses by Destabilizing Signal Transducer and Activator of Transcription 2. Virology 2001, 283, 230–239. [Google Scholar] [CrossRef] [PubMed]
- Basler, C.F.; Mikulasova, A.; Martinez-Sobrido, L.; Paragas, J.; Mühlberger, E.; Bray, M.; Klenk, H.-D.; Palese, P.; García-Sastre, A. The Ebola Virus VP35 Protein Inhibits Activation of Interferon Regulatory Factor 3. J. Virol. 2003, 77, 7945–7956. [Google Scholar] [CrossRef]
- Liu, Q.; Zhou, Y.H.; Yang, Z.Q. The cytokine storm of severe influenza development of immunomodulatory, therapy. Cell. Mol. Immunol. 2016, 13, 3–10. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, J.; Zhan, Y.; Wu, L.; Yu, X.; Zhang, W.; Ye, L.; Xu, S.; Sun, R.; Wang, Y.; et al. Analysis of Serum Cytokines in Patients with Severe Acute Respiratory Syndrome. Infect. Immunity 2004, 72, 4410–4415. [Google Scholar] [CrossRef]
- Karpus, O.N.; Heutinck, K.M.; Wijnker, P.J.M.; Tak, P.P.; Hamann, J. Triggering of the dsRNA Sensors TLR3, MDA5, and RIG-I Induces CD55 Expression in Synovial Fibroblasts. PLoS ONE 2012, 7, e35606. [Google Scholar] [CrossRef]
- Billack, B. Macrophage Activation: Role of Toll-like Receptors, Nitric Oxide, and Nuclear Factor kappa B. Am. J. Pharm. Educ. 2006, 70, 102. [Google Scholar] [CrossRef]
- West, A.P.; Koblansky, A.A.; Ghosh, S. Recognition and Signaling by Toll-Like Receptors. Annu. Rev. Cell Dev. Biol. 2006, 22, 409–437. [Google Scholar] [CrossRef]
- Alexopoulou, L.; Holt, A.C.; Medzhitov, R.; Flavell, R.A. Recognition of double-stranded RNA and activation of NF-κB by Toll-like receptor 3. Nature 2001, 413, 732–738. [Google Scholar] [CrossRef] [PubMed]
- Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef] [PubMed]
- Sato, S.; Sugiyama, M.; Yamamoto, M.; Watanabe, Y.; Kawai, T.; Takeda, K.; Akira, S. Toll/IL-1 Receptor Domain-Containing Adaptor Inducing IFN-β (TRIF) Associates with TNF Receptor-Associated Factor 6 and TANK-Binding Kinase 1, and Activates Two Distinct Transcription Factors, NF-κB and IFN-Regulatory Factor-3, in the Toll-Like Receptor Signaling 1. J. Immunol. 2003, 171, 4304–4310. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.K. Emerging and re-emerging fatal viral diseases. Exp. Mol. Med. 2021, 53, 711–712. [Google Scholar] [CrossRef] [PubMed]
- Nichol, S.T.; Arikawa, J.; Kawaoka, Y. Emerging viral diseases. Proc. Natl. Acad. Sci. USA 2000, 97, 12411–12412. [Google Scholar] [CrossRef]
- Franks, T.J.; Chong, P.Y.; Chui, P.; Galvin, J.R.; Lourens, R.M.; Reid, A.H.; Selbs, E.; Mcevoy, C.P.L.; Hayden, C.D.L.; Fukuoka, J.; et al. Lung pathology of severe acute respiratory syndrome (SARS): A study of 8 autopsy cases from Singapore. Hum. Pathol. 2003, 34, 743–748. [Google Scholar] [CrossRef]
- Nicholls, J.M.; Poon, L.L.; Lee, K.C.; Ng, W.F.; Lai, S.T.; Leung, C.Y.; Chu, C.M.; Hui, P.K.; Mak, K.L.; Lim, W.; et al. Lung pathology of fatal severe acute respiratory syndrome. Lancet 2003, 361, 1773–1778. [Google Scholar] [CrossRef]
- Wong, C.K.; Lam, C.W.K.; Wu, A.K.L.; Ip, W.K.; Lee, N.L.S.; Chan, I.H.S.; Lit, L.C.W.; Hui, D.S.C.; Chan, M.H.M.; Chung, S.S.C.; et al. Plasma inflammatory cytokines and chemokines in severe acute respiratory syndrome. Clin. Exp. Immunol. 2004, 136, 95–103. [Google Scholar] [CrossRef]
- Ding, Y.; Wang, H.; Shen, H.; Li, Z.; Geng, J.; Han, H.; Cai, J.; Li, X.; Kang, W.; Weng, D.; et al. The clinical pathology of severe acute respiratory syndrome (SARS): A report from China. J. Pathol. 2003, 200, 282–289. [Google Scholar] [CrossRef]
- Beignon, A.-S.; McKenna, K.; Skoberne, M.; Manches, O.; DaSilva, I.; Kavanagh, D.G.; Larsson, M.; Gorelick, R.J.; Lifson, J.D.; Bhardwaj, N. Endocytosis of HIV-1 activates plasmacytoid dendritic cells via Toll-like receptor–viral RNA interactions. J. Clin. Invest 2005, 115, 3265–3275. [Google Scholar] [CrossRef]
- Channappanavar, R.; Perlman, S. Evaluation of Activation and Inflammatory Activity of Myeloid Cells During Pathogenic Human Coronavirus Infection. MERS Coronavirus 2019, 2099, 195–204. [Google Scholar] [CrossRef]
- Doyle, S.E.; Vaidya, S.A.; O’Connell, R.; Dadgostar, H.; Dempsey, P.W.; Wu, T.-T.; Rao, G.; Sun, R.; Haberland, M.E.; Modlin, R.L.; et al. IRF3 Mediates a TLR3/TLR4-Specific Antiviral Gene Program. Immunity 2002, 17, 251–263. [Google Scholar] [CrossRef] [PubMed]
- Oshiumi, H.; Matsumoto, M.; Funami, K.; Akazawa, T.; Seya, T. TICAM-1, an adaptor molecule that participates in Toll-like receptor 3–mediated interferon-β induction. Nat. Immunol. 2003, 4, 161–167. [Google Scholar] [CrossRef] [PubMed]
- Ahlquist, P. Parallels among positive-strand RNA viruses, reverse-transcribing viruses and double-stranded RNA viruses. Nat. Rev. Microbiol. 2006, 4, 371–382. [Google Scholar] [CrossRef]
- Gitlin, L.; Barchet, W.; Gilfillan, S.; Cella, M.; Beutler, B.; Flavell, R.A.; Diamond, M.S.; Colonna, M. Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proc. Natl. Acad. Sci. USA 2006, 103, 8459–8464. [Google Scholar] [CrossRef]
- Kato, H.; Takeuchi, O.; Sato, S.; Yoneyama, M.; Yamamoto, M.; Matsui, K.; Uematsu, S.; Jung, A.; Kawai, T.; Ishii, K.J.; et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 2006, 441, 101–105. [Google Scholar] [CrossRef]
- Flory, E.; Kunz, M.; Scheller, C.; Jassoy, C.; Stauber, R.; Rapp, U.R.; Ludwig, S. Influenza Virus-induced NF-κB-dependent Gene Expression Is Mediated by Overexpression of Viral Proteins and Involves Oxidative Radicals and Activation of IκB Kinase. J. Biol. Chem. 2000, 275, 8307–8314. [Google Scholar] [CrossRef]
- de Magalhães, J.C.; Andrade, A.A.; Silva, P.N.G.; Sousa, L.P.; Ropert, C.; Ferreira, P.C.P.; Kroon, E.G.; Gazzinelli, R.T.; Bonjardim, C.A. A mitogenic signal triggered at an early stage of vaccinia virus infection: Implication of MEK/ERK and protein kinase A in virus multiplication. J. Biol. Chem. 2001, 276, 38353–38360. [Google Scholar] [CrossRef]
- Lomas, D.A.; Lipson, D.A.; Miller, B.E.; Willits, L.; Keene, O.; Barnacle, H.; Barnes, N.C.; Tal-Singer, R. An Oral Inhibitor of p38 MAP Kinase Reduces Plasma Fibrinogen in Patients with Chronic Obstructive Pulmonary Disease. J. Clin. Pharmacol. 2012, 52, 416–424. [Google Scholar] [CrossRef]
- Fisk, M.; Cheriyan, J.; Mohan, D.; Forman, J.; Mäki-Petäjä, K.M.; McEniery, C.M.; Fuld, J.; Rudd, J.H.F.; Hopkinson, N.S.; Lomas, D.A.; et al. The p38 mitogen activated protein kinase inhibitor losmapimod in chronic obstructive pulmonary disease patients with systemic inflammation, stratified by fibrinogen: A randomised double-blind placebo-controlled trial. PLoS ONE 2018, 13, e0194197. [Google Scholar] [CrossRef]
- Davies, J.M.; Carroll, M.L.; Li, H.; Poh, A.M.; Kirkegard, D.; Towers, M.; Upham, J.W. Budesonide and Formoterol Reduce Early Innate Anti-Viral Immune Responses In Vitro. PLoS ONE 2011, 6, e27898. [Google Scholar] [CrossRef]
- Thomas, B.J.; Porritt, R.A.; Hertzog, P.J.; Bardin, P.G.; Tate, M.D. Glucocorticosteroids enhance replication of respiratory viruses: Effect of adjuvant interferon. Sci. Rep. 2014, 4, 7176. [Google Scholar] [CrossRef]
Primer | Forward Sequence | Reverse Sequence |
---|---|---|
GAPDH | 5′ATGACTCCACTCACGGCAAAT3′ | 5′GGGTCTCGCTCCTGGAAGAT3′ |
TNF α | 5′GAACTGGCAGAAGAGGCACT3′ | 5′AGGGTCTGGGCCATAGAACT3′ |
IL6 | 5′GAGGATACCACTCCCAACAGACC3′ | 5′AAGTGCATCATCGTTGTTCATACA3′ |
CXCL1 | 5′GCTGGGATTCACCTCAAGAA3′ | 5′TCTCCGTTACTTGGGGACAC3′ |
CCL2 | 5′CTTCTGGGCCTGCTGTTCA3′ | 5′CCAGCCTACTCATTGGGATCA3′ |
IFN-B | 5′TCAGAATGAGTGGTGGTTGC3′ | 5′GACCTTTCAAATGCAGTAGATTCA3′ |
ISG-15 | 5′GGCCACAGCAACATCTATGA3′ | 5′CGCAAATGCTTGATCACTGT3′ |
CXCL10 | 5′GCCGTCATTTTCTGCCTCAT3′ | 5′GCTTCCCTATGGCCCTCATT3′ |
OAS1 | 5′ATTACCTCCTTCCCGACACC3′ | 5′CAAACTCCACCTCCTGATGC3′ |
IFITM3 | 5′GCCCCCAACTACGAAAGA3′ | 5′ATTGAACAGGGACCAGACCAC3′ |
TLR3 | 5′GTCTTCTGCACGAACCTGACAG3′ | 5′TGGAGGTTCTCCAGTTGGACCC3′ |
TLR7 | 5′GTGATGCTGTGTGGTTTGTCTGG3′ | 5′CCTTTGTGTGCTCCTGGACCTA3’ |
Antibody | Detection | Source and Catalog Number |
---|---|---|
PECy7 anti-mouse CD45 | CD45 | Biolegend cat#103114/clone 30-F11 |
Pacific Blue™ anti-mouse/human CD11b | CD11b | Biolegend cat#101224/clone M1/70 |
APC anti-mouse F4/80 | F4/80 | Biolegend cat#123116/clone BM8 |
PE anti-mouse CD283 (TLR3) | TLR3 | Biolegend cat#141904/clone 11F8 |
BD Pharminogen™ PE Mouse Anti-Mouse TLR7 (CD287) | TLR7 | BD Biosciences cat#565557/clone A94B10 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shrestha, R.; Johnson, P.M.; Ghimire, R.; Whitley, C.J.; Channappanavar, R. Differential TLR-ERK1/2 Activity Promotes Viral ssRNA and dsRNA Mimic-Induced Dysregulated Immunity in Macrophages. Pathogens 2024, 13, 1033. https://doi.org/10.3390/pathogens13121033
Shrestha R, Johnson PM, Ghimire R, Whitley CJ, Channappanavar R. Differential TLR-ERK1/2 Activity Promotes Viral ssRNA and dsRNA Mimic-Induced Dysregulated Immunity in Macrophages. Pathogens. 2024; 13(12):1033. https://doi.org/10.3390/pathogens13121033
Chicago/Turabian StyleShrestha, Rakshya, Paige Marie Johnson, Roshan Ghimire, Cody John Whitley, and Rudragouda Channappanavar. 2024. "Differential TLR-ERK1/2 Activity Promotes Viral ssRNA and dsRNA Mimic-Induced Dysregulated Immunity in Macrophages" Pathogens 13, no. 12: 1033. https://doi.org/10.3390/pathogens13121033
APA StyleShrestha, R., Johnson, P. M., Ghimire, R., Whitley, C. J., & Channappanavar, R. (2024). Differential TLR-ERK1/2 Activity Promotes Viral ssRNA and dsRNA Mimic-Induced Dysregulated Immunity in Macrophages. Pathogens, 13(12), 1033. https://doi.org/10.3390/pathogens13121033