Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Bacterial Strains and Culture
2.3. Extraction of Stilbenes from B. striata
2.4. Instrumentation and HPLC/Q-TOF-MS Conditions
2.5. Determination of MIC and MBC
2.6. Determination of Growth Curve
2.7. Observation of TEM
2.8. Determination of Intracellular ATP Levels of C. acnes
2.9. Measurement of MP
2.10. Real-Time Quantitative PCR (qRT-PCR) Analysis
2.11. Statistical Analysis
3. Results
3.1. HPLC/Q-TOF-MS Profile of BSS
3.2. Antimicrobial Activity of BSS against C. acnes
3.3. Inhibitory Effect of BSS on the Growth of C. acnes
3.4. Effect of BSS on the Morphology of C. acnes
3.5. Effect of BSS on the Intracellular ATP Levels of C. acnes
3.6. Effect of BSS on MP of C. acnes
3.7. Effect of BSS on Fatty Acid Biosynthesis-Related Gene Expression of C. acnes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Arooj, A.; Rehman, A.U.; Iqbal, M.; Naz, I.; Alhodaib, A.; Ahmed, N. Development of adapalene loaded liposome based gel for acne. Gels 2023, 9, 135. [Google Scholar] [CrossRef]
- Dréno, B.; Dagnelie, M.A.; Khammari, A.; Corvec, S. The skin microbiome: A new actor in inflammatory acne. Am. J. Clin. Dermatol. 2020, 21, 18–24. [Google Scholar] [CrossRef]
- Matsumoto, Y.; Tateyama, Y.; Sugita, T. Evaluation of antibacterial drugs using silkworms infected by Cutibacterium acnes. Insects 2021, 12, 619. [Google Scholar] [CrossRef]
- Taylor, E.J.; Yu, Y.; Champer, J.; Kim, J. Resveratrol demonstrates antimicrobial effects against Propionibacterium acnes in vitro. Dermatol. Ther. 2014, 4, 249–257. [Google Scholar] [CrossRef]
- Tripathi, S.V.; Gustafson, C.J.; Huang, K.E.; Feldman, S.R. Side effects of common acne treatments. Expert Opin. Drug. Saf. 2013, 12, 39–51. [Google Scholar] [CrossRef]
- Zhai, W.; Wei, E.; Li, R.; Ji, T.; Jiang, Y.; Wang, X.; Liu, Y.; Ding, Z.; Zhou, H. Characterization and evaluation of the pro-coagulant and immunomodulatory activities of polysaccharides from Bletilla striata. ACS Omega 2021, 6, 656–665. [Google Scholar] [CrossRef]
- Bae, J.Y.; Lee, J.W.; Jin, Q.; Jang, H.; Lee, D.; Kim, Y.; Hong, J.T.; Lee, M.K.; Lee, M.S.; Hwang, B.Y. Chemical constituents isolated from Bletilla striata and their inhibitory effects on nitric oxide production in RAW 264.7 Cells. Chem Biodivers 2017, 14, e1600243. [Google Scholar] [CrossRef]
- Nishidono, Y.; Ishii, T.; Okada, R.; Norimoto, H.; Murayama, C.; He, D.; Okuyama, T.; Nishizawa, M.; Tanaka, K. Effect of heat processing on the chemical constituents and NO-suppressing activity of Bletilla Tuber. J. Nat. Med 2020, 74, 219–228. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Wang, M.; Jiang, L.; Xie, Q.; Yuan, H.; Yang, Y.; Zafar, S.; Liu, Y.; Jian, Y.; Li, B.; et al. The medicinal uses of the genus Bletilla in traditional Chinese medicine: A phytochemical and pharmacological review. J. Ethnopharmacol. 2021, 280, 114263. [Google Scholar] [CrossRef]
- Jakfar, S.; Lin, T.C.; Chen, Z.Y.; Yang, I.H.; Gani, B.A.; Ningsih, D.S.; Kusuma, H.; Chang, C.T.; Lin, F.H. A polysaccharide isolated from the herb Bletilla striata combined with methylcellulose to form a hydrogel via self-assembly as a wound dressing. Int. J. Mol. Sci. 2022, 23, 12019. [Google Scholar] [CrossRef]
- Woo, K.W.; Park, J.E.; Choi, S.U.; Kim, K.H.; Lee, K.R. Phytochemical constituents of Bletilla striata and their cytotoxic activity. Nat. Prod. Sci. 2014, 20, 91–94. [Google Scholar]
- Kao, T.I.; Chen, P.J.; Wang, Y.H.; Tseng, H.H.; Chang, S.H.; Wu, T.S.; Yang, S.H.; Lee, Y.T.; Hwang, T.L. Bletinib ameliorates neutrophilic inflammation and lung injury by inhibiting Src family kinase phosphorylation and activity. Br. J. Pharmacol. 2021, 178, 4069–4084. [Google Scholar] [CrossRef]
- Maheshwari, M.; Safar Althubiani, A.; Hasan Abulreesh, H.; Abul Qais, F.; Shavez Khan, M.; Ahmad, I. Bioactive extracts of Carum copticum L. enhances efficacy of ciprofloxacin against MDR enteric bacteria. Saudi J. Biol. Sci. 2019, 26, 1848–1855. [Google Scholar] [CrossRef]
- Miazga-Karska, M.; Michalak, K.; Ginalska, G. Anti-acne action of peptides isolated from burdock root-preliminary studies and pilot testing. Molecules 2020, 25, 2027. [Google Scholar] [CrossRef]
- Chen, J.; Zhang, J.; Zhu, L.; Qian, C.; Tian, H.; Zhao, Z.; Jin, L.; Yang, D. Antibacterial activity of the essential oil from Litsea cubeba against Cutibacterium acnes and the investigations of its potential mechanism by gas chromatography-mass spectrometry metabolomics. Front. Microbiol. 2022, 13, 823845. [Google Scholar] [CrossRef]
- Theansungnoen, T.; Phosri, S.; Bumrungthai, S.; Daduang, J.; Klaynongsruang, S.; Daduang, S. Novel non-cytotoxic antimicrobial peptides WSKK11 and WSRR11 with potent activity against Cutibacterium acnes. J. Antimicrob. Chemother. 2022, 77, 1012–1019. [Google Scholar] [CrossRef]
- O’Malley, T.; Alling, T.; Early, J.V.; Wescott, H.A.; Kumar, A.; Moraski, G.C.; Miller, M.J.; Masquelin, T.; Hipskind, P.A.; Parish, T. Imidazopyridine compounds inhibit mycobacterial growth by depleting ATP levels. Antimicrob. Agents Chemother. 2018, 62, e02439-17. [Google Scholar] [CrossRef]
- Guo, F.; Chen, Q.; Liang, Q.; Zhang, M.; Chen, W.; Chen, H.; Yun, Y.; Zhong, Q.; Chen, W. Antimicrobial activity and proposed action mechanism of linalool against Pseudomonas fluorescens. Front. Microbiol. 2021, 12, 562094. [Google Scholar] [CrossRef]
- Aggarwal, S.D.; Gullett, J.M.; Fedder, T.; Safi, J.P.F.; Rock, C.O.; Hiller, N.L. Competence-associated peptide BriC alters fatty acid biosynthesis in Streptococcus pneumoniae. mSphere 2021, 6, e0014521. [Google Scholar] [CrossRef]
- Rashdan, H.R.M.; Shehadi, I.A.; Abdelrahman, M.T.; Hemdan, B.A. Antibacterial activities and molecular docking of novel sulfone biscompound containing bioactive 1,2,3-triazole moiety. Molecules 2021, 26, 4817. [Google Scholar] [CrossRef]
- Yussof, A.; Cammalleri, B.; Fayemiwo, O.; Lopez, S.; Chu, T. Antibacterial and sporicidal activity evaluation of theaflavin-3,3′-digallate. Int. J. Mol. Sci. 2022, 23, 2153. [Google Scholar] [CrossRef]
- Song, W.; Xin, J.; Yu, C.; Xia, C.; Pan, Y. Alkyl ferulic acid esters: Evaluating their structure and antibacterial properties. Front. Microbiol. 2023, 14, 1135308. [Google Scholar] [CrossRef]
- Reddy, G.K.K.; Nancharaiah, Y.V. Alkylimidazolium Ionic liquids as antifungal alternatives: Antibiofilm activity against Candida albicans and underlying mechanism of action. Front. Microbiol. 2020, 11, 730. [Google Scholar] [CrossRef]
- Zheng, C.J.; Yoo, J.S.; Lee, T.G.; Cho, H.Y.; Kim, Y.H.; Kim, W.G. Fatty acid synthesis is a target for antibacterial activity of unsaturated fatty acids. FEBS Lett. 2005, 579, 5157–5162. [Google Scholar] [CrossRef]
- Chong, J.; Poutaraud, A.; Hugueney, P. Metabolism and roles of stilbenes in plants. Plant Sci. 2009, 177, 143–155. [Google Scholar] [CrossRef]
- Reinecke, T. Inducible enzymes of the 9,10-dihydro-phenanthrene pathway. sterile orchid plants responding to fungal infection. Mol. Plant Microbe 1994, 7, 449–454. [Google Scholar] [CrossRef]
- Xu, D.; Pan, Y.; Chen, J. Chemical constituents, pharmacologic properties, and clinical applications of Bletilla striata. Front. Pharmacol. 2019, 10, 1168. [Google Scholar] [CrossRef]
- Jiang, S.; Chen, C.F.; Ma, X.P.; Wang, M.Y.; Wang, W.; Xia, Y.; Zhang, N.; Wu, M.K.; Pan, W.D. Antibacterial stilbenes from the tubers of Bletilla striata. Fitoterapia 2019, 138, 104350. [Google Scholar] [CrossRef]
- Jiang, S.; Wan, K.; Lou, H.Y.; Yi, P.; Zhang, N.; Zhou, M.; Song, Z.Q.; Wang, W.; Wu, M.K.; Pan, W.D. Antibacterial bibenzyl derivatives from the tubers of Bletilla striata. Phytochemistry 2019, 162, 216–223. [Google Scholar] [CrossRef]
- Takagi, S.; Yamaki, M.; Inoue, K. Antimicrobial agents from Bletilla striata. Phytochemistry 1983, 22, 1011–1015. [Google Scholar] [CrossRef]
- Yao, X.L.; Zhu, X.R.; Pan, S.Y.; Fang, Y.P.; Jiang, F.T.; Phillips, G.O.; Xu, X.Y. Antimicrobial activity of nobiletin and tangeretin against Pseudomonas. Food Chem. 2012, 132, 1883–1890. [Google Scholar] [CrossRef]
- Fang, Z.; Xu, L.Z.; Lin, Y.L.; Cai, X.X.; Wang, S.Y. The preservative potential of octopus scraps peptides-Zinc chelate against Staphylococcus aureus: Its fabrication, antibacterial activity and action mode. Food Control 2019, 98, 24–33. [Google Scholar] [CrossRef]
- Xu, C.; Li, J.L.; Yang, L.Q.; Shi, F.; Yang, L.; Ye, M. Antibacterial activity and a membrane damage mechanism of Lachnum YM30 melanin against Vibrio parahaemolyticus and Staphylococcus aureus. Food Control 2017, 73, 1445–1451. [Google Scholar] [CrossRef]
- Shu, H.; Chen, H.; Wang, X.; Hu, Y.; Yun, Y.; Zhong, Q.; Chen, W.; Chen, W. Antimicrobial activity and proposed action mechanism of 3-carene against Brochothrix thermosphacta and Pseudomonas fluorescens. Molecules 2019, 24, 3246. [Google Scholar] [CrossRef]
- Igbinosa, E.O.; Beshiru, A.; Igbinosa, I.H. Mechanism of action of secondary metabolites from marine-derived Streptoymces on bacterial isolates by membrane permeability. Microb. Pathog. 2020, 149, 104532. [Google Scholar] [CrossRef]
- Deng, Y.; Beahm, D.R.; Ionov, S.; Sarpeshkar, R. Measuring and modeling energy and power consumption in living microbial cells with a synthetic ATP reporter. BMC Biol. 2021, 19, 101. [Google Scholar] [CrossRef]
- McCubbin, T.; Gonzalez-Garcia, R.A.; Palfreyman, R.W.; Stowers, C.; Nielsen, L.K.; Marcellin, E. A pan-genome guided metabolic network reconstruction of five Propionibacterium species reveals extensive metabolic diversity. Genes 2020, 11, 1115. [Google Scholar] [CrossRef]
- Burt, S. Essential oils: Their antibacterial properties and potential applications in foods—A review. Int. J. Food Microbiol. 2004, 94, 223–253. [Google Scholar] [CrossRef]
- Yao, J.; Rock, C.O. Bacterial fatty acid metabolism in modern antibiotic discovery. BBA-Mol. Cell Biol. Lipids 2017, 1862, 1300–1309. [Google Scholar] [CrossRef]
- Lambert, C.; Poyart, C.; Gruss, A.; Fouet, A. FabT, a bacterial transcriptional repressor that limits futile fatty acid biosynthesis. Microbiol. Mol. Biol. Rev. 2022, 86, e0002922. [Google Scholar] [CrossRef]
- McNaught, K.J.; Kuatsjah, E.; Zahn, M.; Prates, É.T.; Shao, H.; Bentley, G.J.; Pickford, A.R.; Gruber, J.N.; Hestmark, K.V.; Jacobson, D.A.; et al. Initiation of fatty acid biosynthesis in Pseudomonas putida KT2440. Metab. Eng. 2023, 76, 193–203. [Google Scholar] [CrossRef]
- Radka, C.D.; Rock, C.O. Mining fatty acid biosynthesis for new antimicrobials. Annu. Rev. Microbiol. 2022, 76, 281–304. [Google Scholar] [CrossRef]
- Chirgadze, N.Y.; Briggs, S.L.; McAllister, K.A.; Fischl, A.S.; Zhao, G. Crystal structure of Streptococcus pneumoniae acyl carrier protein synthase: An essential enzyme in bacterial fatty acid biosynthesis. Embo J. 2000, 19, 5281–5287. [Google Scholar] [CrossRef]
- Hong, S.K.; Kim, K.H.; Park, J.K.; Jeong, K.W.; Kim, Y.; Kim, E.E. New design platform for malonyl-CoA-acyl carrier protein transacylase. FEBS Lett. 2010, 584, 1240–1244. [Google Scholar] [CrossRef]
- Whaley, S.G.; Radka, C.D.; Subramanian, C.; Frank, M.W.; Rock, C.O. Malonyl-acyl carrier protein decarboxylase activity promotes fatty acid and cell envelope biosynthesis in Proteobacteria. J. Biol. Chem. 2021, 297, 101434. [Google Scholar] [CrossRef]
- Cross, E.M.; Adams, F.G.; Waters, J.K.; Aragão, D.; Eijkelkamp, B.A.; Forwood, J.K. Insights into acinetobacter baumannii fatty acid synthesis 3-oxoacyl-ACP reductases. Sci. Rep. 2021, 11, 7050. [Google Scholar] [CrossRef]
- Khan, R.; Zeb, A.; Roy, N.; Thapa Magar, R.; Kim, H.J.; Lee, K.W.; Lee, S.W. Biochemical and structural basis of triclosan resistance in a novel enoyl-acyl carrier protein reductase. Antimicrob. Agents Chemother. 2018, 62, e00648-18. [Google Scholar] [CrossRef]
- Joseph-McCarthy, D.; Parris, K.; Huang, A.; Failli, A.; Quagliato, D.; Dushin, E.G.; Novikova, E.; Severina, E.; Tuckman, M.; Petersen, P.J.; et al. Use of structure-based drug design approaches to obtain novel anthranilic acid acyl carrier protein synthase inhibitors. J. Med. Chem. 2005, 48, 7960–7969. [Google Scholar] [CrossRef]
- Pang, D.R.; Wang, W.F.; Li, E.N.; Shen, W.Z.; Mu, L.X.; Liao, S.T.; Liu, F. Sanggenon D from root bark of mulberry inhibits the growth of Staphylococcus aureus by moderating the fatty acid biosynthesis system. Ind. Crop. Prod. 2019, 140, 111719. [Google Scholar] [CrossRef]
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
gyrB | CTGCCCCAAGTTAACCCGAT | TGGCATTGCGCTGAATGAAC |
acpS | TTGGGTGGAGGAGAAGGACT | ACCTTCGCAGAACACCATCG |
fabD | CAGCCAACCACAATGGCAAA | CGGTTCCATATGAGCCGTGT |
fabH | TTGCTACTCAACCGCTCTGG | CAGAGAAGAGGAAGGCGGTG |
fabG | GTCAGTGGTAGGTCTGCTCG | AAACAAGCTTCTCCGGCAGT |
fabI | CGATGCACACCTCTATCGCT | GGATCGAGTTTGCGAACAGC |
No | Component Name | Retention Time (min) | Molecular Formula | [M–H]− |
---|---|---|---|---|
1 | Coelonin | 29.5 | C15H14O3 | 241.0697 |
2 | 2,4,7-Trimethoxy-9,10-dihydrophenanthrene | 34.2 | C17H18O3 | 269.0623 |
3 | 1,3-Dimethoxy-5-phenethylbenzene | 35.9 | C16H18O2 | 241.0693 |
4 | 3,5-Dimethoxybibenzyl | 38.0 | C15H16O3 | 243.0849 |
5 | 3,3′-Dihydroxy-4-(p-hydroxybenzyl)-5-methoxybibenzyl | 42.0 | C22H22O4 | 349.1187 |
6 | 3,3′-Dihydroxy-2-(p-hydroxybenzyl)-5-methoxybibenzyl | 42.7 | C22H22O4 | 349.1185 |
7 | Bulbocodin D | 43.7 | C29H28O5 | 455.1524 |
8 | 3′,5-Dihydroxy-2-(p-hydroxybenzyl)-3-methoxybibenzyl | 44.7 | C22H22O4 | 349.1186 |
9 | Gymconopin D | 49.1 | C23H24O4 | 363.1329 |
10 | Bulbocol | 49.9 | C23H24O4 | 363.1329 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, Q.; Sun, L.; Peng, F.; Sun, C.; Xiong, F.; Sun, M.; Liu, J.; Peng, C.; Zhou, Q. Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane. Microorganisms 2023, 11, 2958. https://doi.org/10.3390/microorganisms11122958
Yu Q, Sun L, Peng F, Sun C, Xiong F, Sun M, Liu J, Peng C, Zhou Q. Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane. Microorganisms. 2023; 11(12):2958. https://doi.org/10.3390/microorganisms11122958
Chicago/Turabian StyleYu, Qian, Luyao Sun, Fu Peng, Chen Sun, Fang Xiong, Meiji Sun, Juan Liu, Cheng Peng, and Qinmei Zhou. 2023. "Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane" Microorganisms 11, no. 12: 2958. https://doi.org/10.3390/microorganisms11122958