Brucella Species Circulating in Smallholder Dairy Cattle in Tanzania
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area and Design
2.2. Study Population
2.3. Blood and Swab Sampling from Dairy Cattle and Samples Storage
2.4. DNA Extraction from EDTA Blood and PBS Swabs
2.5. Real-Time PCR for Brucella Genus Detection and Species Characterization
2.6. Spatial Analysis
2.7. Data Analysis for Calculation of Molecular Prevalence
3. Results
3.1. Description of Sampled Dairy Cattle
3.2. Brucellosis Molecular Prevalence of Dairy Cattle in Selected Regions of Tanzania
3.3. Brucella Species Circulating in Dairy Cattle Population Identified from Brucella Genus-Positive Swab and Blood Samples
3.4. Brucellosis Hotspot Areas
3.5. Spatial Clustering of Brucella PCR-Positive Animals
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Schelling, E.E.; Diguimbaye, C.; Daoud, S.; Nicolet, J.; Boerlin, P.; Tanner, M.; Zinsstag, J. Brucellosis and Q-fever seroprevalences of nomadic pastoralists and their livestock in Chad. Prev. Vet. Med. 2003, 61, 279–293. [Google Scholar] [CrossRef] [PubMed]
- World Organization for Animal Health (WOAH). Brucellosis. In Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, 12th ed.; World Organization for Animal Health: Paris, France, 2023; Chapter 3.1.4; pp. 1–35. [Google Scholar]
- Pappas, G. The changing Brucella ecology: Novel reservoirs, new threats. Int. J. Antimicrob. Agents 2010, 36, S8–S11. [Google Scholar] [CrossRef] [PubMed]
- Corbel, M.J. Brucellosis in Humans and Animals; World Health Organization (WHO): Geneva, Switzerland; Food and Agriculture Organization (FAO): Rome, Italy; World Organization for Animal Health (OIE): Paris, France, 2006. [Google Scholar]
- Akoko, J.M.; Pelle, R.; Lukambagire, A.S.; Machuka, E.M.; Nthiwa, D.; Mathew, C.; Fèvre, E.M.; Bett, B.; Cook, E.A.J.; Othero, D.; et al. Molecular epidemiology of Brucella species in mixed livestock-human ecosystems in Kenya. Sci. Rep. 2021, 11, 2045–2322. [Google Scholar] [CrossRef] [PubMed]
- Ntivuguruzwa, J.B.; Babaman, K.F.; Mwikarago, E.I.; van Heerden, H. Seroprevalence of brucellosis and molecular characterization of Brucella spp. from slaughtered cattle in Rwanda. PLoS ONE 2022, 17, e0261595. [Google Scholar] [CrossRef] [PubMed]
- ElTahir, Y.; Al-Farsi, A.; Al-Marzooqi, W.; Al-Toobi, A.; Gaafar, O.M.; Jay, M.; Corde, Y.; Bose, S.; Al-Hamrashdi, A.; Al-Kharousi, K. Investigation on Brucella infection in farm animals in Saham, Sultanate of Oman with reference to human brucellosis outbreak. BMC Vet. Res. 2019, 15, 378. [Google Scholar] [CrossRef]
- Muendo, E.N.; Mbatha, P.M.; Macharia, J.; Abdoel, T.H.; Janszen, P.V.; Pastoor, R.; Smits, H.L. Infection of cattle in Kenya with Brucella abortus biovar 3 and Brucella melitensis biovar 1 genotypes. Trop. Anim. Health Prod. 2012, 44, 17–20. [Google Scholar] [CrossRef]
- Moriyón, I.; Grilló, M.; Monreal, D.; González, D.; Marín, C.; López-Goñi, I.; Mainar-Jaime, R.; Moreno, E.; Blasco, J. Rough vaccines in animal brucellosis: Structural and genetic basis and present status. Vet. Res. 2004, 35, 1–38. [Google Scholar] [CrossRef]
- Schurig, G.G.; Sriranganathan, N.; Corbel, M.J. Brucellosis vaccines: Past, present and future. Vet. Microbiol. 2002, 90, 479–496. [Google Scholar] [CrossRef]
- Van Straten, M.; Bardenstein, S.; Keningswald, G.; Banai, M. Brucella abortus S19 vaccine protects dairy cattle against natural infection with Brucella melitensis. Vaccine 2016, 34, 5837–5839. [Google Scholar] [CrossRef]
- Mahlau, E. Further brucellosis surveys in Tanzania. Bulletin of Epizootic Diseases of Africa. Bull. Epizoot. Dis. Afr. 1967, 15, 373–378. [Google Scholar]
- Mathew, C.; Stokstad, M.; Johansen, T.B.; Klevar, S.; Mdegela, R.H.; Mwamengele, G.; Michel, P.; Escobar, L.; Fretin, D.; Godfroid, J. First isolation, identification, phenotypic and genotypic characterization of Brucella abortus biovar 3 from dairy cattle in Tanzania. BMC Vet. Res. 2015, 11, 156. [Google Scholar] [CrossRef] [PubMed]
- Assenga, J.A.; Matemba, L.E.; Muller, S.K.; Malakalinga, J.J.; Kazwala, R.R. Epidemiology of Brucella infection in the human, livestock and wildlife interface in the Katavi-Rukwa ecosystem, Tanzania. BMC Vet. Res. 2015, 11, 189. [Google Scholar] [CrossRef] [PubMed]
- Ducrotoy, M.; Bertu, W.J.; Matope, G.; Cadmus, S.; Conde-Álvarez, R.; Gusi, A.M.; Welburn, S.; Ocholi, R.; Blasco, J.M.; Moriyón, I. Brucellosis in Sub-Saharan Africa: Current challenges for management, diagnosis and control. Acta Trop. 2017, 165, 179–193. [Google Scholar] [CrossRef] [PubMed]
- Mengele, I.J.; Shirima, G.M.; Bwatota, S.F.; Motto, S.K.; Bronsvoort, B.M.C.; Komwihangilo, D.M.; Lyatuu, E.; Cook, E.A.J.; Hernandez-Castro, L.E. The status and risk factors of brucellosis in smallholder dairy cattle in selected regions of Tanzania. Vet. Sci. 2023, 10, 155. [Google Scholar] [CrossRef]
- Makita, K.; Fèvre, E.; Waiswa, C.; Eisler, M.; Thrusfield, M.; Welburn, S. Herd prevalence of bovine brucellosis and analysis of risk factors in cattle in urban and peri-urban areas of the Kampala economic zone, Uganda. BMC Vet. Res. 2011, 7, 60. [Google Scholar] [CrossRef]
- Khurana, S.K.; Sehrawat, A.; Tiwari, R.; Prasad, M.; Gulati, B.; Shabbir, M.Z.; Chhabra, R.; Karthik, K.; Patel, S.; Pathak, M.; et al. Bovine brucellosis—A comprehensive review. Vet. Q. 2021, 41, 61–88. [Google Scholar] [CrossRef]
- Bodenham, R.F.; Lukambagire, A.S.; Ashford, R.T.; Buza, J.J.; Cash-Goldwasser, S.; Crump, J.A.; Kazwala, R.R.; Maro, V.P.; McGiven, J.; Mkenda, N. Prevalence and speciation of brucellosis in febrile patients from a pastoralist community of Tanzania. Sci. Rep. 2020, 10, 7081. [Google Scholar] [CrossRef]
- Nyawale, H.A.; Simchimba, M.; Mlekwa, J.; Mujuni, F.; Chibwe, E.; Shayo, P.; Mngumi, E.B.; Majid, K.S.; Majigo, M.; Mshana, S.E. High Seropositivity of Brucella melitensis Antibodies among Pregnant Women Attending Health Care Facilities in Mwanza, Tanzania: A Cross-Sectional Study. J. Pregnancy 2023, 2023, 2797441. [Google Scholar] [CrossRef]
- Njombe, A.; Msanga, Y.; Mbwambo, N.; Makembe, N. Dairy Industry Status in Tanzania. Ministry of Livestock Development and Fisheries. In Proceedings of the 7th African Dairy Conference and Exhibition, Dar Es Salaam, Tanzania, 25–27 May 2011; Available online: https://dairyafrica.com/ (accessed on 10 May 2021).
- National Bureau of Statistics (NBS). National Sample Census of Agriculture 2019–2020; National Report; Ministry of Finance and Planning, United Republic of Tanzania: Dodoma, Tanzania, 2021; pp. 1–317. [Google Scholar]
- Ministry of Finance and Planning (MoFP). Tanzania Mainland Household Budget Survey 2017–2018, Key indicators; Report: Poverty Eradication Division, National Bureau of Statistics, United Republic of Tanzania; Poverty Eradication Division, National Bureau of Statistics, United Republic of Tanzania: Dodoma, Tanzania, 2019. [Google Scholar]
- Mrode, R.; Ojango, J.; Ekine-Dzivenu, C.; Aliloo, H.; Gibson, J.; Okeyo, M.A. Genomic prediction of crossbred dairy cattle in Tanzania: A route to productivity gains in smallholder dairy systems. J. Dairy Sci. 2021, 104, 11779–11789. [Google Scholar] [CrossRef]
- Shirima, G.M. The Epidemiology of Brucellosis in Animals and Humans in Arusha and Manyara Regions in Tanzania. Ph.D. Thesis, University of Glasgow, Glasgow, UK, 2005. [Google Scholar]
- Matero, P.; Hemmilä, H.; Tomaso, H.; Piiparinen, H.; Rantakokko-Jalava, K.; Nuotio, L.; Nikkari, S. Rapid field detection assays for Bacillus anthracis, Brucella spp., Francisella tularensis and Yersinia pestis. Clin. Microbiol. Infect. 2011, 17, 34–43. [Google Scholar] [CrossRef]
- Probert, W.S.; Schrader, K.N.; Khuong, N.Y.; Bystrom, S.L.; Graves, M.H. Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J. Clin. Microbiol. 2004, 42, 1290–1293. [Google Scholar] [CrossRef] [PubMed]
- Kulldorff, M. Information Management Services. Software for the Spatial and Space-Time Scan Statistics. SaTScan v10.1.2 64bit. 2023. Available online: https://www.satscan.org/ (accessed on 15 February 2020).
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 17 February 2020).
- Lumley, T. Analysis of complex survey samples. J. Stat. Softw. 2004, 9, 1–19. [Google Scholar] [CrossRef]
- Shirima, G.; Lyimo, B.; Kanuya, N. Re-emergence of Bovine Brucellosis in Smallholder Dairy Farms in Urban Settings of Tanzania. J. Appl. Life Sci. Int. 2018, 17, 1–7. [Google Scholar] [CrossRef]
- Mengele, I.J.; Shirima, G.M.; Bronsvoort, B.M.; Hernandez-Castro, L.E.; Cook, E.A.J. Diagnostic challenges of brucellosis in humans and livestock in Tanzania: A thematic review. CABI One Health 2023, ohcs20230001. [Google Scholar] [CrossRef]
- Aliyev, J.; Alakbarova, M.; Garayusifova, A.; Omarov, A.; Aliyeva, S.; Fretin, D.; Godfroid, J. Identification and molecular characterization of Brucella abortus and Brucella melitensis isolated from milk in cattle in Azerbaijan. BMC Vet. Res. 2022, 18, 71. [Google Scholar] [CrossRef]
- Oliveira, M.S.; Dorneles, E.M.S.; Soares, P.M.F.; Junior, A.A.F.; Orzil, L.; de Souza, P.G.; Lage, A.P. Molecular epidemiology of Brucella abortus isolated from cattle in Brazil, 2009–2013. Acta Trop. 2017, 166, 106–113. [Google Scholar] [CrossRef]
- Akoko, J.M.; Muturi, M.; Wambua, L.; Abkallo, H.M.; Nyamota, R.; Bosire, C.; Oloo, S.; Limbaso, K.S.; Gakuya, F.; Nthiwa, D.; et al. Mapping brucellosis risk in Kenya and its implications for control strategies in sub-Saharan Africa. Sci. Rep. 2023, 13, 20192. [Google Scholar] [CrossRef]
- Mitterran, K.N.R.; Barberine, S.A.; Oumarou, F.; Simo, G. Detection of Brucella abortus and Brucellla melitensis in cattle and sheep from southern Cameroon. Res. Sq. 2020, 2, 1–13. [Google Scholar] [CrossRef]
- Abnaroodheleh, F.; Emadi, A.; Dashtipour, S.; Jamil, T.; Khaneghah, A.M.; Dadar, M. Shedding rate of Brucella spp. in the milk of seropositive and seronegative dairy cattle. Heliyon 2023, 9, 1–8. [Google Scholar] [CrossRef]
- Kolo, F.B.; Adesiyun, A.A.; Fasina, F.O.; Katsande, C.T.; Dogonyaro, B.B.; Potts, A.; Matle, I.; Gelaw, A.K.; Van Heerden, H. Seroprevalence and characterization of Brucella species in cattle slaughtered at Gauteng abattoirs, South Africa. Vet. Med. Sci. 2019, 5, 545–555. [Google Scholar] [CrossRef]
- Morales-Estrada, A.I.; Joel, C.; Ahide, L.; Maria, R.M.; Juan, G.V.; Araceli, C. Characterization of Brucella species in Mexico by Bruce-Ladder polymerase chain reaction (PCR). Afr. J. Microbiol. Res. 2012, 6, 2793–2796. [Google Scholar] [CrossRef]
- Ewalt, D.R.; Payeur, J.B.; Rhyan, J.C.; Geer, P.L. Brucella suis biovar 1 in naturally infected cattle: A bacteriological, serological, and histological study. J. Vet. Diagn. Investig. 1997, 9, 417–420. [Google Scholar] [CrossRef] [PubMed]
- Fretin, D.; Mori, M.; Czaplicki, G.; Quinet, C.; Maquet, B.; Godfroid, J.; Saegerman, C. Unexpected Brucella suis biovar 2 infection in a dairy cow, Belgium. Emerg. Infect. Dis. 2013, 19, 2053. [Google Scholar] [CrossRef] [PubMed]
- Baek, B.; Park, M.Y.; Islam, M.A.; Khatun, M.M.; Lee, S.I.; Boyle, S.M. The first detection of Brucella canis in cattle in the Republic of Korea. Zoonoses Public Health 2012, 59, 77–82. [Google Scholar] [CrossRef]
- Yaeger, M.J.; Holler, L.D. Bacterial causes of bovine infertility and abortion. In Current Therapy in Large Animal Theriogenology; Elsevier: Amsterdam, The Netherlands, 2007; pp. 389–399. [Google Scholar]
- Varsha, T.; Bannalikar, A. Molecular characterization of Brucella species detected from clinical samples of cattle and buffaloes. Indian J. Anim. Sci. 2022, 92, 1274–1279. [Google Scholar] [CrossRef]
- Efrem, G.H.; Mihreteab, B.; Ghebremariam, M.K.; Yitbarek, G.; Gezahegne, M. Isolation and identification of Brucella abortus and B. melitensis in ruminants with a history of abortion: The first report from Eritrea. Ethiopian Vet. J. 2024, 28, 122–138. [Google Scholar] [CrossRef]
- Hegazy, Y.M.; Oreiby, A.F.; Algabbary, M.H.; Hamdy, M.E.R.; Beleta, E.I.; Martínez, I.; Shahein, M.A.; García, N.; Eltholth, M. Trans-species transmission of Brucellae among ruminants hampering brucellosis control efforts in Egypt. J. Appl. Microb. 2022, 132, 90–100. [Google Scholar] [CrossRef]
- Bardenstein, S.; Grupel, D.; Blum, S.E.; Motro, Y.; Moran-Gilad, J. Public and animal health risks associated with spillover of Brucella melitensis into dairy farms. Microb. Genom. 2023, 9, 1014. [Google Scholar] [CrossRef]
- Sanz, C.; Sáez, J.L.; Álvarez, J.; Cortés, M.; Pereira, G.; Reyes, A.; Rubio, F.; Martín, J.; García, N.; Domínguez, L. Mass vaccination as a complementary tool in the control of a severe outbreak of bovine brucellosis due to Brucella abortus in Extremadura, Spain. Prev. Vet. Med. 2010, 97, 119–125. [Google Scholar] [CrossRef]
- Lord, V.R.; Schurig, G.G.; Cherwonogrodzky, J.W.; Marcano, M.J.; Melendez, G.E. Field study of vaccination of cattle with Brucella abortus strains RB51 and 19 under high and low disease prevalence. Am. J. Vet. Res. 1998, 59, 1016–1020. [Google Scholar] [CrossRef]
- El-Diasty, M.; Wareth, G.; Melzer, F.; Mustafa, S.; Sprague, L.D.; Neubauer, H. Isolation of Brucella abortus and Brucella melitensis from Seronegative Cows is a Serious Impediment in Brucellosis Control. Vet. Sci. 2018, 5, 28. [Google Scholar] [CrossRef]
- Zinka, M.; Amela, J.; Orjana, S.; Maid, R. Molecular detection of Brucella spp. in clinical samples of seropositive ruminants in Bosnia and Herzegovina. Comp. Immunol. Microbiol. Infect. Dis. 2022, 86, 101821. [Google Scholar]
Target | Targeted Gene | Sequences of Primers and Probes (5′–3′) | Fluorophore/Quencher | Reference |
---|---|---|---|---|
Genus Brucella | IS711 | Probe: AAG CCA ACA CCC GGC Forward: GGC CTA CCG CTG CGA AT Reverse: TTG CGG ACA GTC ACC ATA ATG | FAM/-MGBNFQ | Matero et al. (2011) [26] |
B. melitensis | IS711 downstream of BMEI1162 | Probe: CAGGAGTGTTTCGGCTCAGAATAATCCACA Forward: AACAAGCGGCACCCCTAAAA Reverse: CATGCGCTATGATCTGGTTACG | Texas Red/BHQ2 | Probert et al. (2004) [27] |
B. abortus | IS711 downstream of alkB | Probe: CGCTCATGCTCGCCAGACTTCAATG Forward: GCGGCTTTTCTATCACGGTATTC Reverse: CATGCGCTATGATCTGGTTACG | JOE/BHQ1 |
Region | Total Animals Sampled | Number of Positive Blood Samples (%) | Number of Positive Swab Samples (%) |
---|---|---|---|
Arusha | 318 | 5/318 (1.6%) | 10/294 (3.4%) |
Tanga | 524 | 6/524 (1.0%) | 1/412 (0.2%) |
Kilimanjaro | 521 | 11/519 (2.1%) | 8/513 (1.6%) |
Iringa | 281 | 7/281 (2.5%) | 1/273 (0.4%) |
Njombe | 187 | 1/186 (1.1%) | 14/186 (7.5%) |
Mbeya | 218 | 5/218 (2.3%) | 3/215 (1.4%) |
Total | 2049 | 35/2046 (1.7%) | 37/1893 (2.0%) |
Region | Negative | Positive | Total | PCR Prevalence % | 95% CI | Dairy Cattle Population |
---|---|---|---|---|---|---|
Arusha | 303 | 15 | 318 | 4.7 | 2.7–7.7 | 78,637 |
Tanga | 517 | 7 | 524 | 1.3 | 0.5–2.7 | 41,639 |
Kilimanjaro | 500 | 19 | 519 | 3.7 | 2.2–5.7 | 161,984 |
Iringa | 273 | 8 | 281 | 2.8 | 1.2–5.5 | 7081 |
Njombe | 171 | 15 | 186 | 8.1 | 4.6–13.0 | 7177 |
Mbeya | 210 | 8 | 218 | 3.8 | 1.7–7.4 | 72,724 |
Total | 1974 | 72 | 2046 | 3.5 | 2.8–4.4 | 369,242 |
Region | Sample | B. abortus | B. melitensis | Mixed | Undetermined |
---|---|---|---|---|---|
Arusha | Blood n = 5 | 0 | 3 | 2 | 0 |
Swabs n = 10 | 0 | 9 | 1 | 0 | |
Kilimanjaro | Blood n = 11 | 1 | 9 | 0 | 1 |
Swabs n = 8 | 0 | 6 | 2 | 0 | |
Tanga | Blood n = 6 | 0 | 2 | 3 | 1 |
Swabs n = 1 | 0 | 1 | 0 | 0 | |
Njombe | Blood n = 1 | 0 | 1 | 0 | 0 |
Swabs n = 14 | 0 | 11 | 2 | 1 | |
Iringa | Blood n = 7 | 0 | 3 | 2 | 2 |
Swabs n = 1 | 0 | 1 | 0 | 0 | |
Mbeya | Blood n = 5 | 1 | 1 | 3 | 0 |
Swabs n = 3 | 0 | 1 | 2 | 0 | |
Total | Blood n = 35 | 2 | 19 | 10 | 4 |
Swabs n = 37 | 0 | 29 | 7 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mengele, I.J.; Akoko, J.M.; Shirima, G.M.; Bwatota, S.F.; Motto, S.K.; Hernandez-Castro, L.E.; Komwihangilo, D.M.; Lyatuu, E.; Bronsvoort, B.M.d.C.; Cook, E.A.J. Brucella Species Circulating in Smallholder Dairy Cattle in Tanzania. Pathogens 2024, 13, 815. https://doi.org/10.3390/pathogens13090815
Mengele IJ, Akoko JM, Shirima GM, Bwatota SF, Motto SK, Hernandez-Castro LE, Komwihangilo DM, Lyatuu E, Bronsvoort BMdC, Cook EAJ. Brucella Species Circulating in Smallholder Dairy Cattle in Tanzania. Pathogens. 2024; 13(9):815. https://doi.org/10.3390/pathogens13090815
Chicago/Turabian StyleMengele, Isaac Joseph, James Miser Akoko, Gabriel Mkilema Shirima, Shedrack Festo Bwatota, Shabani Kiyabo Motto, Luis E. Hernandez-Castro, Daniel Mushumbusi Komwihangilo, Eliamoni Lyatuu, Barend Mark de Clare Bronsvoort, and Elizabeth Anne Jessie Cook. 2024. "Brucella Species Circulating in Smallholder Dairy Cattle in Tanzania" Pathogens 13, no. 9: 815. https://doi.org/10.3390/pathogens13090815