1. Introduction
Filamentous fungi are important producers of structurally diverse secondary metabolites and a huge source of discovering novel and commercially important pharmaceuticals, mycoinsecticides, and antibiotics [
1]. Secondary metabolites synthesized by fungi include polyketide, non-ribosomal peptide, terpene, hybrid polyketide-nonribosomal peptide, and alkaloids [
2,
3,
4]. Several potential fungus-based drugs, such as penicillin, echinocandins [
5], cyclosporines [
6], and lovastatin [
7], play crucial roles in the field of therapeutic and biomedical sciences.
With the development of genome sequencing and bioinformatic analyses, numerous biosynthetic gene clusters have been identified within fungal genomes. This suggests that fungi possess the potential to produce a much wider array of natural products than previously anticipated [
8,
9]. However, most clusters are cryptic or have low expressions under laboratory conditions, preventing the discovery of their associated products. Various activation strategies have been employed to awaken these silent gene clusters, enabling the production of natural products with novel structures and potential pharmaceutical applications. These strategies include optimizing culture conditions, heterologous expression, cocultivation, overexpressing pathway-specific positive regulatory factors, or global regulators, and replacing promoters, among others [
10,
11,
12].
Tolypocladium ophioglossoides are known to produce various secondary metabolites (SMs), including tyrosol, cordyepolA-C, ophiosetin, and balanol [
13,
14]. There are 31 gene clusters in the genome of
T. ophioglossoides [
13], indicating its potential for synthesizing a wide range of natural products. However, transcriptome data indicate that most of the gene clusters exhibit low expression levels under laboratory culture conditions. It is intriguing to consider activating these latent gene clusters using appropriate strategies.
The 4-hydroxy pyridones represent a class of polyketide-nonribosomal peptide hybrid compounds with diverse heterocyclic structures and bioactivities [
15]. They have been isolated from various sources, including
Aspergillus terreus [
16],
A. flavus [
17],
A. nidulans [
18], and
Cylindrocladium ilicicola [
19]. This group of compounds includes flavipucines, leporins, aspyridone A, ilicicolin H, and several others. The biosynthesis mechanism of 4-hydroxy pyridones has been extensively studied over the past three decades. Tenellin is the first 4-hydroxy pyridine for which the biosynthesis has been distinctly elucidated [
20]. The biosynthesis of 4-hydroxy pyridones originated from the condensation of acetyl-CoA, malonyl CoA, and tyrosine, yielding an intermediate pentacyclic structure known as acryltetramic acid. This transformation is catalyzed via a polyketide synthase–nonribosomal peptide synthetase (PKS-NRPS) and a trans-acting enoyl reductase (ER) [
15]. Some PKS-NRPSs exhibit a broader substrate tolerance, exemplified by ApdA and TolA, enabling to the utilization of alternative aromatic amino acids and producing analogs [
21]. Subsequently, the pentacyclic structure of acryltetramic acid was transformed into the six-membered 4-hydroxy-2-pyridone catalyzed via a cytochrome P450 enzyme [
20]. The compounds containing 4-hydroxy-2-pyridone undergo modification using various postmodification enzymes, including intramolecular Diels–Alder reactions [
22], Alder-ene reaction [
23], epimerization [
19], hydroxylation [
22], and so on.
Pyridoxatin and its derivatives contain the 4-hydroxy-3-alkyl pyridones structure, which has been isolated from
Acremonium sp (BX86) [
24],
Chaunopycnis sp (CMB-MF028) [
25], and
A. bombycis [
23]. Bioactive investigations have shown that pyridoxatin and its derivatives exhibit antimalarial [
26] and antibiotic activity [
27,
28], as well as free radical scavenger. Asperpyridone A, a potential hypoglycemic agent, was first isolated from the endophytic fungus
Aspergillus sp. TJ2329 [
29].
In fungi, the pathway-specific activator is typically localized within the gene cluster, and its overexpression using a strong promoter or knockout is a simple and efficient strategy to activate the cryptic gene cluster. The fungal transcription factor GAL4 contains six highly conserved cysteine residues, forming the motif CX
2CX
6CX
6CX
2CX
5CX
2, commonly referred to as the C6 transcription factor. The GAL4-like Zn
2Cys
6 binuclear cluster DNA-binding domain is exclusively found in fungi. Transcription factors containing this domain also include STB5, DAL81, CAT8, RDR1, and HAL9 in
Saccharomyces cerevisiae. These transcription factors typically play a regulatory role in numerous secondary metabolic biosyntheses. For instance, overexpression of the transcription factor ApdR in
A. nidulans has been shown to induce the production of aspyridones A and B [
30]. The MokH transcription factor, containing the Zn(II)
2Cys
6 binuclear DNA binding domain, serves as an activator for monacolin K production.
In this study, we activated a cryptic gene cluster (located on chromosome 4, region 1) via the overexpression of one fungal-specific positive activator TopC in T. ophioglossoides. We identified this gene cluster as the top gene cluster which could simultaneously produce pyridoxatin, trichodin A, and asperpyridone A. We first ascertained that TopC positively regulates the transcription of relative genes by binding to promoters of these genes within the top cluster.
2. Materials and Methods
2.1. Strain and Culture Conditions
T. ophioglossoides and its transformants were cultivated on potato dextrose agar (PDA) or COB (5% polypeptone, 5% yeast extract, 1% MgSO
4·7H
2O, 0.5% KH
2PO
4, 3% sucrose, pH 5.5) to obtain the compounds at 26 °C.
E. coli strains were grown in Luria-Bertani (LB) or on LB agar plates at 37 °C for 12 h. YEP medium (1% peptone, 1% yeast extract, 0.5% NaCl, pH 7.0) was used for the culture of
Agrobacterium tumefaciens AGL1 with appropriate antibiotics if needed (
Table S1).
2.2. T. ophioglossoides Genomic DNA Extraction
T. ophioglossoides was cultured in COB medium for a duration of 4 days. Subsequently, the filamentous mycelium was harvested using miracloth and thoroughly rinsed with ultrapure sterile water. Genomic DNA was then extracted from the mycelia. Following this, the precipitate and supernatant were effectively separated through centrifugation at a rate of 12,000 rpm for approximately 5 min. A volume of 500 μL of supernatant was carefully transferred to a fresh Eppendorf tube, to which an equivalent volume of isopropanol was promptly added. This mixture was left to stand at room temperature for a period of 10 min. Subsequently, the supernatant was decanted, and the sediment underwent two additional washes with 75% ethanol.
2.3. Construction and Cloning of Fungal Recombinant Plasmids
Genomic DNA from T. ophioglossoides was prepared as described. Primers were synthesized using GENERAY (Hangzhou, China). The plasmid pFGL-815N, a shuttle expression vector compatible with both E. coli and A. tumefaciens, was utilized. The sur resistance gene fragment was obtained via PCR amplification with primers sur-F/R. This fragment was subsequently inserted into the shuttle plasmid pFG-815N (digestion with restriction enzymes EcoR I and Kpn I) using cloning enzymes, yielding the plasmid pFG-SUR. The TEF promoter for the overexpression gene, derived from the translation elongation factor tef gene, is amplified via PCR using primers pTEF-F/R. The terminator of the T-amyB gene, which serves as the terminator for transcription activation factors, is amplified using primers T-amyB-F/R. The two promoters and terminators were then integrated into the constructed pFG-SUR plasmid (digestion with Kpn I), leading to the formation of the overexpression of plasmid pTEFTAS-2P+2T.
The
topC gene is amplified using primers
topC-p-F/R from
T. ophioglossoides genomic DNA. The amplified
topC gene is then cloned into the pTEFTAS-2P+2T plasmid, which is digested with
Spe I, resulting in the shuttle plasmid pTEFTAS-
topC overexpression. The primers and plasmids used in this procedure are listed in
Tables S2 and S3 and
Figure S1.
2.4. Transformation of T. ophioglossoides
T. ophioglossoides transformation was performed via the ATMT method as described previously [
31].
The transformants of
T. ophioglossoides need to be subcultured for three to four generations to form homozygous mutants. A list of all strains constructed in this study is provided in
Table S1.
2.5. High Performance Liquid Chromatography (HPLC) Analysis and Liquid Chromatog Raphy-Mass Spectrometry (LC-MS) Analysis of Secondary Metabolites
The transformant strains were transferred into 100 mL COB medium in a 250 mL flask and cultured at 26 °C and 180 rpm for 14 days. Then, the culture broth and mycelia were separated via filtration. The culture broth was extracted three times with an equal volume of ethyl acetate and the extracts were analyzed to determine metabolite changes via HPLC. The mycelia were disrupted two times with methanol under ultrasonic conditions. The extracts of the mycelia were directly analyzed using HPLC between 200 and 640 nm.
HPLC analysis was carried out using an Agilent 1260 Infinity system with a DAD detector and a reversed-phase C18 column (Agilent Eclipse Plus C18, 4.6 × 250 mm, 5 µm, Agilent Technologies, Hangzhou, China). Chromatographic conditions were as follows: solvents: (A) water + 1% Formic acid (FA), and (B) acetonitrile; solvent gradient 5% B in the first 5 min, increased to 100% at 45 min, to 5% B at 46 min, followed by 4 min with 5% B. This runs at a flow rate of 1 mL/min, a column temperature of 40 °C and UV detection at 200 to 640 nm.
LC-MS analysis was conducted using an Agilent 1200 HPLC system (Agilent, Santa Clara, CA, USA) and a Thermo Finnigan LCQDeca XP Max LC/MS system (Thermo Finnigan, Waltham, MA, USA). The column employed was Agilent Eclipse Plus C18, while the mobile phases A and B consisted of H2O (with 0.1% formic acid) and acetonitrile (with 0.1% formic acid), respectively. The analysis involved a linear gradient from 5% to 100% (v/v) B over a duration of 50 min.
2.6. Compound Purification
HPLC purification was performed using a semi-preparative reverse-phase C18 column.
A flow rate of 2.5 mL/min was employed with a solvent gradient system consisting of acetonitrile and water containing 0.1% formic acid. Absorbance was continuously monitored at wavelengths of 280 nm and 210 nm. The purification of compounds was carried out as follows: Compound 1: purified via semipreparative HPLC using ACN-H2O (0.1% formic acid) in a ratio of 59:41 v/v as the mobile phase, resulting in a yield of 1 (1.5 mg, 36 min). Compound 2: purified via semipreparative HPLC using ACN-H2O (0.1% formic acid) in a ratio of 52.5:47.5 v/v as the mobile phase, resulting in a yield of 2 (160 mg, 28 min). Compound 3: purified via semipreparative HPLC using ACN-H2O (0.1% formic acid) in a ratio of 38.5:61.5 v/v as the mobile phase, resulting in a yield of 3 (2 mg, 58 min). Compound 4: purified via semipreparative HPLC using ACN-H2O (0.1% formic acid) in a ratio of 52.5:47.5 v/v as the mobile phase, resulting in a yield of 4 (7 mg, 36 min). Compound 5: purified via semipreparative HPLC using ACN-H2O (0.1% formic acid) in a ratio of 27.5:72.5 v/v as the mobile phase, resulting in a yield of 5 (8.5 mg, 34 min). Compounds 6a and 6b: purified via semipreparative HPLC using ACN-H2O (0.1% formic acid) in a ratio of 35:65 v/v as the mobile phase, resulting in yields of 6a and 6b (80 mg, 25 min).
2.7. Quantitative Real-Time PCR (qRT-PCR) Analysis of Gene Expression
The mycelia of
T. ophioglossoides were collected following 4 days of cultivation in COB liquid medium at 26 °C and 180 rpm. Total RNA extraction was performed using HiPure Total RNA Mini Kit (Magen, Guangzhou, China). Reverse transcription was conducted using HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The resulting cDNA was subjected to real-time quantitative PCR (qRT-PCR) for transcriptional analysis employing specific primers that generated PCR products of approximately 200 bp (
Table S3). qRT-PCR analysis of the cluster gene transcription was executed using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). The
tef gene, which encodes the translation elongation factor and maintains a constant expression level, was employed as an internal control [
13]. The qRT-PCR reactions were initiated by incubating the samples at 95 °C for 1 min followed by 40 cycles at 95 °C for 15 s, 55 °C for 15 s, and 68 °C for 20 s. All samples were run in triplicate. The threshold cycle (Ct) was calculated from the program. The 2
−∆∆Ct method was used to quantify the relative changes in gene expression [
31].
2.8. Heterologous Expression and Purification of TopC-DBD in E. coli
A DNA fragment encoding the TopC DNA binding domain (topC-DBD) was amplified from T. ophioglossoides cDNA and inserted into the pET-32a vector (digestion with EcoR I) via in-fusion cloning technology. The E. coli BL21 (DE3) cells harboring the expression plasmid were capable of producing the target TopC-DBD protein upon induction with 0.1 mM IPTG. The induced cells were incubated at 16 °C for 16 h. Affinity purification using Ni-agarose (Qiagen, Hilden, Germany) was employed to isolate the target TopC-DBD protein. The concentration of TopC-DBD was analyzed using a Bradford assay.
2.9. Electrophoretic Mobility Shift Assay (EMSA)-Based Affinity Analysis
DNA probes corresponding to topAH, topB, topC, topDE, and topFG were generated by amplifying the respective genomic segments from
T. ophioglossoides. Primers with 5′-end 6-carboxyfluorescein (6-FAM) labels were used for this purpose (
Table S3). The promoter of the
g8899 gene in the
T. ophioglossoides genome was selected as a non-specific promoter for use as a blank control. As the negative control (Free vector probe), 1 μg of the promoter of g8899 was amplified from
T. ophioglossoides genomic DNA using related primers. Detection of the FAM-labeled probes was carried out using the LAS4000 machine. The Electrophoretic Mobility Shift Assay (EMSA) was conducted to confirm the interaction between TopC-DBD and the DNA probe, as previously reported [
32].
3. Results
3.1. Characterization of Pathway-Specific Regulator TopC of the Cryptic Top Cluster in T. ophioglossides
Based on the analysis of the genome sequence of
T. ophioglossoides for all gene clusters, a gene cluster containing a PKS-NRPS hybrid enzyme was found. The transcriptome analysis showed that this gene cluster (
top) was a cryptic gene cluster, with its constituent genes displaying low expression levels under our laboratory fermentation conditions (
Table S4). According to antiSMASH prediction, the
top gene cluster, homologous to the
tol gene cluster, encompasses a PKS-NRPS hybrid enzyme (
topE) and various modified enzymes. These enzymes include one hypothetical methyltransferase (
topB), a short-chain dehydrogenases/reductases (
topH), three cytochrome p450 monooxygenases (
topA,
F,
G), one enoyl reductase (
topD), and one C6 transcription factor (
topC), which are likely involved in the synthesis of complex natural products (
Table S4 and
Figure S2).
Within this cluster, our investigation unveiled the presence of a putative activator gene named
topC. This gene encodes a fungal cluster-specific C6 transcriptional factor. (
Figure 1), which likely plays a role in regulating the expression of cluster genes. The full length of the TopC protein contains 802 amino acids and has a molecular weight of approximately 87.76 kDa. Bioinformatics analysis indicated that TopC is a typical multidrug-resistant transcription factor in fungi. It possesses an N-terminal CAL4-type Zn
2Cys
6 DNA-binding domain and a C-terminal fungal transcription factor regulatory middle homology domain (
Figure 1 and
Figure S3).
To further explore the relationship of TopC, we conducted a phylogenetic analysis. We gathered nine Zn2Cys6 transcription factors exhibiting significant similarity to the TopC amino acid sequence. These factors were obtained from the NCBI protein database via a blast alignment search. Notable transcription factors in this group include yanR (Accession no. G3Y415.1) from A. niger, GAL4 (Accession no. QGN14419.1) from Saccharomyces, AflR (Accession no. P43651.3) from A. parasiticus, MdpE (Accession no. AN0148) from A. nidulans FGSC A4, AnTF (Accession no. AAC49195) from A. nidulans, MlcR (Accession no. Q8J0F2.1) from P. citrinum, MokH (Accession no. Q3S2U4.1) from Monascus pilosus, LovE (Accession no. Q0C8L8.1) from A. terreus NIH2624, and ApdR (Accession no. XP_045268485.1) from Colletotrichum gloeosporioides.
Our phylogenetic analysis suggests that TopC forms a distinct clade with
A. nidulan ApdR, a recognized transcriptional activator with a pivotal role in aspyridone A and B biosynthesis in
A. nidulan [
33].
Given the prevailing role of C6 transcriptional factors as positive regulators, we devised an expression vector for the overexpression of
topC. This vector drove the activation of the target gene cluster under the control of the strong constitutive promoter
pTEF, a strategy previously documented [
13]. Consequently, we generated the
topCOE mutant. The identity of these transformants was confirmed through PCR analysis.
Notably, the
topCOE mutants exhibited a significantly slower growth rate and displayed a more pronounced yellow pigmentation on PDA medium in comparison to the WT strains (
Figure S4).
Examination of HPLC chromatograms from
topCOE cultures revealed a markedly distinct metabolite profile compared to that of the WT strain. Six previously unobserved peaks (1–6) were detected and subsequently characterized within these new HPLC peaks (
Figure 2). These findings strongly suggest the activation of the target gene cluster upon
topC overexpression.
3.2. Structural Determination of Compounds 1–6
To characterize the chemical structures of these metabolites produced by the transformants, large-scale fermentation in liquid culture was carried out to isolate sufficient amounts of these compounds (
Figure 3 and
Table S5).
Compound
1 was isolated as a light yellow amorphous solid. It has a molecular formula of C
21H
27NO
4 based on the positive mode of HRESIMS.
1H-NMR data indicate that the structure of compound
1 is tolypoalbin, which could be isolated from
T. album TAMA 479 [
34] (
Figures S5 and S6).
Compound
2 was isolated as a light yellow powder. It has a molecular formula of C
21H
27NO
5 based on the negative mode of HRESIMS.
1H and
13C NMR data indicate that the structure of compound
2 is consistent with that of compound F-14329 isolated from
Chaunopycnis sp. [
25] (
Table S6 and
Figures S7–S9).
Compound
3, a white amorphous solid, has a molecular weight of 339.1898 (
m/
z 340.1898, [M + H]
+) determined via HRESIMS, indicating the molecular formula of C
21H
25NO
3. The UV, molecular formular, and
1H NMR data that indicate compound
3 have the same structure as trichodin A [
28] (
Table S7 and
Figures S10 and S11).
Compound
4 was isolated as colorless massive crystals, which have the molecular formular of C
16H
23NO
3 via analysis of the HRESIMS spectrum. The UV and molecular formular data revealed that compound
4 has a similar skeleton structure to compound
6.
1H and
13C NMR data of compound
4 were identical to those of asperpyridone A [
29] (
Table S8 and
Figures S12–S14).
Compound
5 was isolated as orange powder, of which the molecular formular was determined as C
21H
27NO
6 via HRESIMS spectrum analysis. The UV and molecular formular data of
5 were similar to those of F-14329, indicating that compound
5 has a similar structure to compound
2. Subsequently, the structure of compound
5 was determined via
1H and
13C NMR spectra, indicating that compound
5 was chaunolidine B (
Table S9 and
Figures S15–S17).
Compounds
6a and
6b, light yellow powders, have a molecular weight of 263.1456 (
m/z 262.1456, [M-H]
−) determined via HRESIMS, indicating the molecular formula of C
15H
21NO
3; the ratio of
6a to
6b is approximately 5:3 in DMSO (
Table S10 and
Figures S18–S20). The structure of compounds
6a and
6b was elucidated as pyridoxatin based on
1H and
13C NMR data, which is a free radical scavenger, and could inhibit lipid peroxidation induced by free radicals in rat liver microsomes free from vitamin E [
24].
Pyridoxatin and trichodin A with asperpyridone A are the known unusual pyridone alkaloids. The biosynthesis gene cluster of pyridoxatin, pdx, was identified, while the gene clusters responsible for synthesizing trichodin A and asperpyridone A remain elusive. Interestingly, these compounds were found to accumulate in topCOE transformants, indicating that TopC has the capacity to simultaneously regulate the biosynthesis of these compounds. Further investigation through a literature search revealed that the gene clusters responsible for biosynthesis are mainly tol, pdx, and lep. Additionally, local blast analysis uncovered that within the T. ophioglossoides genome, the topE gene exhibits a remarkably high similarity to the core genes of these clusters, particularly tolA, with a similarity of up to 90%. Based on these findings, we postulate that the top gene cluster likely represents a multifunctional biosynthetic gene cluster responsible for producing pyridoxatin, trichodin A, and asperpyridone A.
3.3. Transcriptional Analysis of Top Gene Cluster
The
top gene cluster, consisting of eight genes predicted by antiSMASH, was experimentally validated. To elucidate the gene expression dynamics within this cluster and delineate its boundaries, we conducted transcriptional analysis on the generated transformants using qRT-PCR (
Figure S21). Our findings revealed a substantial increase in the transcription levels of
topA through
topH in the
topCOE transformants when compared to the wild-type (WT) strain. Notably, other genes exhibited no significant alterations in their expression patterns (
Figure 4). These results provide compelling evidence that the
top gene cluster spans from
topA to
topH, encompassing eight genes across approximately 45 kilobases. Furthermore, this cluster can be selectively upregulated through the overexpression of the regulatory gene
topC.
3.4. TopC Positively Regulates Pyridoxatin, Trichodin A, and Asperpyridone A Biosynthesis by Binding All the Promoters of the Top Gene Cluster
The mechanism governing the accumulation of six compounds resulting from the overexpression of the topC gene has hitherto remained elusive. To address this knowledge gap, we conducted in vitro Electrophoretic Mobility Shift Assay (EMSA) experiments, aiming to decipher the intricate interplay between the TopC protein and the promoters of the aforementioned top structural genes.
GAL4, a well-known transcription factor, typically recognizes and binds to gene promoters through its N-terminal DNA-binding domain while activating transcription factors via its C-terminal activation domain. Therefore, we endeavored to selectively express the N-terminal DNA-binding domain (DBD) of TopC in
E. coli BL21, facilitated by Trx soluble tag proteins. Subsequently, the purified fusion protein, with a molecular weight of 32 kDa, was subjected to the ensuing DNA binding experiments (
Figure 5). We amplified five distinct DNA probe fragments from
T. ophioglossoides genomic DNA, utilizing FM-labeled primers. These five DNA probes, along with a promoter of an un-specific gene selected from the
T. ophioglossoides genome, were then subjected to interaction studies with TopC-DBD protein. The results of the EMSA experiments unequivocally demonstrated the binding affinity of TopC-DBD protein to all five probes in vitro, discernibly differentiating them from the control group featuring a promoter of an un-specific gene (Free vector probe) (
Figure 5 and
Figure S22). Remarkably, as the protein concentration increased, the probes exhibited a higher frequency of binding interactions and migrated shorter distances within the gel, ultimately forming discernable delayed probe-TopC-DBD complex bands. As depicted in
Figure 5, it is apparent that the protein’s affinity for the
topB promoter is notably lower compared to its binding affinity with the promoters of other genes within this cluster. Notably, when binding to promoters designated as C or A–H, a staircase emerged, characterized by a progressive increase in size, suggesting a looser binding of the TopC protein. Significantly, EMSA experiments involving C or A–H probes provided compelling evidence of their ability to bind to TopC-DBD.
Building upon these outcomes, we can postulate a regulatory mechanism for TopC. In this proposed mechanism, TopC directly engages with the upstream promoter regions of all genes encompassed within the top gene cluster, thereby augmenting the expression levels of the relevant genes.
Based on our experimental findings, we hypothesize the existence of a conserved binding site for the TopC protein within the promoter regions of all genes. To explore this further, we employed the MEME suite tool (
https://meme-suite.org accessed on 20 April 2023) to identify potential DNA binding motifs within these promoter regions. Through MEME-ChIP analysis, we successfully pinpointed a potential TopC consensus binding site with the highest score, ATCGTTGTGTTTATTTGTTT, which was consistent across five promoter regions.
3.5. Identification of Putative Biosynthetic Pathway of Pyridoxatin, Trichodin A, and Asperpyridone A in T. ophioglossoides
To validate our aforementioned hypothesis concerning this gene cluster, we employed homologous recombination to delete the key short-chain dehydrogenase gene,
topH within the
topCOE background strain (
Figure S23). As depicted in the culture broth profile of the mutant
topCOEΔ
topH (
Figure 6), compounds
3,
4, and
6 were no longer detectable, strongly suggesting their synthesis through the
top gene cluster. This gene cluster, responsible for the production of trichodin A and asperpyridone A, represents a novel discovery in
T. ophioglossoides. We delved into the biosynthetic pathways of this
top biosynthetic gene cluster through gene knockout experiments, metabolite identification, and the study of homologous enzymes. A homologous gene cluster,
tol, was identified via homology alignment. The core PKS-NRPS enzyme TopE/TolA, enoyl reductase TopD/TolC, cytochrome p450 TopF/TolD, and cytochrome p450 TopG/TolB, respectively, share 90.1%, 81%, 82.3%, and 96.8% sequence similarity at the amino acid level (
Table S4), indicative of their likely identical functions [
15]. Furthermore, TopB, an annotated enzyme in this gene cluster, is predicted to be an o-methyltransferase (OMT) with a sequence homology of 99.6% similarity to AdxI, a protein previously implicated in pyridoxatin, trichodin A, and asperpyridone A biosynthesis [
23]. Finally, SDR TopH is the putative ketoreductase, exhibiting an overall homology of 91.7% with PdxG, while TopA shares an 89.6% homology with PdxF within the
pdx gene cluster, suggesting potentially similar functions.
In the culture broth profile of the
topCOEΔ
topH mutant, compounds
3,
4,
5, and
6 were conspicuously absent, while two peaks,
7 and
12, were detected, albeit in trace amounts. Due to the extremely limited yield of compound
12, we encountered difficulties in obtaining a sufficient quantity for nuclear magnetic resonance (NMR) analysis. However, we successfully determined its molecular formula as C
15H
21NO
4 via LC-MS/MS. The UV spectrum of compound
12 closely resembled that of tolypyridone D, a known compound in the literature, with the only difference being an additional hydroxyl group in compound
12 compared to tolypyridone D (
9) [
15]. Therefore, we postulate that compound
12 represents a derivative of tolypyridone D (
Figure 6 and
Figure 7,
Figures S24 and S25), suggesting that TopH may possess a broader substrate tolerance compared to PdxG [
23].
In the metabolite profile of
topCOE
ΔtopA, compounds
4,
5, and
6 were notably absent, and compound
9, along with its derivatives, was not detected, implying a role for TopA in the biosynthesis of intermediate
9 (
Figure S26). Further investigations are warranted to elucidate the precise catalytic mechanism of TopA.
In the knockout strains of topCOEΔtopH and topCOEΔtopA, the production of compound 5 was undetectable. Compound 5 naturally exhibits a low yield in the topCOE strain. It is believed to be generated through a single hydroxylation step from compound 2, as indicated by their molecular formulas. The minimal yield of compound 5 led us to speculate that this reaction might occur through a minor pathway with low enzyme expression or potentially be catalyzed by an enzyme external to the cluster.
In summary, we propose a biosynthetic pathway for pyridoxatin, trichodin A, and asperpyridone A in
T. ophioglossoides, as depicted in
Figure 7, building upon previous biosynthesis studies [
15,
23].
4. Discussion
Filamentous fungi possess the remarkable capacity to produce a diverse array of structurally intricate secondary metabolites with multifaceted biological activities. Among these, pyridone alkaloids constitute a highly diverse and bioactive subgroup [
16]. However, the majority of gene clusters responsible for pyridone alkaloid biosynthesis remain enigmatic. Notably, asperpyridone A, an uncommon pyridone alkaloid initially isolated from the endophytic fungus
Aspergillus sp. TJ23, has exhibited a remarkable glucose uptake effect in liver HepG2 cells, surpassing metformin in efficacy [
29]. Trichodin A, on the other hand, was derived from the marine fungus
Trichoderma sp. MF106 and demonstrated antibiotic properties against the clinically significant microorganism,
Staphylococcus epidermidis [
28]. Yet, our understanding of the regulatory mechanisms governing their biosynthesis remains elusive, thereby impeding their potential clinical applications.
Various Zn(II)
2Cys
6-type zinc finger transcription factors (TFs) have been characterized across different filamentous fungi, including
M. pilosus [
35],
A. nidulans [
33], and
P. citrinum [
36], and are presumed to serve as positive regulators of secondary metabolite biosynthesis. Here, we highlight a latent
T. ophioglossoides PKS-NRPS gene cluster harboring a putative regulator, TopC, possessing a GAL4-type Zn
2Cys
6 binuclear cluster DNA-binding domain. In our investigation, TopC emerges as a key positive regulator governing the biosynthesis of asperpyridone A and trichodin A. Overexpression of the regulatory gene
topC homologously triggers the activation of the cryptic gene cluster
top, resulting in the production of asperpyridone A and trichodin A. TopC exerts direct transcriptional activation of the structural genes within the
top cluster by binding to their respective promoters.
It is important to note that microbial metabolic regulation operates as a complex network, and the expression of the topC gene may be subject to control by other upstream regulatory proteins. In typical growth conditions, secondary metabolites are non-essential for microbial growth, and gene clusters involved in secondary metabolism often remain in a repressed or silenced state. In response to specific environmental cues or stressors, microbes initiate signaling pathways that activate upstream regulatory proteins. Subsequently, these upstream regulators further stimulate downstream proteins, including TopC. TopC, in turn, binds to the promoters of genes within the top cluster, recruits transcription-associated enzymes, and instigates gene transcription. This intricate process warrants further exploration. In our study, we have provided the initial characterization of the gene cluster responsible for asperpyridone A and trichodin A biosynthesis in fungi, shedding light on their biosynthetic pathway through an elucidation of the deduced gene functions within the top biosynthetic gene cluster.
5. Conclusions
In summary, our study unveiled a previously unrecognized biosynthetic gene cluster, named top, responsible for pyridone alkaloid production in T. ophioglossoides through comprehensive genome analysis. Notably, the overexpression of the pathway-specific regulatory gene, topC, residing within the top cluster, resulted in the activation of this cryptic gene cluster. Consequently, this led to the substantial accumulation of three significant pyridone alkaloids: asperpyridone A, trichodin A, and pyridoxatin. Our investigations unveiled TopC as a positive regulator governing the biosynthesis of pyridoxatin, trichodin A, and asperpyridone A. This regulatory protein achieves this by directly recognizing the promoter regions of all the top gene cluster’s constituent genes and binding to them. Furthermore, we made a pioneering discovery by identifying the asperpyridone A and trichodin A biosynthetic gene cluster in T. ophioglossoides through targeted key enzyme gene deletions. Our proposed biosynthesis mechanisms for these compounds emerged from a thorough analysis of gene deletions, metabolite profiles, and the functions of homologous enzymes. Notably, we identified an intriguing short-chain dehydrogenase, TopH, which exhibits remarkable flexibility in reducing various ketones, adding an additional layer of complexity to the biosynthetic pathway.