Next Article in Journal
Detection of Acanthamoeba from Acanthamoeba Keratitis Mouse Model Using Acanthamoeba-Specific Antibodies
Next Article in Special Issue
Response Surface Methodology (RSM) Mediated Optimization of Medium Components for Mycelial Growth and Metabolites Production of Streptomyces alfalfae XN-04
Previous Article in Journal
The Effect of Different Substrates on the Morphological Features and Polyols Production of Endomyces magnusii Yeast during Long-Lasting Cultivation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 10
Issue 9
10.3390/microorganisms10091710
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Improved Biocontrol Agent, F1-35, Protects Watermelon against Fusarium Wilt by Triggering Jasmonic Acid and Ethylene Pathways

by
Xiao-Min Dong
†,
Qing-Gui Lian
†,
Jing Chen
,
Rui-Min Jia
,
Zhao-Feng Zong
,
Qing Ma
and
Yang Wang
*
College of Plant Protection, Northwest A&F University, Yangling, Xianyang 712100, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Microorganisms 2022, 10(9), 1710; https://doi.org/10.3390/microorganisms10091710
Submission received: 17 July 2022 / Revised: 20 August 2022 / Accepted: 22 August 2022 / Published: 25 August 2022
(This article belongs to the Special Issue Advanced Research on Biological Control of Plant Disease or Microbial Interactions)
Browse Figures
Review Reports Versions Notes

Abstract

:
Watermelon Fusarium wilt, caused by Fusarium oxysporum f. sp. niveum (FON), is one of the most important diseases, and has become a major limiting factor to watermelon production worldwide. Previous research has found that the improved biocontrol agent, F1-35, had a high control efficiency to watermelon Fusarium wilt. In this study, the control efficiency of F1-35 to watermelon Fusarium wilt was firstly tested, and the control efficiency was 61.7%. Then, we investigated the mode of action of F1-35 in controlling watermelon Fusarium wilt. Using a pairing assay, we found that F1-35 did not inhibit the normal growth of FON. To know more about the interaction between F1-35 and watermelon root, the protein expressions of roots after 12, 24, and 48 h post-inoculation were examined. A total of 1109 differentially expressed proteins were obtained. KEGG analysis found that the most differentially expressed proteins occurred in alpha-linolenic acid metabolism, cysteine and methionine metabolism, plant–pathogen interaction, and the MAPK signaling pathway to the plant. A further analysis of differentially expressed proteins showed that F1-35 triggered the jasmonic acid and ethylene pathways in watermelon. To validate our results, the qRT-PCR was used to analyze the gene expression levels of PAL, LOX1, and CTR1. The gene expression results showed that those genes, which were positive correlated with the JA pathway, were up-expressed, including PAL and LOX1, and the negative associated gene, CTR1, was down-expressed. In conclusion, the improved biocontrol agent, F1-35, improves the resistance of watermelons to FON by triggering the JA and ET pathways.

1. Introduction

Fusarium wilt of watermelons (Citrullus lanatus), caused by Fusarium oxysporum f. sp. niveum (FON), is one of the most devastating diseases of watermelons around the world [1,2]. The pathogen which causes Fusarium wilt of watermelons exists in many different habitats, including saline soil, dry-tropical rainforests, and hospital sewage [3,4,5,6], and produces microspores, macrospores, and chlamydospores [7].
Fungicides, especially some fumigants, were once the most efficient way to control Fusarium wilt, but those fungicides were banned because of their defects, including being unfriendly to the environment and hardly degradable [8,9]. According to the Montreal Protocols, some alternative soil fumigants are used to control Fusarium wilt, but they are not as effective as MeBr at controlling FON or weeds, they are expensive, and they also negatively impact the environment [10]. Grafting is another method to control watermelon Fusariun wilt, which was first used commercially on watermelons in Japan and Korea [11,12]. Watermelons are primarily grafted onto Cucurbita rootstocks, which are non-hosts to FON [13,14,15]. However, as Mahamed [16] reported, grafting watermelons influences the growth, productivity, and quality of the fruit. Consequently, it is necessary to find an environmentally friendly, high-efficiency method to control Fusarium wilt.
Some researchers reported that F. oxysporum, as a hemi-biotrophic pathogen, could be inhibited by jasmonic acid and ethylene: the interaction between F. oxysporum and Arabidopsis thaliana reveals that salicylic acid (SA), which connects to systemic acquired resistance (SAR) [17,18], and JA/ET, which are induced systemic resistance (ISR) response hormones to beneficial microorganisms [19], also take part in the resistance process to Fusarium [20,21,22]. In addition, Kasote et al. [23] also found that ME-JA and JA-Ile may play an important role in the watermelon defense response against FON pathogens. Interestingly, some F. oxysporum species can enter into a plant as a beneficial microorganism and stimulate the JA pathway in the early stages [18,24]. As such, JA and ET play a role of resistance in the interaction between plant and F. oxysporum.
Many studies over the past decades have shown that certain microorganisms interact intimately with plants, suppressing plant pathogens and promoting plant growth [25,26,27,28]. Those microorganisms able to suppress plant pathogens are called biological control agents (BCA). The antagonism of BCAs includes: (1) diffusible antibiotics, volatile organic compounds, toxins, and biosurfactants inhibiting microbial growth; (2) competition space and nutrients; (3) degradation toxins and other pathogenicity factors; and (4) hyperparasitic, secreting cell-wall-degrading enzymes, such as chitinases and β-1,3-glucanase [29,30,31]. At present, some BCAs have been reported to have inhibitory effects on Fusarium wilt, including Bacillus velezensis, Fluorescent pseudomonads, Trichoderma saturnisporum, and non-pathogenic F. oxysporum [32,33,34,35].
Furthermore, some BCAs induce the expression of plant hormones, such as SA, ET, and JA [36,37,38,39]. Those plant hormones suppress infection by plant pathogens by plant hormone signal transduction. SA, JA, and ethylene (ET) are the major phytohormones in SAR and ISR, respectively. SAR and ISR are the important strategies by which plants respond to a wide range of biotic and abiotic stresses [40,41].
One of the BCAs, non-pathogenic Fusarium oxysporum Fo47, was isolated from soil in France [42]. Many researchers have reported that it has the ability to control many plant diseases worldwide, including Fusarium wilt, Verticillium, and Phytophthora in pepper and tomatoes [42,43,44,45,46,47]. In former research, protoplast fusion was carried out between Fo47 and actinomycetes 153 by inactivation and mutation in order to improve the characteristics of the Fo47 strain [48]. F1-35, one of the fusion products, improved the properties of inoculation, fungicide resistance, and growth promotion. We also found that the rates of promoting the growth of F1-35 depended on the dose of gibberellin. The recombinant strain, F1-35, produced a higher content of gibberellin (223.8 mg/L) than Fo47 (134.5 mg/L) after being separately grown in 200 mL Czapek broth for 3 days in a 250 mL flask at 25 °C, agitated at 150 rmp. F1-35 also had better growth-promoting than that of Fo47 in watermelons and cucumber seedlings. With regard to the control efficiency of FON, F1-35 reached 59.04%, which was higher than that of Fo47 (34.94%) [48].
The aim of this study was to determine the mechanism of F1-35 control of watermelon Fusarium wilt by using the pairing assay and isobaric tags for relative and absolute quantitation (iTRAQ) coupled with the LC-MS/MS method and qRT-PCR to study the interaction between F1-35 and watermelon plants.

2. Materials and Methods

2.1. Pathogenic Fungus, Biocontrol Agent F1-35, and Plant Materials

The watermelon Fusarium wilt pathogen, Fusarium oxysporum f. sp. niveum (FON), and the improved biocontrol strain, F1-35, were provided by the Vegetable Disease and Biocontrol Laboratory, College of Plant Protection, Northwest A&F University, Yangling, Shaanxi Province, China. FON and F1-35 were cultured on potato dextrose agar (PDA) plates at 28 °C for 7 d. A cultivated variety of watermelon, NW-5, which is sensitive to watermelon Fusarium wilt, was used in this study; this was provided by Associate Professor Jianxiang Ma, College of Horticulture, Northwest A&F University, Yangling, Shaanxi Province, China. The seeds were treated according to the procedures of Kong et al. [49] as follows: seeds were first sterilized with 1.5% sodium hypochlorite, soaked in distilled water for 4 h, and maintained at 30 °C for germination. The germinated seedlings were planted in a sterilized peat-perlite substrate (2:1 v/v) and cultured in the greenhouse under a 16-h diurnal light cycle at 28 °C with 80 to 85% relative humidity inside a controlled environment chamber. Seedlings with five true leaves were used for the experiment.

2.2. Inoculum Preparation and Plant Inoculation

Agar plugs (5-mm diameter) were aseptically cut out from the edge of the fungal colonies of FON and F1-35 after 7 d of growth in PDA plates. FON and F1-35 were then separately grown in 200 mL potato dextrose broth (PDB) in a 250 mL flask at 28 °C for 7 d, with agitation at 160 rmp. Spore suspensions of FON and F1-35 in PDB were filtered and prepared at concentrations of 106 cfu/mL and 108 cfu/mL, respectively, determined using a hemocytometer [50].
All seedling roots were inoculated by dipping in a spore suspension for 10 min. There were four treatment groups: control (CK) (treated with PDB), FON (treated with FON), F1-35 (treated with F1-35), and F1-35/FON (treated with FON and F1-35 simultaneously). Each treatment was conducted in triplicate, with 24 seedlings in each replicate. Samples of CK, FON, and F1-35 were separately collected at 0, 12, 24, 48, 72, and 96 h post-inoculation (hpi), with six seedlings for each time point, immediately frozen in liquid nitrogen and stored at −80 °C for further study.

2.3. Control Efficiency Test

Following the treatments described above, and with three replicates for each treatment, the disease index and control efficiency were counted using the methodology described by Pu et al. [50].

2.4. Pairing Assay

To determine the F1-35 inhibition of FON, dual cultures were used according to the method of Veloso and Díaz [43], including only FON and F1-35 + FON, with three replicates, each replicate comprising three Petri dishes. The mycelia of FON, which were located beside F1-35, were examined under a microscope.

2.5. Proteomic Analysis

2.5.1. Proteome Extraction and iTRAQ Labeling

Protein from the CK, and 12 hpi, 24 hpi, and 48 hpi root of F1-35 samples, comprising three biological replicates, was extracted using TCA/acetone precipitation and SDT lysis [51]. Proteins (20 µg) from each sample were then mixed with 5× loading buffer, and boiled for 5 min. The proteins were separated on 12.5% SDS-PAGE gel (constant current 14 mA for 90 min). Protein bands were visualized by Coomassie Blue R-250 staining. After filter-aided sample preparation (FASP digestion) using the Wisniewski method [52], 100 μg of peptide mixture from each sample was labeled using the iTRAQ reagent according to the manufacturer’s instructions (Applied Biosystems).

2.5.2. Peptide Fractionation with Strong Cation Exchange (SCX) Chromatography

The labeled peptides in each group were homogenized and mixed with an AK-TA purifier system (GE Healthcare). As buffer A, we used 10 mM KH2PO4, 25% ACN, pH 3.0, whereas buffer B contained 10 mM KH2PO4, 500 mM KCl, 25% ACN, pH 3.0. The column was equilibrated with buffer A, and then, peptides were eluted at a flow rate of 1 Ml/min with a gradient of 0–8% buffer B (500 mM KCl, 10 mM KH2PO4 in 25% of ACN, pH 3.0) for 22 min, 8–52% buffer B for 22–47 min, 52–100% buffer B for 47–50 min, and 100% buffer B for 50–58 min; then, buffer B was reset to 0% after 58 min. The absorbance was set at 214 nm for monitoring elution, and fractions were collected every 1 min. After collecting fractions, the fractions were collected on C18 Cartridges (Empore™ SPE Cartridges C18, standard density, bed I.D. 7 mm, 3-mL volume; Sigma, St. Louis, MO, USA) and vacuum-centrifuged for concentration.

2.5.3. LC-MS/MS Analysis

The specific steps are as follows: (1) buffer A (0.1% formic acid) and buffer B (84% acetonitrile and 0.1% formic acid) were prepared. (2) The peptide mixture was loaded onto a reverse phase trap column (Thermo Scientific Acclaim PepMap100, 100 μm × 2 cm, nanoViper C18, Boston, MA, USA) and connected to a C18-reverse phase analytical column (Thermo Scientific Easy Column, 10 cm long, 75 μm inner diameter, 3μm resin). Buffer A and buffer B were used for elution at a flow rate of 300 nL/min, which was controlled by IntelliFlow technology. (3) The samples were analyzed by a Q Exactive mass spectrometer (Thermo Scientific), and the detection mode was set to positive ion for 60/120/240 min. The parent scan was in the range of 300 to 1800 m/z with a resolution of 70,000 at 200 m/z. The automatic gain control (AGC) target was set to 3e6 at a maximum injection time of 10 ms. The duration of dynamic exclusion was 40.0 s. The parent ions with the top 10 ionic strength in the full scan were selected and broken by high-energy collisional dissociation (HCD) fragmentation at a resolution of 17,500 at 200 m/z. The collision energy was normalized to 30 eV, and the underfill ratio was 0.1%.

2.5.4. MS Data Analysis

MS/MS spectra were searched using the MASCOT engine (Matrix Science, London, UK; version 2.2) embedded into Proteome Discoverer 1.4 [53]. Protein data, uniprot_Benincaseae_27316_20170228.fasta, were downloaded on 28 February 2017 at http://www.uniprot.org. The following parameters were set: enzyme as trypsin, max missed cleavages at 2, fixed modification as carbamidomethyl (C), iTRAQ 4/8 plex (N-term) and iTRAQ 4/8 plex (K), variable modifications as oxidation (M) and iTRAQ 4/8 plex (Y), peptide mass tolerance at ±20 ppm level, fragment mass tolerance as 0.1 Da, Benincaseae as database, decoy as database pattern, peptide FDR at ≤0.01 level, and the protein ratios calculated as the median of only the unique peptides of the protein. All peptide ratios were normalized by the median protein ratio; the median protein ratio should, therefore, be 1 after normalization.

2.5.5. Analysis of Differentially Expressed Proteins

Compared to CK, proteins with a differential expression greater than ±1.2-fold and a significant p-value ≤ 0.05 were annotated by gene ontology (GO) according to [54] and [55], and KEGG pathway annotation according to Kanehisa et al. [56].

2.6. qRT-PCR Analysis

2.6.1. Screening of Candidate Reference Genes and Primer Design

A total of 4 candidate reference genes were evaluated from http://www.icugi.org/ (accessed on 9 April 2017). These genes were chosen based on previous work by Guo et al. [57] and included: PAL, LOX1, CTR1, and beta-actin. All gene primers for qRT-PCR, except beta-actin, which was referenced by Kong et al. [49], were designed by Beacon Designer 7. All primers were synthesized by Quintarabio, Wuhan, China. The specificity of the PCR amplification product for each primer pair was further studied by melting curve analysis and amplification efficiency (E). All reactions were performed in a 20-μL volume containing 10 μL 2 × UltraSYBR Mixture (Cwbio Biotech Co., Ltd., Beijing, China), 1μL 10Μm forward and reverse primers, and 500 ng of cDNA. Melting curve analysis and amplification efficiency were conducted using Bio-Rad CFX Manager™ Software on Bio-Rad iQ5 real-time PCR instruments (Bio-Rad Laboratories, Hercules, CA, USA). The PCR program was as follows: 95 °C for 1 min, 40 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 40 s. Finally, dissociation curves were generated by increasing the temperature from 65 to 95 °C.

2.6.2. Total RNA Extraction and cDNA Synthesis

Total RNA was extracted from root samples using the Biozol method (Biomiga, Shanghai, China). Complementary DNA (cDNA) synthesis was then performed using a PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer’s instructions. The primer pairs for quantitative RT-PCR were designed using Beacon Designer (Premier Biosoft, Palo Alto, CA, USA). The PCR reaction consisted of 10 μL of 2× Ultra SYBR Mixture (Cwbio, Beijing, China), 40 nM primers, and 2 μL of 1:10 diluted template cDNA in a total volume of 20 μL. No template controls were set for each primer pair. Quantitative RT-PCR was performed employing the Bio-Rad CF X96 System and Opticon Monitor software (Bio-Rad, USA). CT values were determined by averaging three technical replicates and three biological replicates. For each gene of interest, standard curves were generated. We converted Ct values to relative amounts of cDNA and calculated gene expression using the 2−ΔΔCT method [58].

2.6.3. Quantitative Determination and Statistical Analysis

The expression levels of the tested reference genes were determined by CT values. The value of E for each reference gene was calculated according to the following equation: E (%) = (10−1/slope − 1) × 100, where the slope is the standard curve slope determined using Excel 2016. The calculations and comparisons of treatment means for each experiment were conducted using analysis of variance (ANOVA) and SPSS 20.0 (IBM, Armonk, NY, USA); means were analyzed with Tukey’s honestly significant difference (HSD) test at p = 0.05.

2.7. Data Analysis

All data were analyzed using SPSS 20.0 (IBM, Armonk, NY, USA) and Excel 2016 (Microsoft, Redmond, WA, USA). The results of qRT-PCR were calculated by REST using the 2−ΔΔCT method, and all figures were generated using GraphPad Prism 6 (GraphPad Software, San Diego, CA, USA).

2.8. MS/MS Data Submission

The raw data used in the present study for proteomics were submitted to the Integrated Proteome Resources database under accession number, IPX0001180000.

3. Results

3.1. The Control Efficiency of F1-35 against Watermelon Fusarium Wilt

To test the efficiency of F1-35 in controlling watermelon Fusarium wilt, F1-35, F1-35, and FON were simultaneously inoculated, and the incidence of watermelon seedling infections was recorded. The resulting control efficiency of F1-35 on watermelon Fusarium wilt was 61.7% (Table 1).

3.2. Pairing Assay

FON grew synchronously in the presence of F1-35, with no reduction compared to FON only. The radius of the FON colony was 28.5 mm and 27.7 mm, respectively, with no significant difference by the t-test. Therefore, F1-35 did not change the growth rates of FON. There was a boundary between F1-35 and FON. Subsequently, the mycelia of FON, which was located beside F1-35 colony, were observed with a microscope. There were no changes in either the mycelia or the spores. As such, no direct interactions between FON and F1-35 were observed under the microscope.

3.3. Influence of the Root Proteome Expressed after F1-35 Inoculation

To investigate the mechanism of Fusarium wilt reduction under F1-35, watermelon root proteomes during treatment with F1-35 (samples collected at 12, 24, and 48 hpi) were compared to CK. A total of 31,440 peptides were identified, including 27,618 unique peptides, and 6243 proteins were blasted to Benincaseae. To establish authenticity and accuracy, the MASCOT ion score was set as the index, which was carried with MASCOT 2.2 to form a blast in the database. The result of MASCOT showed that 70% of total peptides ion scores were higher than 20, with the middle ion score being 30. Comparing the FDR < 0.01 and ion score distribution, the MS result appears to be reliable and reproducible.
Proteomic results were summarized in the Venn diagram in Figure 1. This clearly demonstrated the differently expressed proteins in watermelon response to F1-35 at 12, 24, and 48 hpi. For the 12-hpi root proteins compared to CK, there were 184 differentially expressed proteins, 110 with up-regulated expression and 83 with down-regulated expression. For the 24-hpi root proteins, the differentially expressed proteins increased to 412, with 221 up-regulated and 191 down-regulated. The 48-hpi root differentially expressed proteins were similar to the 24-hpi root proteins, where 413 proteins were differentially expressed, 186 up-regulated and 227 down-regulated.
To investigate the interaction between F1-35 and watermelons, the identified proteins were analyzed. Compared to CK at 12 hpi, there were three up-regulated proteins and three down-regulated proteins. Having blasted the function of those proteins, the three up-regulated proteins related to soil stress or drought stress, and the three down-regulated proteins were Gip1-like proteins, which respond to some stress. Auxin-repressed protein (Arp), induced by JA, could increase resistance after being silenced. Compared to CK at 24 hpi, the highly expressed protein after treatment for 24 h with F1-35 had not only GIP, Arp, and the negative-regulated resistance protein, but also some JA-associated proteins, PR5 and glyceraldehyde-3-phosphate dehydrogenase. The down-regulated proteins were similar to the 12-hpi samples. After treatment for 48 h with F1-35, the major differentially expressed proteins were similar to 12 h and 24 h. The down-regulated proteins were WRKY 17, a negative protein to JA, and a negative-regulated resistance protein (Table 2).

3.4. Identification and Functional Classification of Differentially Expressed Proteins

GO analysis revealed that most differentially expressed proteins were involved in metabolic processes, and single organism and cellular processes, among others. Many differentially expressed proteins were associated with molecular functions, such as binding, catalytic activity, and the binding of small molecules. Moreover, many differentially expressed proteins were associated with the cellular component, such as the organelle, membrane, and cell part, as seen in (Figure 2).
The differentially expressed proteins were also grouped into main functional classes based on KEGG [59]. The KEGG pathway analysis showed that most differentially expressed proteins occurred in plant–pathogen interaction, phenylpropanoid biosynthesis, oxidative phosphorylation, carbon metabolism, alpha-linolenic acid metabolism, cysteine and methionine metabolism, and the MAPK signaling pathway to the plant (Figure 3). In the root proteins at 12 and 24 hpi, the key enzymes were identified in alpha-linolenic acid metabolism and cysteine/methionine metabolism pathways. The plant hormones, JA and ET, are the product of those pathways. In the 24- and 36-hpi root proteins, JAR1 and ChiB were identified.
Based on the above results, we consider that the mechanism of F1-35 protection watermelon against Fusarium wilt involves triggering the JA and ET pathways (Figure 4).

3.5. qRT-PCR Analysis

To validate the above hypothesis, qRT-PCR was used. The primers were designed with Beacon Designer 7 according to the cDNA sequence, which can be downloaded from http://www.icugi.org/ (accessed on 9 April 2017), with the exception of beta-actin (Table 3). To determine a suitable temperature for qRT-PCR, a gradient PCR was carried out, with results shown for 60 °C; each primer had a well-defined peak. The results of E show that all primers had amplification efficiency values of 96.28 to 224.35%, and all R2 values were greater than 0.96, all of which indicated that those primers could be used in qRT-PCR and 2−ΔΔCT [58].
Together, these results suggest that all primers were suitable for qRT-PCR. Therefore, samples collected after treatment for 0, 12, 24, 48, 72, and 96 h were used to analyze gene expression, including the PAL, LOX1, and CTR1 genes. In F1-35 treated roots, PAL gene transcriptional levels were also induced after 48 hpi, whereas in FON-treated roots, the PAL gene was highly expressed before 48 hpi. In F1-35-treated stems, the PAL gene was induced at 48 hpi, and peaked at 72 hpi, which was higher than in the CK or FON treatments. In F1-35-treated leaves, the PAL gene was induced at 24 hpi. The peak of the PAL gene was 5.34 at 24 hpi, and then it slowly returned to normal (1.34). With FON treatment, PAL gene expression was increased after an initial decrease. The LOX1 gene was induced after treatment with F1-35 at 12 hpi, and peaked at 24 hpi in the roots. In stems and leaves, LOX1 was also induced. CTR1, a negative key gene connected with the ET pathway, was down-regulated after treatment with F1-35 and even FON (Figure 5).

4. Discussion

Fusarium oxysporum f. sp. niveum (FON), the pathogen causing watermelon Fusarium wilt, is wildly distributed around the world, and F. oxysporum is a hemi-biotrophic pathogen that can infect many plants, including tomatoes, bananas, and Arabidopsis [60]. FON poses a serious threat to the yield and quality of watermelons. A biocontrol agent is an effective natural means of controlling plant disease. All BCAs have been isolated from the rhizosphere and plants, but there are some obstacles in the application of BCAs. One of the important factors is the loss of anti-fungal activity, a result of a longtime subculture on artificial media [61,62,63,64]. Several methods can resolve this loss, including protoplast fusion and molecular genetics. As a Fo47-actinomycetes-153 fusion strain, previous research found that F1-35 produce more gibberellin and have a higher control efficiency of FON in watermelon plants, up to 59%, which was higher than Fo47 [48]. Our control efficiency experiment demonstrated a 61.7% control effect of FON in watermelon seedlings. Indeed, Fo47, improved with actinomycetes 153 by protoplast fusion, had stable biocontrol activity.
Further, the mechanism of F1-35-controlled Fusarium wilt in watermelon seedlings was explored. Previous studies reported that Fo47 controls plant disease by nutrition and ecological niche competition, inducing the expression of some defense genes. Actinomycetes 153 has activity against some fungi and bacteria [48]. As such, after protoplast fusion, did the Fo47-actinomycetes-153 fusion strain have those abilities? In this study, pair assaying was used to explore the antifungal ability of Fo47 after improvement with the protoplast of actinomycetes 153. The pair assay results showed that F1-35 could not cause the inhibition of FON growth because both the mycelia growth rates and spore morphology were normal.
In plants, F. oxysporum is controlled by manipulating defense pathways: some research has indicated that Arabidopsis thaliana responds against F. oxysporum via the JA/ET pathway [65]. Some studies have reported that SA and JA biosynthesis genes can be induced to expression at the early stage of FON infection of watermelons, and a lower concentration of SA may enhance watermelon resistance to FON. In addition, in resistant watermelon varieties, the crosstalk net between SA, JA, and ABA may help the JAR, NPRs, and PYLs family genes trigger the plant immune system against FON infection [22,66]. Other studies reported that F. oxysporum resistance is independent of SA-dependent defense gene expression in impaired JA-signaling mutants, such as myc2, coi1, and pft1/med25 [67,68,69]. In our study, the improved control agent, F1-35, increased some key enzymes of JA and ET pathways, which is similar to other BCAs, such as Bacillus pumilus SE34 [70,71]. Moreover, our results also indicate that F1-35 not only stimulates the JA and ET pathways, but also triggers plant PAMP defense and many broad-spectrum resistance proteins. Compared to CK treatment at 12 hpi, the up-regulated proteins were Q6I673, A3F570, and P0DI61. Former research has shown that these are a response to a poor soil environment and drought stress [72,73]. The down-regulated proteins were A0A0A0LG20, D1MWZ6, and A0A0A0L4M8. A0A0A0LG20 is a gibberellin-binding protein. D1MWZ6 is an auxin-repressing protein and A0A0A0L4M8 is a negative-regulated resistance protein [74]. Compared to CK treatment at 24 hpi, the up-regulated proteins were V5LF72, A0A097BU00, Q6I673, A0A0A0LWG8, A0A1D8RFV5, A0A0A0LW70, A0A0A0K1Y0, H6TB43, A0A0A0KGB3, A5X4I4, and A0A0A0KBB7. The main function of these proteins is drought resistance, including the PR5 protein or connecting with the JA pathway. The down-regulated proteins were D1MWZ6 and A0A0A0L4M8, which is similar to the result of 12-hpi vs. CK treatment. Compared to CK treatment at 48 hpi, the up-regulated proteins were Q6I673, A0A0A0LVN5, and A0A0A0LD49. These are connected to the JA pathway and some resistance proteins. The down-regulated proteins were E7CEW6, A0A0A0L4M8, A0A0A0LT35, D1MWZ6, and A0A0A0LW64. These proteins are negative-regulated resistance proteins or have a negative correlation with JA.
Furthermore, plant hormones were systemically analyzed. JA and ET, as plant hormones, play important roles in plant life, including fruit-ripening, and responding to pathogen and environment stress [75]. The signal transduction pathways occur in the induced responses of a plant to the pathogen, wounding, and herbivory. Jasmonic acid is involved in inducible defenses against pathogens and insects, and ET is important in induced plant defense [76,77].
In this study, lipoxygenase (LOX) and allene oxide synthase (AOS), key enzymes in the JA-producing pathway [78], were identified. Indeed, jasmonic acid-amido synthetase (JAR1), a JA-induced protein [79], could also be identified. In addition, chitinase B (ChiB), a protein related to downstream ethylene signal transduction [80], was elevated. Therefore, the JA and ET pathways were induced after the inoculation of F1-35 in the watermelons. To validate our results, qRT-PCR was used to analyze PAL, LOX1, and CTR1 gene expression levels. The gene expression results show that PAL and LOX1, which have a positive correlation to JA, have up-expression, and the negative-associated gene, CTR1, was down-expressed. In conclusion, the improved biocontrol agent, F1-35, can improve the resistance of watermelons to FON by triggering the JA and ET pathways.

Author Contributions

Conceptualization, Y.W., Q.M., X.-M.D. and Q.-G.L.; Investigation, Q.-G.L., X.-M.D. and J.C.; Methodology, Q.-G.L. and R.-M.J.; Validation, X.-M.D. and J.C.; Interpretation of the data, Y.W. and R.-M.J.; Writing—original draft, Q.-G.L. and X.-M.D.; Writing—review and editing, Z.-F.Z., Q.M. and Y.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation of China (31371978); The Key Industry Chain Innovation Project of Shaanxi province (2020ZDLNY07-02, 2021ZDLNY03-05).

Data Availability Statement

The raw data used in the present study for proteomics were submitted to the Integrated Proteome Resources database under accession number IPX0001180000.

Acknowledgments

We are grateful to John Richard Schrock (Emporia State University, USA) for proofreading the manuscript.

Conflicts of Interest

The authors have no conflict of interest to declare.

References

  1. Ren, Y.; Jiao, D.; Gong, G.Y.; Zhang, H.Y.; Guo, S.G.; Zhang, J.; Xu, Y. Genetic analysis and chromosome mapping of resistance to Fusarium oxysporum f. sp. niveum (FON) race 1 and race 2 in watermelon (Citrullus lanatus L.). Mol. Breed. 2015, 35, 9. [Google Scholar] [CrossRef] [PubMed]
  2. Hudson, O.; Fulton, J.C.; Dong, A.K.; Dufault, N.S.; Ali, M.E. Fusarium oxysporum f. sp. niveum molecular diagnostics past, present and future. Int. J. Mol. Sci. 2021, 22, 9735. [Google Scholar] [CrossRef]
  3. Massaccesi, G.; Romero, M.C.; Cazau, M.C.; Bucsinszky, A.M. Cadmium removal capacities of filamentous soil fungi isolated from industrially polluted sediments, in La Plata (Argentina). World J. Microbiol. Biot. 2002, 18, 817–820. [Google Scholar] [CrossRef]
  4. Mandeel, Q.A. Biodiversity of the genus Fusarium in saline soil habitats. J. Basic Microbiol. 2006, 46, 480–494. [Google Scholar] [CrossRef] [PubMed]
  5. Ortega-Larrocea, M.D.; Xoconostle-Cazares, B.; Maldonado-Mendoza, I.E.; Carrillo-Gonzalez, R.; Hernandez-Hernandez, J.; Garduno, M.D.; Lopez-Meyer, M.; Gomez-Flores, L.; Gonzalez-Chavez, M.D.A. Plant and fungal biodiversity from metal mine wastes under remediation at Zimapan, Hidalgo, Mexico. Environ. Pollut. 2010, 158, 1922–1931. [Google Scholar] [CrossRef] [PubMed]
  6. Babic, M.N.; Zalar, L.; Zenko, B.; Schroers, H.J.; Deroski, S.; Gunde-Cimerman, N. Candida and Fusarium species known as opportunistic human pathogens from customer-accessible parts of residential washing machines. Fungal Biol. 2015, 119, 95–113. [Google Scholar] [CrossRef]
  7. Rahman, M.Z.; Ahmad, K.; Siddiqui, Y.; Saad, N.; Hun, T.G.; Mohd Hata, E.; Rashed, O.; Hossain, M.I.; Kutawa, A.B. First report of Fusarium wilt disease on watermelon caused by Fusarium oxysporum f. sp. niveum (FON) in Malaysia. Plant Dis. 2021, 105, 4169. [Google Scholar] [CrossRef]
  8. Everts, K.L.; Himmelstein, J.C. Fusarium wilt of watermelon: Towards sustainable management of a re-emerging plant disease. Crop Prot. 2015, 73, 93–99. [Google Scholar] [CrossRef]
  9. Zhang, X.; Xue, C.; Fang, D.; He, X.H.; Wei, M.Y.; Zhuo, C.J.; Jin, J.Y.; Shen, B.A.; Li, R.; Ling, N.; et al. Manipulating the soil microbiomes during a community recovery process with plant beneficial species for the suppression of Fusarium wilt of watermelon. Amb. Express. 2021, 11, 1. [Google Scholar] [CrossRef]
  10. Sande, D.; Mullen, J.; Wetzstein, M.; Houston, J. Environmental Impacts from Pesticide Use: A case study of Soil fumigation in Florida tomato production. Int. J. Environ. Res. Public Health 2011, 8, 4649–4661. [Google Scholar] [CrossRef]
  11. Davis, A.R.; Perkins-Veazie, P.; Sakata, Y.; Lopez-Galarza, S.; Maroto, J.V.; Lee, S.G.; Huh, Y.C.; Sun, Z.Y.; Miguel, A.; King, S.R.; et al. Cucurbit grafting. Crit. Rev. Plant Sci. 2008, 27, 50–74. [Google Scholar] [CrossRef]
  12. King, S.R.; Davis, A.R.; Liu, W.G.; Levi, A. Grafting for disease resistance. Hortscience 2008, 43, 1673–1676. [Google Scholar] [CrossRef]
  13. Cohen, R.; Tyutyunik, J.; Fallik, E.; Oka, Y.; Tadmor, Y.; Edelstein, M. Phytopathological evaluation of exotic watermelon germplasm as a basis for rootstock breeding. Sci. Hortic. 2014, 165, 203–210. [Google Scholar] [CrossRef]
  14. Keinath, A.P.; Hassell, R.L. Control of Fusarium wilt of watermelon by grafting onto bottlegourd or interspecific hybrid squash despite colonization of rootstocks by Fusarium. Plant Dis. 2014, 98, 255–266. [Google Scholar] [CrossRef] [PubMed]
  15. Keinath, A.P.; Wechter, W.P.; Rutter, W.B.; Agudelo, P.A. Cucurbit rootstocks resistant to Fusarium oxysporum f. sp. niveum remain resistant when coinfected by Meloidogyne incognita in the Field. Plant Dis. 2019, 103, 1383–1390. [Google Scholar] [CrossRef]
  16. Mohamed, F.; El-Hamed, K.; Elwan, M.; Hussien, M.-A. Impact of grafting on watermelon growth, fruit yield and quality. J. Fruit Ornam. Plant Res. 2012, 76, 99–118. [Google Scholar] [CrossRef]
  17. Ryals, J.A.; Neuenschwander, U.H.; Willits, M.G.; Molina, A.; Steiner, H.Y.; Hunt, M.D. Systemic acquired resistance. Plant Cell 1996, 8, 1809–1819. [Google Scholar] [CrossRef]
  18. Chen, Y.C.; Kidd, B.N.; Carvalhais, L.C.; Schenk, P.M. Molecular defense responses in roots and the rhizosphere against Fusarium oxysporum. Plant Signal. Behav. 2014, 9, e977710. [Google Scholar] [CrossRef]
  19. Van Loon, L.C.; Bakker, P.A.; Pieterse, C.M. Systemic resistance induced by rhizosphere bacteria. Annu. Rev. Phytopathol. 1998, 36, 453–483. [Google Scholar] [CrossRef]
  20. Pieterse, C.M.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.; Bakker, P.A. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef] [Green Version]
  21. Di, X.T.; Takken, F.L.W.; Tintor, N. How phytohormones shape interactions between plants and the soil-borne fungus Fusarium oxysporum. Front. Plant Sci. 2016, 7, 170. [Google Scholar] [CrossRef] [PubMed]
  22. Zhu, F.; Wang, Z.; Fang, Y.; Tong, J.; Xiang, J.; Yang, K.; Wang, R. Study on the role of phytohormones in resistance to watermelon Fusarium wilt. Plants 2022, 11, 156. [Google Scholar] [CrossRef] [PubMed]
  23. Kasote, D.M.; Jayaprakasha, G.K.; Ong, K.; Crosby, K.M.; Patil, B.S. Hormonal and metabolites responses in Fusarium wilt-susceptible and -resistant watermelon plants during plant-pathogen interactions. BMC Plant Biol. 2020, 20, 481. [Google Scholar] [CrossRef]
  24. Fernandes, L.B.; Ghag, S.B. Molecular insights into the jasmonate signaling and associated defense responses against wilt caused by Fusarium oxysporum. Plant Physiol. Biochem. 2022, 174, 22–34. [Google Scholar] [CrossRef]
  25. Alvarez, B.; Biosca, E.G. Bacteriophage-based bacterial wilt biocontrol for an environmentally sustainable agriculture. Front. Plant Sci. 2017, 8, 1218. [Google Scholar] [CrossRef]
  26. Vurukonda, S.S.K.P.; Giovanardi, D.; Stefani, E. Plant growth promoting and biocontrol activity of Streptomyces spp. as endophytes. Int. J. Mol. Sci. 2018, 19, 952. [Google Scholar] [CrossRef] [PubMed]
  27. Bubici, G.; Kaushal, M.; Prigigallo, M.I.; Gomez-Lama Cabanas, C.; Mercado-Blanco, J. Biological control agents against Fusarium wilt of Banana. Front. Microbiol. 2019, 10, 616. [Google Scholar] [CrossRef]
  28. Zheng, Y.; Han, X.; Zhao, D.; Wei, K.; Yuan, Y.; Li, Y.; Liu, M.; Zhang, C.S. Exploring biocontrol agents from microbial keystone taxa associated to suppressive soil: A new attempt for a biocontrol strategy. Front. Plant Sci. 2021, 12, 655673. [Google Scholar] [CrossRef]
  29. Raaijmakers, J.M.; de Bruijn, I.; de Kock, M.J.D. Cyclic lipopeptide production by plant-associated Pseudomonas spp.: Diversity, activity, biosynthesis, and regulation. Mol. Plant-Microbe Interact. 2006, 19, 699–710. [Google Scholar] [CrossRef]
  30. Deketelaere, S.; Tyvaert, L.; Franca, S.C.; Hofte, M. Desirable traits of a good biocontrol agent against Verticillium wilt. Front. Microbiol. 2017, 8, 1186. [Google Scholar] [CrossRef] [Green Version]
  31. Kohl, J.; Kolnaar, R.; Ravensberg, W.J. Mode of action of microbial biological control agents against plant diseases: Relevance beyond efficacy. Front. Plant Sci. 2019, 10, 845. [Google Scholar] [CrossRef] [PubMed]
  32. Tziros, G.T.; Lagopodi, A.L.; Tzavella-Klonari, K. Reduction of Fusarium wilt in watermelon by Pseudomonas chlororaphis PCL1391 and P. fluorescens WCS365. Phytopathol. Mediterr. 2007, 46, 320–323. [Google Scholar]
  33. Martinez, F.D.; Santos, M.; Carretero, F.; Marin, F. Trichoderma saturnisporum, a new biological control agent. J. Sci. Food Agric. 2016, 96, 1934–1944. [Google Scholar] [CrossRef]
  34. Jiang, C.H.; Yao, X.F.; Mi, D.D.; Li, Z.J.; Yang, B.Y.; Zheng, Y.; Qi, Y.J.; Guo, J.H. Comparative transcriptome analysis reveals the biocontrol mechanism of Bacillus velezensis F21 against Fusarium wilt on watermelon. Front. Microbiol. 2019, 10, 652. [Google Scholar] [CrossRef]
  35. Hua, G.K.H.; Wang, L.; Chen, J.; Ji, P.S. Biological control of Fusarium wilt on watermelon by Fluorescent pseudomonads. Biocontrol Sci. Techn. 2020, 30, 212–227. [Google Scholar] [CrossRef]
  36. Yoshioka, Y.; Ichikawa, H.; Naznin, H.A.; Kogure, A.; Hyakumachi, M. Systemic resistance induced in Arabidopsis thaliana by Trichoderma asperellum SKT-1, a microbial pesticide of seedborne diseases of rice. Pest Manag. Sci. 2012, 68, 60–66. [Google Scholar] [CrossRef] [PubMed]
  37. Nawrocka, J.; Malolepsza, U. Diversity in plant systemic resistance induced by Trichoderma. Biol. Control 2013, 67, 149–156. [Google Scholar] [CrossRef]
  38. Angelopoulou, D.J.; Naska, E.J.; Paplomatas, E.J.; Tjamos, S.E. Biological control agents (BCAs) of Verticillium wilt: Influence of application rates and delivery method on plant protection, triggering of host defence mechanisms and rhizosphere populations of BCAs. Plant Pathol. 2014, 63, 1062–1069. [Google Scholar] [CrossRef]
  39. Jiao, X.R.; Takishita, Y.; Zhou, G.S.; Smith, D.L. Plant associated rhizobacteria for biocontrol and plant growth enhancement. Front. Plant Sci. 2021, 12, 634796. [Google Scholar] [CrossRef]
  40. Ku, Y.S.; Sintaha, M.; Cheung, M.Y.; Lam, H.M. Plant Hormone Signaling Crosstalks between Biotic and Abiotic Stress Responses. Int. J. Mol. Sci. 2018, 19, 3206. [Google Scholar] [CrossRef]
  41. Vlot, A.C.; Sales, J.H.; Lenk, M.; Bauer, K.; Brambilla, A.; Sommer, A.; Chen, Y.Y.; Wenig, M.; Nayem, S. Systemic propagation of immunity in plants. New Phytol. 2021, 229, 1234–1250. [Google Scholar] [CrossRef] [PubMed]
  42. Alabouvette, C.; Couteaudier, Y.; Lemanceau, P. Nature of intrageneric competition between pathogenic and non-pathogenic Fusarium in a wilt-suppressive soil. In Iron, Siderophores, and Plant Diseases; Springer: Berlin/Heidelberg, Germany, 1986; pp. 165–178. [Google Scholar] [CrossRef]
  43. Veloso, J.; Díaz, J. Fusarium oxysporum Fo47 confers protection to pepper plants against Verticillium dahliae and Phytophthora capsici, and induces the expression of defence genes. Plant Pathol. 2012, 61, 281–288. [Google Scholar] [CrossRef]
  44. Aimé, S.; Alabouvette, C.; Steinberg, C.; Olivain, C. The endophytic strain Fusarium oxysporum Fo47: A good candidate for priming the defense responses in tomato roots. Mol. Plant-Microbe Interact. 2013, 26, 918–926. [Google Scholar] [CrossRef] [PubMed]
  45. Veloso, J.; Alabouvette, C.; Olivain, C.; Flors, V.; Pastor, V.; García, T.; Díaz, J. Modes of action of the protective strain Fo47 in controlling Verticillium wilt of pepper. Plant Pathol. 2016, 65, 997–1007. [Google Scholar] [CrossRef]
  46. Constantin, M.E.; Vlieger, B.V.; Takken, F.L.W.; Rep, M. Diminished pathogen and enhanced endophyte colonization upon coInoculation of endophytic and pathogenic Fusarium strains. Microorganisms 2020, 8, 544. [Google Scholar] [CrossRef]
  47. De Lamo, F.J.; Spijkers, S.B.; Takken, F.L.W. Protection to Tomato wilt disease conferred by the nonpathogen Fusarium oxysporum Fo47 is more effective than that conferred by avirulent strains. Phytopathology 2021, 111, 253–257. [Google Scholar] [CrossRef]
  48. Chunling, L.; Zhaoyi, S.; Zhaofeng, Z. The improvement of Fusarium oxysporum Fo47 by protoplast fusion. J. Northwest A F Univ. Nat. Sci. Ed. 2010, 38, 126–130. (In Chinese) [Google Scholar] [CrossRef]
  49. Kong, Q.S.; Yuan, J.X.; Niu, P.H.; Xie, J.J.; Jiang, W.; Huang, Y.; Bie, Z.L. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in Melon. PLoS ONE 2014, 9, 1. [Google Scholar] [CrossRef]
  50. Pu, X.M.; Xie, B.Y.; Li, P.Q.; Mao, Z.C.; Ling, J.; Shen, H.F.; Zhang, J.X.; Huang, N.; Lin, B.R. Analysis of the defence-related mechanism in cucumber seedlings in relation to root colonization by nonpathogenic Fusarium oxysporum CS-20. FEMS Microbiol. Lett. 2014, 355, 142–151. [Google Scholar] [CrossRef]
  51. Jorrin-Novo, J.V. Plant proteomics methods and protocols. Methods Mol. Biol. 2014, 1072, 3–13. [Google Scholar] [CrossRef]
  52. Wisniewski, J.R.; Zougman, A.; Nagaraj, N.; Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 2009, 6, 359–362. [Google Scholar] [CrossRef] [PubMed]
  53. Colaert, N.; Barsnes, H.; Vaudel, M.; Helsens, K.; Timmerman, E.; Sickmann, A.; Gevaert, K.; Martens, L. Thermo-msf-parser: An open source Java library to parse and visualize Thermo Proteome Discoverer msf files. J. Proteome Res. 2011, 10, 3840–3843. [Google Scholar] [CrossRef] [PubMed]
  54. Gotz, S.; Garcia-Gomez, J.M.; Terol, J.; Williams, T.D.; Nagaraj, S.H.; Nueda, M.J.; Robles, M.; Talon, M.; Dopazo, J.; Conesa, A. High-throughput functional annotation and data mining with the Blast2GO suite. Nucleic Acids Res. 2008, 36, 3420–3435. [Google Scholar] [CrossRef]
  55. Quevillon, E.; Silventoinen, V.; Pillai, S.; Harte, N.; Mulder, N.; Apweiler, R.; Lopez, R. InterProScan: Protein domains identifier. Nucleic Acids Res. 2005, 33, W116–W120. [Google Scholar] [CrossRef] [PubMed]
  56. Kanehisa, M.; Goto, S.; Sato, Y.; Furumichi, M.; Tanabe, M. KEGG for integration and interpretation of large-scale molecular data sets. Nucleic Acids Res. 2012, 40, D109–D114. [Google Scholar] [CrossRef] [PubMed]
  57. Guo, S.; Zhang, J.; Sun, H.; Salse, J.; Lucas, W.J.; Zhang, H.; Zheng, Y.; Mao, L.; Ren, Y.; Wang, Z.; et al. The draft genome of watermelon (Citrullus lanatus) and resequencing of 20 diverse accessions. Nat. Genet. 2013, 45, 51–58. [Google Scholar] [CrossRef]
  58. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  59. Moriya, Y.; Itoh, M.; Okuda, S.; Yoshizawa, A.C.; Kanehisa, M. KAAS: An automatic genome annotation and pathway reconstruction server. Nucleic Acids Res. 2007, 35, W182–W185. [Google Scholar] [CrossRef]
  60. Berrocal-Lobo, M.; Molina, A. Arabidopsis defense response against Fusarium oxysporum. Trends Plant Sci. 2008, 13, 145–150. [Google Scholar] [CrossRef]
  61. Whipps, J.M. Microbial interactions and biocontrol in the rhizosphere. J. Exp. Bot. 2001, 52, 487–511. [Google Scholar] [CrossRef]
  62. Wang, L.Y.; Xie, Y.S.; Cui, Y.Y.; Xu, J.; He, W.; Chen, H.G.; Guo, J.H. Conjunctively screening of biocontrol agents (BCAs) against Fusarium root rot and Fusarium head blight caused by Fusarium graminearum. Microbiol. Res. 2015, 177, 34–42. [Google Scholar] [CrossRef] [PubMed]
  63. Pellan, L.; Dieye, C.A.T.; Durand, N.; Fontana, A.; Strub, C.; Schorr-Galindo, S. Biocontrol agents: Toolbox for the screening of weapons against Mycotoxigenic Fusarium. J. Fungi 2021, 7, 446. [Google Scholar] [CrossRef] [PubMed]
  64. Chen, J.; Hu, L.; Chen, N.; Jia, R.; Ma, Q.; Wang, Y. The biocontrol and plant growth-promoting properties of Streptomyces alfalfae XN-04 revealed by functional and genomic analysis. Front. Microbiol. 2021, 12, 745766. [Google Scholar] [CrossRef] [PubMed]
  65. Thatcher, L.F.; Manners, J.M.; Kazan, K. Fusarium oxysporum hijacks COI1-mediated jasmonate signaling to promote disease development in Arabidopsis. Plant J. 2009, 58, 927–939. [Google Scholar] [CrossRef]
  66. Xu, W.; Wang, Z.; Wu, F. Companion cropping with wheat increases resistance to Fusarium wilt in watermelon and the roles of root exudates in watermelon root growth. Physiol. Mol. Plant Pathol. 2015, 90, 12–20. [Google Scholar] [CrossRef]
  67. Anderson, J.P.; Badruzsaufari, E.; Schenk, P.M.; Manners, J.M.; Desmond, O.J.; Ehlert, C.; Maclean, D.J.; Ebert, P.R.; Kazan, K. Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 2004, 16, 3460–3479. [Google Scholar] [CrossRef]
  68. Kidd, B.N.; Edgar, C.I.; Kumar, K.K.; Aitken, E.A.; Schenk, P.M.; Manners, J.M.; Kazan, K. The mediator complex subunit PFT1 is a key regulator of jasmonate-dependent defense in Arabidopsis. Plant Cell 2009, 21, 2237–2252. [Google Scholar] [CrossRef]
  69. Cole, S.J.; Yoon, A.J.; Faull, K.F.; Diener, A.C. Host perception of jasmonates promotes infection by Fusarium oxysporum formae speciales that produce isoleucine- and leucine-conjugated jasmonates. Mol. Plant Pathol. 2014, 15, 589–600. [Google Scholar] [CrossRef]
  70. Compant, S.; Duffy, B.; Nowak, J.; Clement, C.; Barka, E.A. Use of plant growth-promoting bacteria for biocontrol of plant diseases: Principles, mechanisms of action, and future prospects. Appl. Environ. Microbiol. 2005, 71, 4951–4959. [Google Scholar] [CrossRef]
  71. Samaras, A.; Roumeliotis, E.; Ntasiou, P.; Karaoglanidis, G. Bacillus subtilis MBI600 promotes growth of tomato plants and induces systemic resistance contributing to the control of soilborne pathogens. Plants 2021, 10, 1113. [Google Scholar] [CrossRef]
  72. Chaumont, F.; Moshelion, M.; Daniels, M.J. Regulation of plant aquaporin activity. Biol. Cell 2005, 97, 749–764. [Google Scholar] [CrossRef] [PubMed]
  73. Nanasato, Y.; Akashi, K.; Yokota, A. Co-expression of cytochrome b(561) and ascorbate oxidase in leaves of wild watermelon under drought and high light conditions. Plant Cell Physiol. 2005, 46, 1515–1524. [Google Scholar] [CrossRef] [PubMed]
  74. Milc, J.; Infantino, A.; Pecchioni, N.; Aragona, M. Identification of tomato genes differentially expressed during compatible interaction with Pyrenochaeta lycopersici. J. Plant Pathol. 2012, 94, 283–296. [Google Scholar]
  75. Alvarez-Florez, F.; Lopez-Cristoffanini, C.; Jauregui, O.; Melgarejo, L.M.; Lopez-Carbonell, M. Changes in ABA, IAA and JA levels during calyx, fruit and leaves development in cape gooseberry plants (Physalis peruviana L.). Plant Physiol. Biochem. 2017, 115, 174–182. [Google Scholar] [CrossRef] [PubMed]
  76. Shigenaga, A.M.; Argueso, C.T. No hormone to rule them all: Interactions of plant hormones during the responses of plants to pathogens. Semin. Cell Dev. Biol. 2016, 56, 174–189. [Google Scholar] [CrossRef] [PubMed]
  77. Li, N.; Han, X.; Feng, D.; Yuan, D.Y.; Huang, L.J. Signaling crosstalk between Salicylic Acid and Ethylene/Jasmonate in plant defense: Do we understand what they are whispering? Int. J. Mol. Sci. 2019, 20, 671. [Google Scholar] [CrossRef]
  78. Sembdner, G.; Parthier, B. The biochemistry and the physiological and molecular actions of jasmonates. Annu. Rev. Plant Phys. 1993, 44, 569–589. [Google Scholar] [CrossRef]
  79. Kawamura, Y.; Takenaka, S.; Hase, S.; Kubota, M.; Ichinose, Y.; Kanayama, Y.; Nakaho, K.; Klessig, D.F.; Takahashi, H. Enhanced defense responses in Arabidopsis induced by the cell wall protein fractions from Pythium oligandrum require SGT1, RAR1, NPR1 and JAR1. Plant Cell Physiol. 2009, 50, 924–934. [Google Scholar] [CrossRef]
  80. Liu, Q.; Xu, C.; Wen, C.K. Genetic and transformation studies reveal negative regulation of ERS1 ethylene receptor signaling in Arabidopsis. BMC Plant Biol. 2010, 10, 60. [Google Scholar] [CrossRef] [Green Version]
Microorganisms 10 01710 g001 550
Figure 1. Distribution of differentially expressed proteins. (a): The up-regulated expression in watermelon response to F1-35 at 12, 24, and 48 hpi. (b): The down-regulated expression in watermelon response to F1-35 at 12, 24, and 48 hpi. T1: CK treatment at 12 hpi; T2: CK treatment at 24 hpi; T3: CK treatment at 48 hpi.
Figure 1. Distribution of differentially expressed proteins. (a): The up-regulated expression in watermelon response to F1-35 at 12, 24, and 48 hpi. (b): The down-regulated expression in watermelon response to F1-35 at 12, 24, and 48 hpi. T1: CK treatment at 12 hpi; T2: CK treatment at 24 hpi; T3: CK treatment at 48 hpi.
Microorganisms 10 01710 g001
Microorganisms 10 01710 g002a 550Microorganisms 10 01710 g002b 550
Figure 2. Gene ontology annotation. (a): CK treatment at 12 hpi; (b): CK treatment at 24 hpi; (c): CK treatment at 48 hpi. BP: biological process; MF: molecular function; CC: cellular component.
Figure 2. Gene ontology annotation. (a): CK treatment at 12 hpi; (b): CK treatment at 24 hpi; (c): CK treatment at 48 hpi. BP: biological process; MF: molecular function; CC: cellular component.
Microorganisms 10 01710 g002aMicroorganisms 10 01710 g002b
Microorganisms 10 01710 g003 550
Figure 3. KEGG annotation. T1 is CK treatment at 12 hpi; T2 is CK treatment at 24 hpi; and T3 is CK treatment at 48 hpi.
Figure 3. KEGG annotation. T1 is CK treatment at 12 hpi; T2 is CK treatment at 24 hpi; and T3 is CK treatment at 48 hpi.
Microorganisms 10 01710 g003
Microorganisms 10 01710 g004 550
Figure 4. A summary of the mechanism of F1-35 protection of watermelons against FON.
Figure 4. A summary of the mechanism of F1-35 protection of watermelons against FON.
Microorganisms 10 01710 g004
Microorganisms 10 01710 g005 550
Figure 5. Target gene expression level in the roots, stems, or leaves of plants treated with F1-35 or FON.
Figure 5. Target gene expression level in the roots, stems, or leaves of plants treated with F1-35 or FON.
Microorganisms 10 01710 g005
Table
Table 1. Control efficiency of F1-35 on watermelon Fusarium wilt.
Table 1. Control efficiency of F1-35 on watermelon Fusarium wilt.
TreatmentDisease Index (%)Control Efficiency (%)
FON58.46 ± 4.48-
F1-35 and FON22.39 ± 5.0161.7 ± 3.79
Table
Table 2. Function analysis of differentially expressed proteins.
Table 2. Function analysis of differentially expressed proteins.
12 hpi /CK24 hpi /CK48 hpi /CK
UpFunctionDownFunctionUpFunctionDownFunctionUpFunctionDownFunction
Q6I673Drought stressA0A0A0LG20Drought stressV5LF72Broad-spectrum
resistance		D1MWZ6ArpQ6I673Broad-spectrum resistanceE7CEW6WRKY17
A3F570Drought stressD1MWZ6Drought stressA0A097BU00Alcohol
dehydrogenase		A0A0A0L4M8SusceptibilityA0A0A0LVN5Alcohol
dehydrogenase		A0A0A0L4M8Susceptibility
P0DI61Soil stressA0A0A0L4M8Soil stressQ6I673Drought stress A0A0A0LD49Drought stressA0A0A0LT35Susceptibility
A0A0A0LWG8Related to JA D1MWZ6Arp
A0A1D8RFV5PR5 A0A0A0LW64Negative
correlation
to heat shock
A0A0A0LW70Physiological stress
A0A0A0K1Y0Ca
H6TB43Osmotic stress
A0A0A0KGB3Related to JA
A5X4I4glycerol 3-phosphate degradation
A0A0A0KBB7Precursors of JA
Table
Table 3. The primers for qRT-PCR.
Table 3. The primers for qRT-PCR.
Gene NameGene IDPrimersProduction Size (bp)Amplification Efficiency %R2
β-actinMU51303FCCTGGTATCGCTGACCGTAT13396.7
RTACTGAGCGATGCAAGGATG
PALCla018297FTGCTATGGCTTCCTATT141114.350.9912
RATGTCAATGGCTTCTTC
LOX1Cla019905FAATGCTTGCTGGAGTGA12199.250.9946
RTGCTATGTGTTCTTCTGTTATG
CTR1Cla017731FGAAGTTGCTGTGAAGAT10096.280.9656
RTAGGATGTCGTAAGGATT
Note: beta-actin data taken from Kong et al. [49].
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Dong, X.-M.; Lian, Q.-G.; Chen, J.; Jia, R.-M.; Zong, Z.-F.; Ma, Q.; Wang, Y. The Improved Biocontrol Agent, F1-35, Protects Watermelon against Fusarium Wilt by Triggering Jasmonic Acid and Ethylene Pathways. Microorganisms 2022, 10, 1710. https://doi.org/10.3390/microorganisms10091710

AMA Style

Dong X-M, Lian Q-G, Chen J, Jia R-M, Zong Z-F, Ma Q, Wang Y. The Improved Biocontrol Agent, F1-35, Protects Watermelon against Fusarium Wilt by Triggering Jasmonic Acid and Ethylene Pathways. Microorganisms. 2022; 10(9):1710. https://doi.org/10.3390/microorganisms10091710

Chicago/Turabian Style

Dong, Xiao-Min, Qing-Gui Lian, Jing Chen, Rui-Min Jia, Zhao-Feng Zong, Qing Ma, and Yang Wang. 2022. "The Improved Biocontrol Agent, F1-35, Protects Watermelon against Fusarium Wilt by Triggering Jasmonic Acid and Ethylene Pathways" Microorganisms 10, no. 9: 1710. https://doi.org/10.3390/microorganisms10091710

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop