Detection of Potential Zoonotic Bartonella Species in African Giant Rats (Cricetomys gambianus) and Fleas from an Urban Area in Senegal
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Study Site and Sample Collection
2.3. Ectoparasite Identification
2.4. DNA Extraction and Screening for Bartonella spp. by the Real-Time PCR (qPCR)
2.5. Bartonella spp. Culture and Isolation and MALDI-TOF MS Identification
2.6. Genetic Amplification by Standard PCR, Sequencing and Phylogeny
3. Results
3.1. Rats and Ectoparasites
3.2. Bartonella Detection and Isolation
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Theonest, N.O.; Carter, R.W.; Amani, N.; Doherty, S.L.; Hugho, E.; Keyyu, J.D.; Mable, B.K.; Shirima, G.M.; Tarimo, R.; Thomas, K.M.; et al. Molecular detection and genetic characterization of Bartonella species from rodents and their associated ectoparasites from northern Tanzania. PLoS ONE 2019, 14, e0223667. [Google Scholar] [CrossRef] [PubMed]
- Iannino, F.; Salucci, S.; Di Provvido, A.; Paolini, A.; Ruggieri, E. Bartonella infections in humans dogs and cats. Vet. Ital. 2018, 54, 63–72. [Google Scholar] [CrossRef] [PubMed]
- Vayssier-Taussat, M.; Le Rhun, D.; Bonnet, S.; Cotté, V. Insights in Bartonella host specificity. Ann. N. Y. Acad. Sci. 2009, 1166, 127–132. [Google Scholar] [CrossRef] [PubMed]
- Inoue, K.; Maruyama, S.; Kabeya, H.; Yamada, N.; Ohashi, N.; Sato, Y.; Yukawa, M.; Masuzawa, T.; Kawamori, F.; Kadosaka, T.; et al. Prevalence and genetic diversity of Bartonella species isolated from wild rodents in Japan. Appl. Environ. Microbiol. 2008, 74, 5086–5092. [Google Scholar] [CrossRef][Green Version]
- Regier, Y.; O’Rourke, F.; Kempf, V.A.J. Bartonella spp.—A chance to establish One Health concepts in veterinary and human medicine. Parasites Vectors 2016, 9, 261. [Google Scholar] [CrossRef]
- Kingdon, J. The Kingdon Field Guide to African Mammals; Academic Press: San Diego, CA, USA, 1997; pp. 199–200. ISBN 0-12-408355-2. [Google Scholar]
- Ekeh, F.; Ekechukwu, N.E. Ecto and gut parasitic fauna of the African giant rat (Cricetomy gambianus) in a semi-urban tropical community. Anim. Res. Int. 2009, 6, 1082–1085. [Google Scholar] [CrossRef]
- Gutiérrez, R.; Krasnov, B.; Morick, D.; Gottlieb, Y.; Khokhlova, I.S.; Harrus, S. Bartonella infection in rodents and their flea ectoparasites: An overview. Vector Borne Zoonotic Dis. 2015, 15, 27–39. [Google Scholar] [CrossRef]
- Yong, Z.; Fournier, P.E.; Rydkina, E.; Raoult, D. The geographical segregation of human lice preceded that of Pediculus humanus capitis and Pediculus humanus humanus. Comptes Rendus Biol. 2003, 326, 565–574. [Google Scholar] [CrossRef]
- Mediannikov, O.; Fenollar, F. Looking in ticks for human bacterial pathogens. Microb. Pathog. 2014, 77, 142–148. [Google Scholar] [CrossRef]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef]
- Dahmani, M.; Sambou, M.; Scandola, P.; Raoult, D.; Fenollar, F.; Mediannikov, O. Bartonella bovis and Candidatus Bartonella davousti in cattle from Senegal. Comp. Immunol. Microbiol. Infect. Dis. 2017, 50, 63–69. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1884. [Google Scholar] [CrossRef]
- Leulmi, H.; Socolovschi, C.; Laudisoit, A.; Houemenou, G.; Davoust, B.; Bitam, I.; Raoult, D.; Parola, P. Detection of Rickettsia felis, Rickettsia typhi, Bartonella species and Yersinia pestis in fleas (Siphonaptera) from Africa. PLoS Negl. Trop. Dis. 2014, 8, e3152. [Google Scholar] [CrossRef]
- Halliday, J.E.B.; Knobel, D.L.; Agwanda, B.; Bai, Y.; Breiman, R.F.; Cleaveland, S.; Njenga, M.K.; Kosoy, M. Prevalence and diversity of small mammal-associated Bartonella species in rural and urban Kenya. PLoS Negl. Trop. Dis. 2015, 9, e0003608. [Google Scholar] [CrossRef]
- Martin-Alonso, A.; Houemenou, G.; Abreu-Yanes, E.; Valladares, B.; Feliu, C.; Foronda, P. Bartonella spp. in small mammals, Benin. Vector Borne Zoonotic Dis. 2016, 16, 229–237. [Google Scholar] [CrossRef]
- Bai, Y.; Osikowicz, L.M.; Kosoy, M.Y.; Eisen, R.J.; Atiku, L.A.; Mpanga, J.T.; Boegler, K.A.; Enscore, R.E.; Gage, K.L. Comparison of zoonotic bacterial agents in fleas collected from small mammals or host-seeking fleas from a Ugandan region where plague is endemic. mSphere 2017, 2, e00402-17. [Google Scholar] [CrossRef]
- Medkour, H.; Lo, C.I.; Anani, H.; Fenollar, F.; Mediannikov, O. Bartonella massiliensis sp. nov., a new bacterial species isolated from an Ornithodoros sonrai tick from Senegal. New Microbes New Infect. 2019, 32, 100596. [Google Scholar] [CrossRef]
- Billeter, S.A.; Borchert, J.N.; Atiku, L.A.; Mpanga, J.T.; Gage, K.L.; Kosoy, M.Y. Bartonella species in invasive rats and indigenous rodents from Uganda. Vector Borne Zoonotic Dis. 2014, 14, 182–188. [Google Scholar] [CrossRef]
- Kamani, J.; Morick, D.; Mumcuoglu, K.Y.; Harrus, S. Prevalence and diversity of Bartonella species in commensal rodents and ectoparasites from Nigeria, West Africa. PLoS Negl. Trop. Dis. 2013, 7, e2246. [Google Scholar] [CrossRef]
- Boutellis, A.; Veracx, A.; Angelakis, E.; Diatta, G.; Mediannikov, O.; Trape, J.F.; Raoult, D. Bartonella quintana in head lice from Senegal. Vector Borne Zoonotic Dis. 2012, 12, 564–567. [Google Scholar] [CrossRef]
- Dahmana, H.; Medkour, H.; Anani, H.; Granjon, L.; Diatta, G.; Fenollar, F.; Mediannikov, O. Non-contiguous finished genome sequence and description of Bartonella saheliensis sp. nov. from the blood of Gerbilliscus gambianus from Senegal. New Microbes New Infect. 2020, 35, 100667. [Google Scholar] [CrossRef] [PubMed]
- Dahmani, M.; Diatta, G.; Labas, N.; Diop, A.; Bassene, H.; Raoult, D.; Granjon, L.; Fenollar, F.; Mediannikov, O. Noncontiguous finished genome sequence and description of Bartonella mastomydis sp. nov. New Microbes New Infect. 2018, 25, 60–70, Erratum in New Microbes New Infect. 2018, 27, 3. https://doi.org/10.1016/j.nmni.2018.10.005. [Google Scholar] [CrossRef] [PubMed]
- Durden, L.A.; Hinkle, N.C. Fleas (Siphonaptera). In Medical and Veterinary Entomology, 3rd ed.; Chapter 10; Mullen, G.R., Durden, L.A., Eds.; Academic Press: Cambridge, MA, USA, 2019; pp. 145–169. ISBN 9780128140437. [Google Scholar]
- La Scola, B.; Zeaiter, Z.; Khamis, A.; Raoult, D. Gene-sequence-based criteria for species definition in bacteriology: The Bartonella paradigm. Trends Microbiol. 2003, 11, 318–321. [Google Scholar] [CrossRef]
- Mediannikov, O.; El Karkouri, K.; Robert, C.; Fournier, P.E.; Raoult, D. Non-contiguous finished genome sequence and description of Bartonella florenciae sp. nov. Stand. Genom. Sci. 2013, 9, 185–196. [Google Scholar] [CrossRef] [PubMed]
- Mediannikov, O.; El Karkouri, K.; Diatta, G.; Robert, C.; Fournier, P.E.; Raoult, D. Non-contiguous finished genome sequence and description of Bartonella senegalensis sp. nov. Stand. Genom. Sci. 2013, 8, 279–289. [Google Scholar] [CrossRef] [PubMed]
- Mangombi, J.B.; N’Dilimabaka, N.; Medkour, H.; Banga, O.L.; Tall, M.L.; Ben Khedher, M.; Terras, J.; Abdi, S.; Bourgarel, M.; Leroy, E.; et al. Bartonella gabonensis sp. nov., a new Bartonella species from savannah rodent Lophuromys sp. in Franceville, Gabon. New Microbes New Infect. 2020, 38, 100796. [Google Scholar] [CrossRef] [PubMed]
- El Karkouri, K.; Mediannikov, O.; Robert, C.; Raoult, D.; Fournier, P.E. Genome Sequence of the Tick-Borne Pathogen Rickettsia raoultii. Genome Announc. 2016, 4, e00157-16. [Google Scholar] [CrossRef]
- Tay, S.T.; Kho, K.L.; Wee, W.Y.; Choo, S.W. Whole-genome sequence analysis and exploration of the zoonotic potential of a rat-borne Bartonella elizabethae. Acta Trop. 2016, 155, 25–33. [Google Scholar] [CrossRef]
- O’Halloran, H.S.; Draud, K.; Minix, M.; Rivard, A.K.; Pearson, P.A. Leber’s neuroretinitis in a patient with serologic evidence of Bartonella elizabethae. Retina 1998, 18, 276–278. [Google Scholar] [CrossRef]
- Corral, J.; Manríquez Robles, A.; Toussaint Caire, S.; Hernández-Castro, R.; Moreno-Coutiño, G. First report of bacillary angiomatosis by Bartonella elizabethae in an HIV-positive patient. Am. J. Dermatopathol. 2019, 41, 750–753. [Google Scholar] [CrossRef]
- Mexas, A.M.; Hancock, S.I.; Breitschwerdt, E.B. Bartonella henselae and Bartonella elizabethae as potential canine pathogens. J. Clin. Microbiol. 2002, 40, 4670–4674. [Google Scholar] [CrossRef]
- Thiam, M.; Fall, P.D.; Gning, S.B.; Grinda, J.M.; Mainardi, J.L. Bartonella quintana infective endocarditis in an immunocompetent Senegalese man. Rev. Med. Interne 2002, 23, 1035–1037. [Google Scholar] [CrossRef]
- Diatta, G.; Mediannikov, O.; Sokhna, C.; Bassene, H.; Socolovschi, C.; Ratmanov, P.; Fenollar, F.; Raoult, D. Prevalence of Bartonella quintana in patients with fever and head lice from rural areas of Sine-Saloum, Senegal. Am. J. Trop. Med. Hyg. 2014, 91, 291–293. [Google Scholar] [CrossRef]
PCRs | Target Genes | Primer Names | Sequences | References |
---|---|---|---|---|
Screening by qPCR | ITS3, Bartonella spp. (Intergenic 16S-23S) | Barto_ITS3_F | GATGCCGGGGAAGGTTTTC | [10] |
Barto_ITS3_R | GCCTGGGAGGACTTGAACCT | |||
Barto_ITS3_P | 6FAM-GCGCGCGCTTGATAAGCGTG | |||
ITS2, Bartonella spp. 2nd intention | Barto_ITS2_F | GGGGCCGTAGCTCAGCTG | ||
Barto_ITS2_R | TGAATATATCTTCTCTTCACAATTTC | |||
Barto_ITS2_P | 6FAM-CGATCCCGTCCGGCTCCACCA | |||
Standard PCRs and sequencing | 16S, Bacteria | Fd1 | AGAGTTTGATCCTGGCTCAG | [11] |
Rp2 | ACGGCTACCTTGTTACGACTT | |||
ITS, Bartonella spp. | Urbarto1 | CTTCGTTTCTCTTTCTTCA | [12] | |
Urbarto2 | CTTCTCTTCACAATTTCAAT | |||
ftsZ, Bartonella spp. | FTSZDIR | CCGTGAATAATATGATTAATGC | ||
FTSZREV | TTGAAATGGCTTTGTCACAAC | |||
rpoB, Bartonella spp. | 1400F | CGCATTGGCTTACTTCGTATG | ||
2300R | GTAGACTGATTAGAACGCTG | |||
1596R | GGACAAATACGACCATAATGCG | |||
2028F | GGAAAATGATGATGCGAATCGTGC | |||
1873R | TCYTCCATMGCWGAMAGATAAA |
Isolates | Blast Results: Identity (%) and Size (bp) for the Sequenced Genes | ||||||||
---|---|---|---|---|---|---|---|---|---|
Best Results | 16S | Size | RpoB | Size | ITS | Size | FtsZ | Size | |
R03 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1400 | 93.2–96.3 | 1001 | 87.9–94.1 | 727 | 96.2–96.3 | 894 |
R04 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | - | - | - | - | 87.7–89.9 | 739 | 95.6–96 | 889 |
R05 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1408 | 93.4–96.2 | 866 | 88–89.9 | 730 | 96–96.2 | 906 |
R06 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1416 | 93.4–96.8 | 868 | 87.2–89 | 781 | 95.3–95.6 | 900 |
R08 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1401 | 93.7–96.5 | 898 | - | - | 95.9–96.1 | 879 |
R09 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1400 | - | - | 88.8–90 | 708 | 95–95.4 | 895 |
R10 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1400 | - | - | - | - | - | - |
R11 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1351 | 92.8–95.7 | 906 | 86.7–94.5 | 727 | 95.4–95.8 | 877 |
R12 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1400 | - | - | 88.8–91.7 | 715 | 95.3–95.5 | 925 |
R13 | B. massiliensis strain OS09 (HM636440) | 100 | 1401 | 99 | 877 | 98.3 | 786 | 99.5 | 868 |
R14 | B. massiliensis strain OS09 (HM636440) | 100 | 1401 | 99.2 | 874 | - | - | 99.1 | 895 |
R15 | B. massiliensis strain OS09 (HM636440) | 99.9 | 1401 | 99.3 | 1018 | 97.8 | 770 | 99.8 | 875 |
R16 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1400 | 93.8–96.7 | 873 | 87.9–90.2 | 737 | 96.4–96.7 | 913 |
R17 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1400 | 93.8–96.7 | 868 | 87.5–89.6 | 731 | - | - |
R18 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1410 | 94–95.9 | 889 | 89.6–91.5 | 720 | 95.9–96 | 909 |
R19 | B. kosoyi strain Tel Aviv (MN627780), B. elizabethae strain NCTC12898 (LR134527) | 99.6 | 1400 | 93.5–96.2 | 865 | 88.3–90.4 | 771 | 96.6–96.9 | 915 |
R20 | B. massiliensis strain OS09 (HM636440) | 100 | 1402 | 99 | 868 | 98.9 | 812 | 99.1 | 902 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Demoncheaux, J.-P.; Medkour, H.; Louni, M.; Laugier, L.; Pasqualini, C.; Fenollar, F.; Davoust, B.; Mediannikov, O. Detection of Potential Zoonotic Bartonella Species in African Giant Rats (Cricetomys gambianus) and Fleas from an Urban Area in Senegal. Microorganisms 2022, 10, 489. https://doi.org/10.3390/microorganisms10030489
Demoncheaux J-P, Medkour H, Louni M, Laugier L, Pasqualini C, Fenollar F, Davoust B, Mediannikov O. Detection of Potential Zoonotic Bartonella Species in African Giant Rats (Cricetomys gambianus) and Fleas from an Urban Area in Senegal. Microorganisms. 2022; 10(3):489. https://doi.org/10.3390/microorganisms10030489
Chicago/Turabian StyleDemoncheaux, Jean-Paul, Hacene Medkour, Meriem Louni, Laurie Laugier, Christelle Pasqualini, Florence Fenollar, Bernard Davoust, and Oleg Mediannikov. 2022. "Detection of Potential Zoonotic Bartonella Species in African Giant Rats (Cricetomys gambianus) and Fleas from an Urban Area in Senegal" Microorganisms 10, no. 3: 489. https://doi.org/10.3390/microorganisms10030489
APA StyleDemoncheaux, J.-P., Medkour, H., Louni, M., Laugier, L., Pasqualini, C., Fenollar, F., Davoust, B., & Mediannikov, O. (2022). Detection of Potential Zoonotic Bartonella Species in African Giant Rats (Cricetomys gambianus) and Fleas from an Urban Area in Senegal. Microorganisms, 10(3), 489. https://doi.org/10.3390/microorganisms10030489