The Improved Biocontrol Agent, F1-35, Protects Watermelon against Fusarium Wilt by Triggering Jasmonic Acid and Ethylene Pathways
Abstract
:1. Introduction
2. Materials and Methods
2.1. Pathogenic Fungus, Biocontrol Agent F1-35, and Plant Materials
2.2. Inoculum Preparation and Plant Inoculation
2.3. Control Efficiency Test
2.4. Pairing Assay
2.5. Proteomic Analysis
2.5.1. Proteome Extraction and iTRAQ Labeling
2.5.2. Peptide Fractionation with Strong Cation Exchange (SCX) Chromatography
2.5.3. LC-MS/MS Analysis
2.5.4. MS Data Analysis
2.5.5. Analysis of Differentially Expressed Proteins
2.6. qRT-PCR Analysis
2.6.1. Screening of Candidate Reference Genes and Primer Design
2.6.2. Total RNA Extraction and cDNA Synthesis
2.6.3. Quantitative Determination and Statistical Analysis
2.7. Data Analysis
2.8. MS/MS Data Submission
3. Results
3.1. The Control Efficiency of F1-35 against Watermelon Fusarium Wilt
3.2. Pairing Assay
3.3. Influence of the Root Proteome Expressed after F1-35 Inoculation
3.4. Identification and Functional Classification of Differentially Expressed Proteins
3.5. qRT-PCR Analysis
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ren, Y.; Jiao, D.; Gong, G.Y.; Zhang, H.Y.; Guo, S.G.; Zhang, J.; Xu, Y. Genetic analysis and chromosome mapping of resistance to Fusarium oxysporum f. sp. niveum (FON) race 1 and race 2 in watermelon (Citrullus lanatus L.). Mol. Breed. 2015, 35, 9. [Google Scholar] [CrossRef] [PubMed]
- Hudson, O.; Fulton, J.C.; Dong, A.K.; Dufault, N.S.; Ali, M.E. Fusarium oxysporum f. sp. niveum molecular diagnostics past, present and future. Int. J. Mol. Sci. 2021, 22, 9735. [Google Scholar] [CrossRef]
- Massaccesi, G.; Romero, M.C.; Cazau, M.C.; Bucsinszky, A.M. Cadmium removal capacities of filamentous soil fungi isolated from industrially polluted sediments, in La Plata (Argentina). World J. Microbiol. Biot. 2002, 18, 817–820. [Google Scholar] [CrossRef]
- Mandeel, Q.A. Biodiversity of the genus Fusarium in saline soil habitats. J. Basic Microbiol. 2006, 46, 480–494. [Google Scholar] [CrossRef] [PubMed]
- Ortega-Larrocea, M.D.; Xoconostle-Cazares, B.; Maldonado-Mendoza, I.E.; Carrillo-Gonzalez, R.; Hernandez-Hernandez, J.; Garduno, M.D.; Lopez-Meyer, M.; Gomez-Flores, L.; Gonzalez-Chavez, M.D.A. Plant and fungal biodiversity from metal mine wastes under remediation at Zimapan, Hidalgo, Mexico. Environ. Pollut. 2010, 158, 1922–1931. [Google Scholar] [CrossRef] [PubMed]
- Babic, M.N.; Zalar, L.; Zenko, B.; Schroers, H.J.; Deroski, S.; Gunde-Cimerman, N. Candida and Fusarium species known as opportunistic human pathogens from customer-accessible parts of residential washing machines. Fungal Biol. 2015, 119, 95–113. [Google Scholar] [CrossRef]
- Rahman, M.Z.; Ahmad, K.; Siddiqui, Y.; Saad, N.; Hun, T.G.; Mohd Hata, E.; Rashed, O.; Hossain, M.I.; Kutawa, A.B. First report of Fusarium wilt disease on watermelon caused by Fusarium oxysporum f. sp. niveum (FON) in Malaysia. Plant Dis. 2021, 105, 4169. [Google Scholar] [CrossRef]
- Everts, K.L.; Himmelstein, J.C. Fusarium wilt of watermelon: Towards sustainable management of a re-emerging plant disease. Crop Prot. 2015, 73, 93–99. [Google Scholar] [CrossRef]
- Zhang, X.; Xue, C.; Fang, D.; He, X.H.; Wei, M.Y.; Zhuo, C.J.; Jin, J.Y.; Shen, B.A.; Li, R.; Ling, N.; et al. Manipulating the soil microbiomes during a community recovery process with plant beneficial species for the suppression of Fusarium wilt of watermelon. Amb. Express. 2021, 11, 1. [Google Scholar] [CrossRef]
- Sande, D.; Mullen, J.; Wetzstein, M.; Houston, J. Environmental Impacts from Pesticide Use: A case study of Soil fumigation in Florida tomato production. Int. J. Environ. Res. Public Health 2011, 8, 4649–4661. [Google Scholar] [CrossRef]
- Davis, A.R.; Perkins-Veazie, P.; Sakata, Y.; Lopez-Galarza, S.; Maroto, J.V.; Lee, S.G.; Huh, Y.C.; Sun, Z.Y.; Miguel, A.; King, S.R.; et al. Cucurbit grafting. Crit. Rev. Plant Sci. 2008, 27, 50–74. [Google Scholar] [CrossRef]
- King, S.R.; Davis, A.R.; Liu, W.G.; Levi, A. Grafting for disease resistance. Hortscience 2008, 43, 1673–1676. [Google Scholar] [CrossRef]
- Cohen, R.; Tyutyunik, J.; Fallik, E.; Oka, Y.; Tadmor, Y.; Edelstein, M. Phytopathological evaluation of exotic watermelon germplasm as a basis for rootstock breeding. Sci. Hortic. 2014, 165, 203–210. [Google Scholar] [CrossRef]
- Keinath, A.P.; Hassell, R.L. Control of Fusarium wilt of watermelon by grafting onto bottlegourd or interspecific hybrid squash despite colonization of rootstocks by Fusarium. Plant Dis. 2014, 98, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Keinath, A.P.; Wechter, W.P.; Rutter, W.B.; Agudelo, P.A. Cucurbit rootstocks resistant to Fusarium oxysporum f. sp. niveum remain resistant when coinfected by Meloidogyne incognita in the Field. Plant Dis. 2019, 103, 1383–1390. [Google Scholar] [CrossRef]
- Mohamed, F.; El-Hamed, K.; Elwan, M.; Hussien, M.-A. Impact of grafting on watermelon growth, fruit yield and quality. J. Fruit Ornam. Plant Res. 2012, 76, 99–118. [Google Scholar] [CrossRef]
- Ryals, J.A.; Neuenschwander, U.H.; Willits, M.G.; Molina, A.; Steiner, H.Y.; Hunt, M.D. Systemic acquired resistance. Plant Cell 1996, 8, 1809–1819. [Google Scholar] [CrossRef]
- Chen, Y.C.; Kidd, B.N.; Carvalhais, L.C.; Schenk, P.M. Molecular defense responses in roots and the rhizosphere against Fusarium oxysporum. Plant Signal. Behav. 2014, 9, e977710. [Google Scholar] [CrossRef]
- Van Loon, L.C.; Bakker, P.A.; Pieterse, C.M. Systemic resistance induced by rhizosphere bacteria. Annu. Rev. Phytopathol. 1998, 36, 453–483. [Google Scholar] [CrossRef]
- Pieterse, C.M.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.; Bakker, P.A. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef] [Green Version]
- Di, X.T.; Takken, F.L.W.; Tintor, N. How phytohormones shape interactions between plants and the soil-borne fungus Fusarium oxysporum. Front. Plant Sci. 2016, 7, 170. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Wang, Z.; Fang, Y.; Tong, J.; Xiang, J.; Yang, K.; Wang, R. Study on the role of phytohormones in resistance to watermelon Fusarium wilt. Plants 2022, 11, 156. [Google Scholar] [CrossRef] [PubMed]
- Kasote, D.M.; Jayaprakasha, G.K.; Ong, K.; Crosby, K.M.; Patil, B.S. Hormonal and metabolites responses in Fusarium wilt-susceptible and -resistant watermelon plants during plant-pathogen interactions. BMC Plant Biol. 2020, 20, 481. [Google Scholar] [CrossRef]
- Fernandes, L.B.; Ghag, S.B. Molecular insights into the jasmonate signaling and associated defense responses against wilt caused by Fusarium oxysporum. Plant Physiol. Biochem. 2022, 174, 22–34. [Google Scholar] [CrossRef]
- Alvarez, B.; Biosca, E.G. Bacteriophage-based bacterial wilt biocontrol for an environmentally sustainable agriculture. Front. Plant Sci. 2017, 8, 1218. [Google Scholar] [CrossRef]
- Vurukonda, S.S.K.P.; Giovanardi, D.; Stefani, E. Plant growth promoting and biocontrol activity of Streptomyces spp. as endophytes. Int. J. Mol. Sci. 2018, 19, 952. [Google Scholar] [CrossRef] [PubMed]
- Bubici, G.; Kaushal, M.; Prigigallo, M.I.; Gomez-Lama Cabanas, C.; Mercado-Blanco, J. Biological control agents against Fusarium wilt of Banana. Front. Microbiol. 2019, 10, 616. [Google Scholar] [CrossRef]
- Zheng, Y.; Han, X.; Zhao, D.; Wei, K.; Yuan, Y.; Li, Y.; Liu, M.; Zhang, C.S. Exploring biocontrol agents from microbial keystone taxa associated to suppressive soil: A new attempt for a biocontrol strategy. Front. Plant Sci. 2021, 12, 655673. [Google Scholar] [CrossRef]
- Raaijmakers, J.M.; de Bruijn, I.; de Kock, M.J.D. Cyclic lipopeptide production by plant-associated Pseudomonas spp.: Diversity, activity, biosynthesis, and regulation. Mol. Plant-Microbe Interact. 2006, 19, 699–710. [Google Scholar] [CrossRef]
- Deketelaere, S.; Tyvaert, L.; Franca, S.C.; Hofte, M. Desirable traits of a good biocontrol agent against Verticillium wilt. Front. Microbiol. 2017, 8, 1186. [Google Scholar] [CrossRef] [Green Version]
- Kohl, J.; Kolnaar, R.; Ravensberg, W.J. Mode of action of microbial biological control agents against plant diseases: Relevance beyond efficacy. Front. Plant Sci. 2019, 10, 845. [Google Scholar] [CrossRef] [PubMed]
- Tziros, G.T.; Lagopodi, A.L.; Tzavella-Klonari, K. Reduction of Fusarium wilt in watermelon by Pseudomonas chlororaphis PCL1391 and P. fluorescens WCS365. Phytopathol. Mediterr. 2007, 46, 320–323. [Google Scholar]
- Martinez, F.D.; Santos, M.; Carretero, F.; Marin, F. Trichoderma saturnisporum, a new biological control agent. J. Sci. Food Agric. 2016, 96, 1934–1944. [Google Scholar] [CrossRef]
- Jiang, C.H.; Yao, X.F.; Mi, D.D.; Li, Z.J.; Yang, B.Y.; Zheng, Y.; Qi, Y.J.; Guo, J.H. Comparative transcriptome analysis reveals the biocontrol mechanism of Bacillus velezensis F21 against Fusarium wilt on watermelon. Front. Microbiol. 2019, 10, 652. [Google Scholar] [CrossRef]
- Hua, G.K.H.; Wang, L.; Chen, J.; Ji, P.S. Biological control of Fusarium wilt on watermelon by Fluorescent pseudomonads. Biocontrol Sci. Techn. 2020, 30, 212–227. [Google Scholar] [CrossRef]
- Yoshioka, Y.; Ichikawa, H.; Naznin, H.A.; Kogure, A.; Hyakumachi, M. Systemic resistance induced in Arabidopsis thaliana by Trichoderma asperellum SKT-1, a microbial pesticide of seedborne diseases of rice. Pest Manag. Sci. 2012, 68, 60–66. [Google Scholar] [CrossRef] [PubMed]
- Nawrocka, J.; Malolepsza, U. Diversity in plant systemic resistance induced by Trichoderma. Biol. Control 2013, 67, 149–156. [Google Scholar] [CrossRef]
- Angelopoulou, D.J.; Naska, E.J.; Paplomatas, E.J.; Tjamos, S.E. Biological control agents (BCAs) of Verticillium wilt: Influence of application rates and delivery method on plant protection, triggering of host defence mechanisms and rhizosphere populations of BCAs. Plant Pathol. 2014, 63, 1062–1069. [Google Scholar] [CrossRef]
- Jiao, X.R.; Takishita, Y.; Zhou, G.S.; Smith, D.L. Plant associated rhizobacteria for biocontrol and plant growth enhancement. Front. Plant Sci. 2021, 12, 634796. [Google Scholar] [CrossRef]
- Ku, Y.S.; Sintaha, M.; Cheung, M.Y.; Lam, H.M. Plant Hormone Signaling Crosstalks between Biotic and Abiotic Stress Responses. Int. J. Mol. Sci. 2018, 19, 3206. [Google Scholar] [CrossRef]
- Vlot, A.C.; Sales, J.H.; Lenk, M.; Bauer, K.; Brambilla, A.; Sommer, A.; Chen, Y.Y.; Wenig, M.; Nayem, S. Systemic propagation of immunity in plants. New Phytol. 2021, 229, 1234–1250. [Google Scholar] [CrossRef] [PubMed]
- Alabouvette, C.; Couteaudier, Y.; Lemanceau, P. Nature of intrageneric competition between pathogenic and non-pathogenic Fusarium in a wilt-suppressive soil. In Iron, Siderophores, and Plant Diseases; Springer: Berlin/Heidelberg, Germany, 1986; pp. 165–178. [Google Scholar] [CrossRef]
- Veloso, J.; Díaz, J. Fusarium oxysporum Fo47 confers protection to pepper plants against Verticillium dahliae and Phytophthora capsici, and induces the expression of defence genes. Plant Pathol. 2012, 61, 281–288. [Google Scholar] [CrossRef]
- Aimé, S.; Alabouvette, C.; Steinberg, C.; Olivain, C. The endophytic strain Fusarium oxysporum Fo47: A good candidate for priming the defense responses in tomato roots. Mol. Plant-Microbe Interact. 2013, 26, 918–926. [Google Scholar] [CrossRef] [PubMed]
- Veloso, J.; Alabouvette, C.; Olivain, C.; Flors, V.; Pastor, V.; García, T.; Díaz, J. Modes of action of the protective strain Fo47 in controlling Verticillium wilt of pepper. Plant Pathol. 2016, 65, 997–1007. [Google Scholar] [CrossRef]
- Constantin, M.E.; Vlieger, B.V.; Takken, F.L.W.; Rep, M. Diminished pathogen and enhanced endophyte colonization upon coInoculation of endophytic and pathogenic Fusarium strains. Microorganisms 2020, 8, 544. [Google Scholar] [CrossRef]
- De Lamo, F.J.; Spijkers, S.B.; Takken, F.L.W. Protection to Tomato wilt disease conferred by the nonpathogen Fusarium oxysporum Fo47 is more effective than that conferred by avirulent strains. Phytopathology 2021, 111, 253–257. [Google Scholar] [CrossRef]
- Chunling, L.; Zhaoyi, S.; Zhaofeng, Z. The improvement of Fusarium oxysporum Fo47 by protoplast fusion. J. Northwest A F Univ. Nat. Sci. Ed. 2010, 38, 126–130. (In Chinese) [Google Scholar] [CrossRef]
- Kong, Q.S.; Yuan, J.X.; Niu, P.H.; Xie, J.J.; Jiang, W.; Huang, Y.; Bie, Z.L. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in Melon. PLoS ONE 2014, 9, 1. [Google Scholar] [CrossRef]
- Pu, X.M.; Xie, B.Y.; Li, P.Q.; Mao, Z.C.; Ling, J.; Shen, H.F.; Zhang, J.X.; Huang, N.; Lin, B.R. Analysis of the defence-related mechanism in cucumber seedlings in relation to root colonization by nonpathogenic Fusarium oxysporum CS-20. FEMS Microbiol. Lett. 2014, 355, 142–151. [Google Scholar] [CrossRef]
- Jorrin-Novo, J.V. Plant proteomics methods and protocols. Methods Mol. Biol. 2014, 1072, 3–13. [Google Scholar] [CrossRef]
- Wisniewski, J.R.; Zougman, A.; Nagaraj, N.; Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 2009, 6, 359–362. [Google Scholar] [CrossRef] [PubMed]
- Colaert, N.; Barsnes, H.; Vaudel, M.; Helsens, K.; Timmerman, E.; Sickmann, A.; Gevaert, K.; Martens, L. Thermo-msf-parser: An open source Java library to parse and visualize Thermo Proteome Discoverer msf files. J. Proteome Res. 2011, 10, 3840–3843. [Google Scholar] [CrossRef] [PubMed]
- Gotz, S.; Garcia-Gomez, J.M.; Terol, J.; Williams, T.D.; Nagaraj, S.H.; Nueda, M.J.; Robles, M.; Talon, M.; Dopazo, J.; Conesa, A. High-throughput functional annotation and data mining with the Blast2GO suite. Nucleic Acids Res. 2008, 36, 3420–3435. [Google Scholar] [CrossRef]
- Quevillon, E.; Silventoinen, V.; Pillai, S.; Harte, N.; Mulder, N.; Apweiler, R.; Lopez, R. InterProScan: Protein domains identifier. Nucleic Acids Res. 2005, 33, W116–W120. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Goto, S.; Sato, Y.; Furumichi, M.; Tanabe, M. KEGG for integration and interpretation of large-scale molecular data sets. Nucleic Acids Res. 2012, 40, D109–D114. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Zhang, J.; Sun, H.; Salse, J.; Lucas, W.J.; Zhang, H.; Zheng, Y.; Mao, L.; Ren, Y.; Wang, Z.; et al. The draft genome of watermelon (Citrullus lanatus) and resequencing of 20 diverse accessions. Nat. Genet. 2013, 45, 51–58. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Moriya, Y.; Itoh, M.; Okuda, S.; Yoshizawa, A.C.; Kanehisa, M. KAAS: An automatic genome annotation and pathway reconstruction server. Nucleic Acids Res. 2007, 35, W182–W185. [Google Scholar] [CrossRef]
- Berrocal-Lobo, M.; Molina, A. Arabidopsis defense response against Fusarium oxysporum. Trends Plant Sci. 2008, 13, 145–150. [Google Scholar] [CrossRef]
- Whipps, J.M. Microbial interactions and biocontrol in the rhizosphere. J. Exp. Bot. 2001, 52, 487–511. [Google Scholar] [CrossRef]
- Wang, L.Y.; Xie, Y.S.; Cui, Y.Y.; Xu, J.; He, W.; Chen, H.G.; Guo, J.H. Conjunctively screening of biocontrol agents (BCAs) against Fusarium root rot and Fusarium head blight caused by Fusarium graminearum. Microbiol. Res. 2015, 177, 34–42. [Google Scholar] [CrossRef] [PubMed]
- Pellan, L.; Dieye, C.A.T.; Durand, N.; Fontana, A.; Strub, C.; Schorr-Galindo, S. Biocontrol agents: Toolbox for the screening of weapons against Mycotoxigenic Fusarium. J. Fungi 2021, 7, 446. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Hu, L.; Chen, N.; Jia, R.; Ma, Q.; Wang, Y. The biocontrol and plant growth-promoting properties of Streptomyces alfalfae XN-04 revealed by functional and genomic analysis. Front. Microbiol. 2021, 12, 745766. [Google Scholar] [CrossRef] [PubMed]
- Thatcher, L.F.; Manners, J.M.; Kazan, K. Fusarium oxysporum hijacks COI1-mediated jasmonate signaling to promote disease development in Arabidopsis. Plant J. 2009, 58, 927–939. [Google Scholar] [CrossRef]
- Xu, W.; Wang, Z.; Wu, F. Companion cropping with wheat increases resistance to Fusarium wilt in watermelon and the roles of root exudates in watermelon root growth. Physiol. Mol. Plant Pathol. 2015, 90, 12–20. [Google Scholar] [CrossRef]
- Anderson, J.P.; Badruzsaufari, E.; Schenk, P.M.; Manners, J.M.; Desmond, O.J.; Ehlert, C.; Maclean, D.J.; Ebert, P.R.; Kazan, K. Antagonistic interaction between abscisic acid and jasmonate-ethylene signaling pathways modulates defense gene expression and disease resistance in Arabidopsis. Plant Cell 2004, 16, 3460–3479. [Google Scholar] [CrossRef]
- Kidd, B.N.; Edgar, C.I.; Kumar, K.K.; Aitken, E.A.; Schenk, P.M.; Manners, J.M.; Kazan, K. The mediator complex subunit PFT1 is a key regulator of jasmonate-dependent defense in Arabidopsis. Plant Cell 2009, 21, 2237–2252. [Google Scholar] [CrossRef]
- Cole, S.J.; Yoon, A.J.; Faull, K.F.; Diener, A.C. Host perception of jasmonates promotes infection by Fusarium oxysporum formae speciales that produce isoleucine- and leucine-conjugated jasmonates. Mol. Plant Pathol. 2014, 15, 589–600. [Google Scholar] [CrossRef]
- Compant, S.; Duffy, B.; Nowak, J.; Clement, C.; Barka, E.A. Use of plant growth-promoting bacteria for biocontrol of plant diseases: Principles, mechanisms of action, and future prospects. Appl. Environ. Microbiol. 2005, 71, 4951–4959. [Google Scholar] [CrossRef]
- Samaras, A.; Roumeliotis, E.; Ntasiou, P.; Karaoglanidis, G. Bacillus subtilis MBI600 promotes growth of tomato plants and induces systemic resistance contributing to the control of soilborne pathogens. Plants 2021, 10, 1113. [Google Scholar] [CrossRef]
- Chaumont, F.; Moshelion, M.; Daniels, M.J. Regulation of plant aquaporin activity. Biol. Cell 2005, 97, 749–764. [Google Scholar] [CrossRef] [PubMed]
- Nanasato, Y.; Akashi, K.; Yokota, A. Co-expression of cytochrome b(561) and ascorbate oxidase in leaves of wild watermelon under drought and high light conditions. Plant Cell Physiol. 2005, 46, 1515–1524. [Google Scholar] [CrossRef] [PubMed]
- Milc, J.; Infantino, A.; Pecchioni, N.; Aragona, M. Identification of tomato genes differentially expressed during compatible interaction with Pyrenochaeta lycopersici. J. Plant Pathol. 2012, 94, 283–296. [Google Scholar]
- Alvarez-Florez, F.; Lopez-Cristoffanini, C.; Jauregui, O.; Melgarejo, L.M.; Lopez-Carbonell, M. Changes in ABA, IAA and JA levels during calyx, fruit and leaves development in cape gooseberry plants (Physalis peruviana L.). Plant Physiol. Biochem. 2017, 115, 174–182. [Google Scholar] [CrossRef] [PubMed]
- Shigenaga, A.M.; Argueso, C.T. No hormone to rule them all: Interactions of plant hormones during the responses of plants to pathogens. Semin. Cell Dev. Biol. 2016, 56, 174–189. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Han, X.; Feng, D.; Yuan, D.Y.; Huang, L.J. Signaling crosstalk between Salicylic Acid and Ethylene/Jasmonate in plant defense: Do we understand what they are whispering? Int. J. Mol. Sci. 2019, 20, 671. [Google Scholar] [CrossRef]
- Sembdner, G.; Parthier, B. The biochemistry and the physiological and molecular actions of jasmonates. Annu. Rev. Plant Phys. 1993, 44, 569–589. [Google Scholar] [CrossRef]
- Kawamura, Y.; Takenaka, S.; Hase, S.; Kubota, M.; Ichinose, Y.; Kanayama, Y.; Nakaho, K.; Klessig, D.F.; Takahashi, H. Enhanced defense responses in Arabidopsis induced by the cell wall protein fractions from Pythium oligandrum require SGT1, RAR1, NPR1 and JAR1. Plant Cell Physiol. 2009, 50, 924–934. [Google Scholar] [CrossRef]
- Liu, Q.; Xu, C.; Wen, C.K. Genetic and transformation studies reveal negative regulation of ERS1 ethylene receptor signaling in Arabidopsis. BMC Plant Biol. 2010, 10, 60. [Google Scholar] [CrossRef] [Green Version]
Treatment | Disease Index (%) | Control Efficiency (%) |
---|---|---|
FON | 58.46 ± 4.48 | - |
F1-35 and FON | 22.39 ± 5.01 | 61.7 ± 3.79 |
12 hpi /CK | 24 hpi /CK | 48 hpi /CK | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Up | Function | Down | Function | Up | Function | Down | Function | Up | Function | Down | Function |
Q6I673 | Drought stress | A0A0A0LG20 | Drought stress | V5LF72 | Broad-spectrum resistance | D1MWZ6 | Arp | Q6I673 | Broad-spectrum resistance | E7CEW6 | WRKY17 |
A3F570 | Drought stress | D1MWZ6 | Drought stress | A0A097BU00 | Alcohol dehydrogenase | A0A0A0L4M8 | Susceptibility | A0A0A0LVN5 | Alcohol dehydrogenase | A0A0A0L4M8 | Susceptibility |
P0DI61 | Soil stress | A0A0A0L4M8 | Soil stress | Q6I673 | Drought stress | A0A0A0LD49 | Drought stress | A0A0A0LT35 | Susceptibility | ||
A0A0A0LWG8 | Related to JA | D1MWZ6 | Arp | ||||||||
A0A1D8RFV5 | PR5 | A0A0A0LW64 | Negative correlation to heat shock | ||||||||
A0A0A0LW70 | Physiological stress | ||||||||||
A0A0A0K1Y0 | Ca | ||||||||||
H6TB43 | Osmotic stress | ||||||||||
A0A0A0KGB3 | Related to JA | ||||||||||
A5X4I4 | glycerol 3-phosphate degradation | ||||||||||
A0A0A0KBB7 | Precursors of JA |
Gene Name | Gene ID | Primers | Production Size (bp) | Amplification Efficiency % | R2 | |
---|---|---|---|---|---|---|
β-actin | MU51303 | F | CCTGGTATCGCTGACCGTAT | 133 | 96.7 | |
R | TACTGAGCGATGCAAGGATG | |||||
PAL | Cla018297 | F | TGCTATGGCTTCCTATT | 141 | 114.35 | 0.9912 |
R | ATGTCAATGGCTTCTTC | |||||
LOX1 | Cla019905 | F | AATGCTTGCTGGAGTGA | 121 | 99.25 | 0.9946 |
R | TGCTATGTGTTCTTCTGTTATG | |||||
CTR1 | Cla017731 | F | GAAGTTGCTGTGAAGAT | 100 | 96.28 | 0.9656 |
R | TAGGATGTCGTAAGGATT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, X.-M.; Lian, Q.-G.; Chen, J.; Jia, R.-M.; Zong, Z.-F.; Ma, Q.; Wang, Y. The Improved Biocontrol Agent, F1-35, Protects Watermelon against Fusarium Wilt by Triggering Jasmonic Acid and Ethylene Pathways. Microorganisms 2022, 10, 1710. https://doi.org/10.3390/microorganisms10091710
Dong X-M, Lian Q-G, Chen J, Jia R-M, Zong Z-F, Ma Q, Wang Y. The Improved Biocontrol Agent, F1-35, Protects Watermelon against Fusarium Wilt by Triggering Jasmonic Acid and Ethylene Pathways. Microorganisms. 2022; 10(9):1710. https://doi.org/10.3390/microorganisms10091710
Chicago/Turabian StyleDong, Xiao-Min, Qing-Gui Lian, Jing Chen, Rui-Min Jia, Zhao-Feng Zong, Qing Ma, and Yang Wang. 2022. "The Improved Biocontrol Agent, F1-35, Protects Watermelon against Fusarium Wilt by Triggering Jasmonic Acid and Ethylene Pathways" Microorganisms 10, no. 9: 1710. https://doi.org/10.3390/microorganisms10091710