Next Article in Journal
Rumen and Fecal Microbiota Characteristics of Qinchuan Cattle with Divergent Residual Feed Intake
Previous Article in Journal
β-Alanine Metabolism Leads to Increased Extracellular pH during the Heterotrophic Ammonia Oxidation of Pseudomonas putida Y-9
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 11
Issue 2
10.3390/microorganisms11020357
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Records of Possibly Human Pathogenic Rickettsia Species in Bat Ticks, Carios vespertilionis, in Sweden

by
Eszter Tompa
1,*,
Thomas G. T. Jaenson
2 and
Peter Wilhelmsson
1,3
1
Department of Biomedical and Clinical Sciences, Division of Inflammation and Infection, Linköping University, 581 83 Linköping, Sweden
2
Evolutionary Biology Centre, Department of Organismal Biology, Uppsala University, 752 36 Uppsala, Sweden
3
Department of Clinical Microbiology, Region Jönköping County, 553 05 Jönköping, Sweden
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(2), 357; https://doi.org/10.3390/microorganisms11020357
Submission received: 22 November 2022 / Revised: 15 January 2023 / Accepted: 24 January 2023 / Published: 31 January 2023
(This article belongs to the Section Medical Microbiology)
Browse Figures
Review Reports Versions Notes

Abstract

:
The Soprano pipistrelle bat, Pipistrellus pygmaeus, is a common species in large parts of Sweden. Many of its natural habitats are near human habitations. This creates opportunities for ticks infesting these bats to encounter humans and possibly transmit zoonotic pathogens by tick bites. The bats are often infested with Carios vespertilionis, a tick species that, in addition to bats, has been recorded to bite humans on occasion. This study aimed to investigate if C. vespertilionis acts as a reservoir for Anaplasma phagocytophilum, Neoehrlichia mikurensis, Tick-borne encephalitis virus, and species of Babesia and Rickettsia and to improve currently used conventional PCR protocols for molecular species determination of Rickettsia spp. Ninety-two C. vespertilionis ticks were collected from underneath a bat-box harbouring P. pygmaeus. Pathogen-specific PCR assays showed that 58.4% were positive for Rickettsia spp. and negative for the other pathogens analysed. Phylogenetic analyses indicate that the species belong to R. parkeri, R. conorii, R. slovaca, R. sibirica subsp. mongolotimonae, R. rickettsii, and a hitherto uncultured Rickettsia sp. Several of these species are considered pathogenic to humans. Given the ecology and behaviour of C. vespertilionis, it may be a vector of these rickettsiae among bats and occasionally humans. To determine the Rickettsia species with certainty, and to determine if C. vespertilionis may be a reservoir and vector of the Rickettsia spp., further studies are needed.

1. Introduction

Due to several recent outbreaks of serious infections caused by bat-associated pathogens, research on such pathogens has increased drastically during the past two decades [1]. Among approximately 1400 described bat species, 19 can be found in Sweden. The Soprano pipistrelle, Pipistrellus pygmaeus (Chiroptera; Vespertilionidae), is a common species in southern and south–central Sweden. This species prefers to rest and breed in hollow trees, attics, roof coverings, and wall cavities [2,3]. Many of the resting places of this bat species are near human living spaces, which creates an opportunity for bat ectoparasites, such as ticks, to blood-feed on humans and thus a potential to transmit pathogens to them [4,5].
European populations of P. pygmaeus are often infested by ticks, such as the Short-legged bat tick Carios vespertilionis (Ixodida; Argasidae). To this date, this is the only argasid species and the only bat-associated species recorded from Sweden [4]. This tick species is usually host-specific to bats but has been described as ‘highly aggressive’, with a few reports of occasional infestations on humans, dogs, and birds [4,5,6].
Several bacterial, viral, and protozoan pathogens have been identified in C. vespertilionis ticks. However, the role of this species as a vector and/or a reservoir is still under debate. As far as we know, there is only one study where the prevalence and species of pathogens in C. vespertilionis in Sweden have been investigated. The ticks investigated in this study have previously been analysed for Borrelia spp. where a high prevalence of Borrelia of the relapsing fever group was found [7]. The identified species, Borrelia sp. CPB1, has also been identified in C. vespertilionis in France and could perhaps pose a threat to Pipistrellus bats [7,8]. There have been findings of microorganisms with known and unknown pathogenicity worldwide, as seen in Table 1. However, the prevalence of Anaplasma phagocytophilum, Babesia spp., Tick-borne encephalitis virus (TBEV), Neoehrlichia mikurensis, and Rickettsia spp. in C. vespertilionis ticks from Sweden has, to our knowledge, not been studied before.
As mentioned, the prevalence of Borrelia spp. in C. vespertilionis ticks has been reported earlier [7]. The present study investigated the role of C. vespertilionis as a potential reservoir of A. phagocytophilum, N. mikurensis, TBEV, and species of Babesia and Rickettsia. In particular, we investigated if the molecular species determination of Rickettsia spp. in C. vespertilionis ticks could be improved by complementing or exchanging the currently used conventional PCR protocols.

2. Materials and Methods

2.1. Sampling, Analyses, and Processing of Ticks

Full details of the sampling site, procedures for tick collection and identification, extraction of total nucleic acid, and synthesis of cDNA are available in the previous report [7].
In summary, ticks were collected from June to August in 2015 and 2018 from a tray placed underneath a bat box located at Snesslinge, province of Uppland, south–central Sweden (60°19.567 N, 18°15.067 E). In addition, one tick collected from inside a private house at Älmhult, province of Småland, southern Sweden (56°32.720 N, 13°52.667 E) in 2019 was included. All ticks were photographed and morphologically identified to life stage (larva, nymph, adult). Each tick was homogenised individually using a TissueLyser II (Qiagen, Hilden, Germany). The total nucleic acid (NA) was extracted, purified, and isolated using MagAttract® Viral RNA M48 kit in a BioRobot M48 workstation (Qiagen). The eluted NA was reverse-transcribed to cDNA using illustra™ Ready-to-Go RT-PCR Beads kits (GE Healthcare, Amersham Place, UK). The final product was frozen at −80 °C.

2.2. Detection of Anaplasma phagocytophilum

A TaqMan real-time PCR assay was used to detect A. phagocytophilum. The primers and probe used for the assay amplify a 64 bp long amplicon of the citrate synthase gene (gltA) of A. phagocytophilum (Table 2). A synthetic plasmid containing the target sequence (nucleotides 304 to 420 of the A. phagocytophilum gltA gene (GenBank: AF304137)) was synthesized and cloned into pUC57 vector (GenScript, Piscataway, NJ, USA) and used as a positive control. Further details of the method are described in an article by Henningsson et al. [13].

2.3. Detection of Babesia Species

An SYBR green real-time PCR assay was used to detect Babesia spp. The primers used for the assay amplify a 411–452 bp long amplicon of the 18S rRNA gene of Babesia (Table 2). A synthetic plasmid containing the target sequence (nucleotides 467 to 955) of the B. divergens 18S rRNA gene (GenBank: AJ439713) was synthesized and cloned into pUC57 vector (GenScript) and used as a positive control. Further details on the method are described in an article by Casati et al. [14].

2.4. Detection of Neoehrlichia mikurensis

An SYBR green real-time PCR assay was used to detect N. mikurensis. The primers used for the assay amplify a 107 bp long amplicon of the 16S rRNA gene of N. mikurensis [15] (Table 2). As a positive control, cDNA samples positive for N. mikurensis confirmed by sequencing in an earlier study [15] were used. Further details of the method are described in a previous article by Labbé Sandelin et al. [15].

2.5. Detection of TBEV

A duplex TaqMan real-time PCR assay was used for the detection of TBEV, as previously described by Schwaiger and Cassinotti, and Gäumann et al. [16,17]. The primers and probes are designed to target all three subtypes of TBEV to amplify a 68 bp and an 88 bp long amplicon, respectively [16,17] (Table 2).

2.6. Detection of Rickettsia and Determination of Species

A TaqMan real-time PCR assay with primers designed to target the gltA gene of Rickettsia spp. was used to detect Rickettsia spp. as previously described [7,18]. The primers and probe used in the assay amplify a 74 bp long amplicon (Table 2) [18]. A synthetic plasmid containing the target sequence (nucleotides 1102 to 1231) of the R. rickettsii gltA gene (GeneBank: U59729) was synthesized and cloned into pUC57 vector (GenScript) and used as a positive control.
The samples positive in the TaqMan real-time PCR assay were further analysed using conventional PCR assays where fragments of the genes coding for outer membrane proteins A and B (ompA, ompB), 17 kDa, gltA (I and II), and 16S rRNA (rrs) genes were amplified as previously described (Table 2) [18,19,20,21,22]. The gltA gene was amplified both using a conventional PCR assay and a semi-nested PCR assay (Table 2) [21,22]. The PCR products amplified by the conventional PCR assays were sequenced by Macrogen Inc. (Amsterdam, The Netherlands). All sequences were confirmed by sequencing both strands. The obtained chromatograms were edited and analysed using BioEdit v7.0 (Tom Hall, Ibis Therapeutics, Carlsbad, CA, USA). The edited sequences were compared to existing sequences in the Basic Local Alignment Search Tool (BLAST).

2.7. Phylogenetic Analyses

Phylogenetic trees were constructed with MEGA11 by maximum likelihood using the Kimura 2-parameter. Complete deletion with a bootstrap value of 500 replicates was used.

3. Results

3.1. Number of Ticks Collected

A total of 92 ticks were collected in the province of Uppland, south–central Sweden, in the summers of 2015 and 2018. In addition, one specimen was collected in the province of Småland, southern Sweden, in 2019. Of these, 28 ticks were collected in 2015, and 63 were collected in 2018. All ticks were microscopically identified as C. vespertilionis. Of all 92 ticks, 48 were identified as nymphs, 31 as larvae, and 13 as adults (Table 3). These results have been reported earlier [7].

3.2. Prevalence of Rickettsia

Of the 92 examined ticks, 54 (58.7%) were determined to be Rickettsia-positive using the real-time PCR assay, including the adult tick from Småland. Of these 54 ticks, 77% (10/13) were adults, 56.3% (27/48) were nymphs, and 56.7% (17/31) were larvae, as seen in Table 3. Of the ticks collected in 2015, 50% (14/28) were positive for Rickettsia, and 62% (39/63) of ticks collected in 2018 were positive for Rickettsia.

3.3. Sequencing of PCR Products and Phylogenetic Sequence Analysis

The results of the amplification and sequencing of the ompA, ompB, rrs, gltA (I), gltA (II), and 17 kDa amplicons can be seen in Table 4.
Seven samples could not be analysed using the ompA, rrs, and the gltA (II) PCR protocols due to insufficient volumes of NA. As seen in Table 4, the amplification and sequencing of the ompA gene amplicon was successful in 9 of 47 samples, including the tick from Småland. All nine samples, referred to as ‘Rickettsia sp. AvBat ompA’ in Table 4, showed 100% identity (305/305) with Rickettsia parkeri (accession no. MK801772.1).
Further, the amplification and sequencing of the ompB gene amplicon was successful in 49 of 54 samples, including the tick from Småland. Of these, 47 sequences, referred to as ‘Rickettsia sp. AvBat ompB’ in Table 4, were identical to each other and showed 100% sequence identity (250/250) with those of Rickettsia parkeri (accession no. KY124259), Rickettsia slovaca (accession no. AF123723), Rickettsia conorii (accession no. AF149110), and Rickettsia sibirica sub-species mongolotimonae (accession no. AF123715). One sequence referred to as ‘Rickettsia sp. AvBat ompB nymph 229 Uppland 2018’ in Table 4, showed 99.6% sequence identity (251/252) with the aforementioned sequences, and the other sequence, referred to as ‘Rickettsia sp. AvBat ompB nymph 191 Uppland 2018’ in Table 4, showed 98.8% sequence identity (249/252) with the aforementioned sequences.
Four of the forty-seven samples could be successfully amplified and sequenced using the rrs gene amplicon. Two samples referred to as ‘Rickettsia sp. AvBat rrs’ in Table 4 were identical to each other and showed 100% sequence identity (1356/1356) to an uncultured Rickettsia species (accession no. MG827267.1). One sample referred to as ‘Rickettsia sp. AvBat rrs nymph 159 Uppland 2018’ showed a 99.4% sequence identity (1248/1256) with the aforementioned sequence. Finally, one sample referred to as ‘Rickettsia sp. AvBat rrs nymph 161 Uppland 2018’ showed a 94.7% sequence identity (1325/1399) with Rickettsia conorii (accession no. NR_074480.2).
One gltA (II) gene amplicon could be successfully sequenced. This sample, referred to as ‘Rickettsia sp. AvBat gltA adult 179 2018 Uppland’ in Table 4, showed 100% sequence identity (333/333) with Rickettsia parkeri (accession no. MK814825.1).
Amplification and sequencing of the gltA (I) gene amplicon was successful in 43 samples, including the tick from Småland. All sequences referred to as ‘Rickettsia sp. AvBat gltA’ in Figure 1 and Table 4 were identical to each other and showed 100% sequence identity (795/795) with Rickettsia parkeri (accession no. MN388794).
Amplification and sequencing of the 17 kDa gene amplicon was successful in 32 samples, including the tick from Småland. All sequences referred to as ‘Rickettsia sp. AvBat 17 kDa’ in Figure 2 and Table 4 were identical to each other and showed a 100% sequence identity (434/434) with Rickettsia rickettsii (accession no. DQ176856.1).
All consensus sequences obtained and used for BLAST search in this study can be found in Supplementary File S1.

3.4. Prevalence of Other Tick-Borne Microorganisms

All ticks, including the tick from Småland, were negative for A. phagocytophilum, N. mikurensis, Babesia spp., and TBEV.

3.5. Co-Infections

A high prevalence of species belonging to the relapsing fever Borrelia complex has been described in a previous report [7]. Of the ticks collected from below the bat box, 16.5% (15/91) were co-infected with Borrelia sp. and Rickettsia sp. We collected 3 of these ticks (2 nymphs and 1 adult) in 2015 and 12 ticks (8 larvae and 4 nymphs) in 2018. The tick from Småland was co-infected with Borrelia sp. and Rickettsia sp.

4. Discussion

The only argasid tick species recorded in Sweden is C. vespertilionis. This species is also the only known bat-associated tick species in Sweden, making it a highly interesting species to investigate [4]. There is, as far as we know, no previous Swedish record of any Rickettsia species from this tick species or from any bat species in Sweden. Rickettsia spp. were identified in almost two-thirds (58.7%) of the investigated ticks. The phylogenetic analyses of the genes gltA and 17 kDa, and the sequencing of the amplicons from ompA, ompB, and rrs indicate that the specific species identified in this study are phylogenetically close to R. parkeri, R. conorii, R. slovaca, R. sibirica subsp. mongolotimonae, R. rickettsii, and an uncultured Rickettsia sp. The pre-dominant Rickettsia species found in I. ricinus ticks in Sweden is R. helvetica [21,23]. Moreover, there is a single record of R. sibirica from I. ricinus [21]. In addition, R. felis infections have been diagnosed in two human patients with sub-acute meningitis [24]. R. aeschlimannii has been identified in adult Hyalomma ticks in Sweden. However, members of this tick genus are not (yet) considered to be permanently present in Sweden [23].
The species R. conorii, R. slovaca, and R. sibirica subsp. mongolotimonae are under surveillance in many European countries as they are pathogenic to humans [25]. Sub-species of R. conorii cause Mediterranean spotted fever (MSF). In European patients, fatality or complications have been seen in up to 32% of cases. They are caused by different sub-species of R. conorii and involve many medical factors such as delayed and incorrect treatment, delayed diagnosis, and co-morbidities [25,26,27]. R. slovaca is one of the causative species of Scalp Eschar and Neck Lymphadenopathy After Tick Bite (SENLAT), a disease associated with several painful symptoms and fatigue which can become chronic [26,28]. To this date, there are at least 27 reports of human cases of R. sibirica subsp. mongolotimonae rickettsioses [26]. Infections are usually mild, but cases with acute renal failure, retinal vasculitis, hyponatremia, and lethargy have been reported [29]. R. rickettsii and R. parkeri are currently not under surveillance in any European country [25]. Therefore, information on any European cases of rickettsioses caused by these species is scarce. There have been around 15 confirmed human cases of R. parkeri rikettsiosis in the Western hemisphere between 2004 and 2013, all with mild clinical outcomes [28]. For this reason, R. parkeri might not require extensive surveillance. R. rickettsii, however, is the causative of Rocky Mountain Spotted Fever (RMSF) in the Americas. For reasons yet to be fully understood, the fatality rates of RMSF varies widely among different strains in the US, and there have been outbreaks in Mexico and Panama with rates as high as 38% and 100% [28].
The known vectors for R. conorii are Dermacentor spp. and Rhipicephalus spp. [6,25,26,27]. The vectors for R. sibirica subsp. mongolotimonae are Hyalomma spp. and Rhipicephalus pusillus. However, the vectors in Europe are unknown [6,25,26]. There are studies that implicate the involvement of R. sanguineus s.l. in the transmission of R. conorii and R. rickettsii [6]. Species of Dermacentor and Amblyomma and are known vectors for the R. rickettsii in the Americas [28]. The vectors of R. slovaca are D. marginatus and D. reticulatus [6,25,26,27]. Lastly, the vectors of R. parkeri are D. variabilis and species of Amblyomma [28].
As seen in Table 1, there have been findings of Rickettsia spp. in C. vespertilionis ticks. Notably, R. rickettsii was identified in C. vespertilionis ticks in China [12]. This information and the findings of our study indicate that this tick species may have a role as a vector and/or reservoir for Rickettsia sp. in Sweden. Thorough further investigations on more tick specimens from different geographic areas and possibly from different mammalian hosts are needed to confirm this.
Rickettsioses are among the oldest known vector-borne diseases. Knowledge about their medical importance has increased dramatically during the past 25 years [26,30]. There are currently 29 acknowledged species of the Rickettsia genus. The species are phylogenetically divided into separate groups: the spotted fever group (SFG), the typhus group (TG), the R. bellii group, and the R. canadensis group [30]. The TG consists of the species R. typhi and R. prowazekii, with fleas and body lice as their respective vectors [25]. Epidemic typhus, caused by R. prowazekii, is not considered to be present in Europe [25,26]. Murine typhus, caused by R. typhi, is not present in Sweden, but a few imported cases occur each year [31]. The SFG contains the majority of all species that cause disease in humans. The more than 20 species are primarily transmitted by many different tick species, such as Rhipicephalus spp., Ixodes spp., and Dermacentor spp. [25,26,28,30].
As the knowledge on rickettsiae has increased, many species that were initially classified to the order Rickettsiales have been moved to other orders [26,28]. The guidelines for classification and species determination of the genus Rickettsia are an ongoing discussion among rickettsiologists around the world [26,28]. Cultivation of rickettsiae is limited to tissue cultures, guinea pigs, and embryonated chicken eggs as these bacteria are strictly intra-cellular. Staining is also more challenging as regularly used methods cannot be used [30]. More recently proposed guidelines for taxonomic classification of Rickettsia are sequencing of the genes rrs, gltA, ompA, ompB, and gene D and comparison of these to validated Rickettsia species [28,30,32]. The rrs gene has been suggested as the best tool for classification on a genus level and the ompA gene for classification into the SFG. In the case of the absence of ompA, these samples may still classify as a SFG Rickettsia if they show a certain degree of similarity with two of the genes rrs, gltA, ompB, or gene D from a validated Rickettsia species [32].
Based on this, we added three other conventional PCR protocols for rrs, gltA, and ompA, which had been created for and tested on Ixodes pacificus ticks [22], to our existing protocols. It was deemed that SFG Rickettsia was the most likely group of Rickettsia to be found in C. vespertilionis ticks. The TG species are transmitted by lice and fleas and, as mentioned above, are not present in Sweden [30,31]. While R. bellii is transmitted by many tick species, it has only been recorded in the Americas [28].
In terms of the number of successfully sequenced samples, the added protocols performed poorly compared with gltA (I), ompB, and 17 kDa. The analyses for gltA (I), ompB, and 17 kDa were performed in 2020, whereas the three additional genes were analysed in 2022. All used NAs were extracted at the same time and were stored in a −80 °C freezer. The cDNA was synthesised at several times over the years, last in 2022 when the analyses for rrs, gltA (II), and ompA were performed. Long-term storage of RNA and repeated freeze–thawing cycles can cause significant degradation [33,34]. We believe this may be the cause of the poor performance and suggest that, in the future, all cDNA should be synthesised shortly after the extraction of NA as it has increased stability compared to RNA. There is also the possibility of co-infections with several species of Rickettsia that cause interference in the obtained chromatograms from the sequencing. This cannot be investigated any further with the methods used in this study and is therefore of interest for future studies.
Several putative tick-borne pathogens, such as Borrelia sp., Ehrlichia sp., Babesia sp., and Bartonella sp., have been molecularly identified in C. vespertilionis ticks in Europe in previous studies [7,8,9,10,11]. However, with the use of molecular assays, it is not possible to distinguish if the genomes of the pathogens identified were viable nor if the genomes came from the tick or the bat host. As previously reported, nearly all investigated ticks contained host blood [7]. Therefore, the results of this study could indicate what microorganisms these bats are carrying. Obtaining ethical approvals for sampling P. pipistrellus bats in Sweden may be difficult as all bat species in Sweden are protected by law [35]. As earlier stated, P. pygmaeus bats often live in close proximity to humans. This creates an opportunity for C. vespertilionis ticks to bite humans and possibly transmit pathogens. For these reasons, it is of particular interest to investigate what pathogens C. vespertilionis contain.
In this study, we found indications of several human pathogenic species of Rickettsia in the investigated ticks. Our results reflect that the taxonomic classification on a species level of Rickettsia is often faced with difficulties. Due to the fact that several of the species pose a potential danger to humans, it is of importance to further investigate the host associations of the Rickettsia species, their potential to be transmitted horizontally and/or vertically by C. vespertilionis, and their geographical distribution.

5. Conclusions

The ticks investigated contain a high prevalence of Rickettsia species. Several of the species possibly belong to the SFG, which contains human-pathogenic species. Further studies are needed to determine with certainty the species identity of these rickettsiae species detected in C. vespertilionis and to determine if this tick species is a reservoir and vector of these rickettsiae.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms11020357/s1, Supplementary File S1: Aligned rickettsial nucleotide sequences based on PCR-products.

Author Contributions

Conceptualization, T.G.T.J. and P.W.; Formal analysis, E.T. and P.W.; Funding acquisition, T.G.T.J. and P.W.; Investigation, E.T., T.G.T.J. and P.W.; Methodology, T.G.T.J. and P.W.; Resources, T.G.T.J. and P.W.; Supervision, P.W.; Visualization, E.T. and P.W.; Writing—original draft, E.T.; Writing—review and editing, E.T., T.G.T.J. and P.W. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by Carl Tryggers stiftelse; Helge Ax:son Johnsons stiftelse; Längmanska kulturfonden (BA 20-1831); Magnus Bergvalls stiftelse (2022-425); the Medical Research Council of Southeast Sweden (FORSS, 931010); and the Division of Laboratory Medicine, Region Jönköping County. The work was carried out under the auspices of ESGBOR (the European Study Group on Lyme Borrelioses) and VectorNet, a European network for sharing data on the geographic distribution of arthropod vectors and transmitting human and animal disease agents (framework contract OC/EFSA/AHAW/2013/02FWC1), funded by the European Food Safety Authority (EFSA) and the European Centre for Disease prevention and Control (ECDC).

Institutional Review Board Statement

No ethical approvals were needed for this study as the analyses were performed on nucleic acid from ticks collected underneath a bat house.

Data Availability Statement

The data supporting the conclusions of this article are included within the article. Raw data can be shared with researchers upon request.

Acknowledgments

We are most grateful to Lars-Eric Roxin for constructing the bat house and for collecting the ticks and to Håkan Lundkvist for collecting the tick at Älmhult, Småland.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Brook, C.E.; Dobson, A.P. Bats as ‘special’ reservoirs for emerging zoonotic pathogens. Trends Microbiol. 2015, 23, 172–180. [Google Scholar] [CrossRef] [PubMed]
  2. Ahlén, I. Agreement on the Conservation of Bats in Europe—National Implementation Report from Sweden 2006; Swedish Enviromental Protection Agency: Stockholm, Sweden, 2006; p. 10. [Google Scholar]
  3. Naturvårdsverket. Fladdermusarter i Sverige. Available online: https://www.naturvardsverket.se/amnesomraden/arter-och-artskydd/fladdermossen-i-sverige/fladdermusarter-i-sverige/ (accessed on 2 May 2022).
  4. Jaenson, T.G.T.; Tälleklint, L.; Lundqvist, L.; Olsen, B.; Chirico, J.; Mejlon, H. Geographical distribution, host associations, and vector roles of ticks (Acari: Ixodidae, Argasidae) in Sweden. J. Med. Entomol. 1994, 31, 240–256. [Google Scholar] [CrossRef] [PubMed]
  5. Péter, Á.; Barti, L.; Corduneanu, A.; Hornok, S.; Mihalca, A.D.; Sándor, A.D. First record of Ixodes Simplex found on a human host, with a review of cases of human infestation by bat tick species occurring in Europe. Ticks Tick-Borne Dis. 2021, 12, 101722. [Google Scholar] [CrossRef]
  6. Estrada-Peña, A.; Mihalca, A.D.; Petney, T.N. (Eds.) Ticks of Europe and North Africa; Springer International Publishing: Cham, Switzerland, 2017; ISBN 978-3-319-63759-4. [Google Scholar]
  7. Jaenson, T.G.T.; Wilhelmsson, P. First record of a suspected human-pathogenic Borrelia species in populations of the bat tick Carios vespertilionis in Sweden. Microorganisms 2021, 9, 1100. [Google Scholar] [CrossRef]
  8. Socolovschi, C.; Kernif, T.; Raoult, D.; Parola, P. Borrelia, Rickettsia, and Ehrlichia species in bat ticks, France, 2010. Emerg. Infect. Dis. 2012, 18, 1966–1975. [Google Scholar] [CrossRef] [PubMed]
  9. Hornok, S.; Szőke, K.; Meli, M.L.; Sándor, A.D.; Görföl, T.; Estók, P.; Wang, Y.; Tu, V.T.; Kováts, D.; Boldogh, S.A.; et al. Molecular detection of vector-borne bacteria in bat ticks (Acari: Ixodidae, Argasidae) from eight countries of the Old and New Worlds. Parasites Vectors 2019, 12, 50. [Google Scholar] [CrossRef] [Green Version]
  10. Hornok, S.; Szőke, K.; Görföl, T.; Földvári, G.; Tu, V.T.; Takács, N.; Kontschán, J.; Sándor, A.D.; Estók, P.; Epis, S.; et al. Molecular investigations of the bat tick Argas vespertilionis (Ixodida: Argasidae) and Babesia vesperuginis (Apicomplexa: Piroplasmida) reflect “bat connection” between Central Europe and Central Asia. Exp. Appl. Acarol. 2017, 72, 69–77. [Google Scholar] [CrossRef]
  11. Lv, J.; Fernández de Marco, M.d.M.; Goharriz, H.; Phipps, L.P.; McElhinney, L.M.; Hernández-Triana, L.M.; Wu, S.; Lin, X.; Fooks, A.R.; Johnson, N. Detection of tick-borne bacteria and Babesia with zoonotic potential in Argas (Carios) vespertilionis (Latreille, 1802) ticks from british bats. Sci. Rep. 2018, 8, 1865. [Google Scholar] [CrossRef] [Green Version]
  12. Zhao, S.; Yang, M.; Liu, G.; Hornok, S.; Zhao, S.; Sang, C.; Tan, W.; Wang, Y. Rickettsiae in the common pipistrelle Pipistrellus pipistrellus (Chiroptera: Vespertilionidae) and the bat soft tick Argas vespertilionis (Ixodida: Argasidae). Parasites Vectors 2020, 13, 10. [Google Scholar] [CrossRef]
  13. Henningsson, A.J.; Hvidsten, D.; Kristiansen, B.-E.; Matussek, A.; Stuen, S.; Jenkins, A. Detection of Anaplasma phagocytophilum in Ixodes ricinus ticks from Norway using a realtime PCR assay targeting the Anaplasma citrate synthase gene gltA. BMC Microbiol. 2015, 15, 153. [Google Scholar] [CrossRef]
  14. Casati, S.; Sager, H.; Gern, L.; Piffaretti, J.-C. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann. Agric. Environ. Med. 2006, 13, 65–70. [Google Scholar] [PubMed]
  15. Labbé Sandelin, L.; Tolf, C.; Larsson, S.; Wilhelmsson, P.; Salaneck, E.; Jaenson, T.G.T.; Lindgren, P.-E.; Olsen, B.; Waldenström, J. Candidatus Neoehrlichia mikurensis in ticks from migrating birds in Sweden. PLoS ONE 2015, 10, e0133250. [Google Scholar] [CrossRef] [PubMed]
  16. Schwaiger, M.; Cassinotti, P. Development of a quantitative real-time RT-PCR Assay with internal control for the laboratory detection of tick borne encephalitis virus (TBEV) RNA. J. Clin. Virol. 2003, 27, 136–145. [Google Scholar] [CrossRef]
  17. Gäumann, R.; Mühlemann, K.; Strasser, M.; Beuret, C.M. High-throughput procedure for tick surveys of tick-borne encephalitis virus and its application in a national surveillance study in Switzerland. AEM 2010, 76, 4241–4249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Stenos, J.; Unsworth, N.B.; Graves, S.R. A highly sensitive and specific real-time PCR assay for the detection of spotted fever and typhus group Rickettsiae. Am. J. Trop. Med. Hyg. 2005, 73, 1083–1085. [Google Scholar] [CrossRef] [PubMed]
  19. Carl, M.; Tibbs, C.W.; Dobson, M.E.; Paparello, S.F.; Dasch, G.A. Diagnosis of acute typhus infection using the polymerase chain reaction. Ann. N. Y. Acad. Sci. 1990, 590, 439–444. [Google Scholar] [CrossRef]
  20. Choi, Y.-J.; Lee, S.-H.; Park, K.-H.; Koh, Y.-S.; Lee, K.-H.; Baik, H.-S.; Choi, M.-S.; Kim, I.-S.; Jang, W.-J. Evaluation of PCR-based assay for diagnosis of spotted fever group Rickettsiosis in human serum samples. CVI 2005, 12, 759–763. [Google Scholar] [CrossRef] [Green Version]
  21. Wallménius, K.; Pettersson, J.H.-O.; Jaenson, T.G.T.; Nilsson, K. Prevalence of Rickettsia spp., Anaplasma phagocytophilum, and Coxiella burnetii in adult Ixodes ricinus ticks from 29 study areas in central and southern Sweden. Ticks Tick-Borne Dis. 2012, 3, 100–106. [Google Scholar] [CrossRef]
  22. Phan, J.N.; Lu, C.R.; Bender, W.G.; Smoak, R.M.; Zhong, J. Molecular detection and identification of Rickettsia species in Ixodes pacificus in California. Vector-Borne Zoonotic Dis. 2011, 11, 957–961. [Google Scholar] [CrossRef] [Green Version]
  23. Lindblom, A.; Severinson, K.; Nilsson, K. Rickettsia felis infection in Sweden: Report of two cases with subacute meningitis and review of the literature. Scand. J. Infect. Dis. 2010, 42, 906–909. [Google Scholar] [CrossRef]
  24. Grandi, G.; Chitimia-Dobler, L.; Choklikitumnuey, P.; Strube, C.; Springer, A.; Albihn, A.; Jaenson, T.G.T.; Omazic, A. First records of adult Hyalomma marginatum and H. rufipes ticks (Acari: Ixodidae) in Sweden. Ticks Tick-Borne Dis. 2020, 11, 101403. [Google Scholar] [CrossRef]
  25. European Centre for Disease Prevention and Control. Epidemiological Situation of Rickettsioses in EU/EFTA Countries; Publications Office: Luxembourg, 2013. [Google Scholar]
  26. Portillo, A.; Santibáñez, S.; García-Álvarez, L.; Palomar, A.M.; Oteo, J.A. Rickettsioses in Europe. Microbes Infect. 2015, 17, 834–838. [Google Scholar] [CrossRef]
  27. Oteo, J.A.; Portillo, A. Tick-borne Rickettsioses in Europe. Ticks Tick-Borne Dis. 2012, 3, 271–278. [Google Scholar] [CrossRef] [PubMed]
  28. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.-E.; et al. Update on tick-Borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [Green Version]
  29. Ramos, J.M.; Jado, I.; Padilla, S.; Masiá, M.; Anda, P.; Gutiérrez, F. Human infection with Rickettsia sibirica mongolitimonae, Spain, 2007–2011. Emerg. Infect. Dis. 2013, 19, 267–269. [Google Scholar] [CrossRef] [PubMed]
  30. Fournier, P.-E.; Raoult, D. Chapter 69—Tick-borne Rickettsioses. In Hunter´s Tropical Medicine and Emerging Infectious Diseases; Elsevier: Edinburgh, UK, 2020; Volume 587–593, p. 1236. ISBN 978-0-323-62551-7. [Google Scholar]
  31. Sjukdomsinformation om Fläckfeber—Folkhälsomyndigheten. Available online: https://www.folkhalsomyndigheten.se/smittskydd-beredskap/smittsamma-sjukdomar/flackfeber-/ (accessed on 22 June 2022).
  32. Fournier, P.-E.; Dumler, J.S.; Greub, G.; Zhang, J.; Wu, Y.; Raoult, D. Gene sequence-based criteria for identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. Nov. J. Clin. Microbiol. 2003, 41, 5456–5465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Kellman, B.P.; Baghdassarian, H.M.; Pramparo, T.; Shamie, I.; Gazestani, V.; Begzati, A.; Li, S.; Nalabolu, S.; Murray, S.; Lopez, L.; et al. Multiple Freeze-Thaw cycles lead to a loss of consistency in poly(A)-enriched RNA sequencing. BMC Genom. 2021, 22, 69. [Google Scholar] [CrossRef]
  34. Olivieri, E.H.R.; de Andrade Franco, L.; Pereira, R.G.; Carvalho Mota, L.D.; Campos, A.H.J.F.M.; Carraro, D.M. Biobanking practice: RNA storage at low concentration affects integrity. Biopreservation Biobanking 2014, 12, 46–52. [Google Scholar] [CrossRef] [PubMed]
  35. Artdatabanken. Dvärgpipistrell Pipistrellus pygmaeus. Available online: https://artfakta.se/ (accessed on 22 May 2022).
Microorganisms 11 00357 g001 550
Figure 1. Phylogenetic tree based on gltA (I) gene sequences of Rickettsia species, constructed by maximum likelihood using Kimura 2-parameter and complete deletion. Sequences detected in our study (‘Rickettsia sp. AvBat gltA’, n = 43) are highlighted in bold. The reliability of the tree was tested by 500 bootstrap replicate analyses; only values greater than 50% are shown.
Figure 1. Phylogenetic tree based on gltA (I) gene sequences of Rickettsia species, constructed by maximum likelihood using Kimura 2-parameter and complete deletion. Sequences detected in our study (‘Rickettsia sp. AvBat gltA’, n = 43) are highlighted in bold. The reliability of the tree was tested by 500 bootstrap replicate analyses; only values greater than 50% are shown.
Microorganisms 11 00357 g001
Microorganisms 11 00357 g002 550
Figure 2. Phylogenetic tree based on 17 kDa gene sequences of Rickettsia species, constructed by maximum likelihood using Kimura 2-parameter and complete deletion. Sequences detected in our study (‘Rickettsia sp. AvBat 17 kDa’ n = 32) are highlighted in bold. The reliability of the tree was tested by 500 bootstrap replicate analyses; only values greater than 50% are shown.
Figure 2. Phylogenetic tree based on 17 kDa gene sequences of Rickettsia species, constructed by maximum likelihood using Kimura 2-parameter and complete deletion. Sequences detected in our study (‘Rickettsia sp. AvBat 17 kDa’ n = 32) are highlighted in bold. The reliability of the tree was tested by 500 bootstrap replicate analyses; only values greater than 50% are shown.
Microorganisms 11 00357 g002
Table
Table 1. Bacteria identified in C. vespertilionis ticks collected from different countries.
Table 1. Bacteria identified in C. vespertilionis ticks collected from different countries.
PathogenSpeciesCountryReference(s)
BorreliaBorrelia sp. CPB1France, Sweden[7,8]
Bartonella Hungary[9]
Babesia Hungary, Romania, Italy, Kenya, Vietnam, China
Finland, UK		[10]
[11]
EhrlichiaEhrlichia sp. AvBat
Ehrlichia spp.		France
United Kingdom		[8]
[11]
RickettsiaRickettsia sp. AvBatFrance[8]
SFG RickettsiaUnited Kingdom[11]
Rickettsia helveticaChina[9]
Rickettsia africae-likeHungary[9]
Rickettsia raoultii, Rickettsia rickettsiiChina[12]
Table
Table 2. Primers and probes used for molecular analysis of tick-borne pathogens.
Table 2. Primers and probes used for molecular analysis of tick-borne pathogens.
OrganismTargetPrimer/Probe NameSequence (5′-3′)Amplicon Length (bp)References
A. phagocytophilumgltAApFTTTTGGGCGCTGAATACGAT64[13]
ApRTCTCGAGGGAATGATCTAATAACGT
ApMFAM-TGCCTGAACAAGTTATG-BHQ1
Babesia spp. 18S rRNABJ1GTCTTGTAATTGGAATGATGG411–452[14]
BN2TAGTTTATGGTTAGGACTACG
N. mikurensis16S rRNANeo_16S_FGTAAAGGGCATGTAGGCGGTTTAA107[15]
Neo_16S_RTCCACTATCCTCTCTCGATCTCTAGTT TAA
11,054–1112 aF-TBE 1GGGCGGTTCTTGTTCTCC68[16]
TBEV R-TBE 1ACACATCACCTCCTTGTCAGACT
TBE-probe-WTFAM-TGAGCCACCATCACCCAG ACACA-BHQ1
1329–1416 aTBEE-F6GGCTTGTGAGGCAAAAAAGAA88[17]
TBEE-R2TCCCGTGTGTGGTTCGACTT
TBEE-P4HEX-AAGCCACAGGACATGTGTACG ACGCC-BHQ1
Rickettsia spp. gltACS-FTCGCAAATGTTCACGGTACTTT74[18]
CS-RTCGTGCATTTCTTTCCATTGTG
CS-PFAM-TGCAATAGCAAGAACCGTAGG CTGGATG-BHQ1
17 kDaRr17kDa.61pGCTCTTGCAACTTCTATGTT434[19]
Rr17kDa.492nCATTGTTCGTCAGGTTGGCG
ompBRc.rompB.4362pGTCAGCGTTACTTCTTCGATGC475[20]
Rc.rompB.4836nCCGTACTCCATCTTAGCATCAG
Rc.rompB.4496pCCAATGGCAGGACTTAGCTACT267
Rc.rompB.4762nAGGCTGGCTGATACACGGAGTAA
gltA (I)RH314AAACAGGTTGCTCATCATTC832[21]
CSF-RAAGTACCGTGAACATTTGCGA
CS-Ric-RCAGTGAACATTTGCGACGGTA
CS535dGCAATGTCTTATAAATATTCSP
gltA (II)ForwardGGCTAATGAAGCGGTAATAA ATATGCTT341[22]
ReverseTTTGCGACGGTATACCCATAGC
ompAForwardCACYACCTCAACCGCAGC438–444[22]
ReverseAAAGTTA TATTTCCTAAACCYGTATAAKTATCRGC
16S rRNAForwardTAAGGAGGTAATCCAGCC1482–1483[22]
ReverseCCTG GCTCAGAACGAA
a = Genome region of TBEV strain Neudoerfl (U27495) that is present in all three subtypes of TBEV. Abbreviations: FAM, 6-carboxyfluorescein; HEX, 5(6)-carboxyfluorescein; BHQ, Black Hole Quencher; SP, sequencing primer.
Table
Table 3. Tick-borne microorganisms detected in Carios vespertilionis ticks from the province of Uppland, in 2015 and 2018, and from the province of Småland, in 2019.
Table 3. Tick-borne microorganisms detected in Carios vespertilionis ticks from the province of Uppland, in 2015 and 2018, and from the province of Småland, in 2019.
Developmental StageNo. of Examined TicksRickettsia spp.A. phagocytophilumN. mikurensisBabesia spp.TBEV
Larva3117 (56.7)
Nymph4827 (56.3)
Adult a1310 (77.0)
Total9254 (58.7)0 0 0 0
a = One adult C. vespertilionis tick in this group was collected in the province of Småland.
Table
Table 4. Number of specimens with successful amplification of Rickettsia gene targets by conventional PCR assays. The sequences obtained from the amplification of the 17 kDa and gltA (I) genes have been used for phylogenetic assays.
Table 4. Number of specimens with successful amplification of Rickettsia gene targets by conventional PCR assays. The sequences obtained from the amplification of the 17 kDa and gltA (I) genes have been used for phylogenetic assays.
GeneNo. of Successfully Sequenced SamplesSampleSpeciesIdentity
17 kDa32/54Rickettsia sp. AvBat 17 kDaR. rickettsii100% (434/434)
gltA (I)43/54Rickettsia sp. AvBat gltAR. parkeri100% (795/795)
ompA9/47 *Rickettsia sp. AvBat ompAR. parkeri100% (305/305)
ompB49/54Rickettsia sp. AvBat ompBR. parkeri, R. slovaca, R. conorii, R. sibirica subsp. mongolotimonae100% (250/250)
Rickettsia sp. AvBat ompB nymph 229 Uppland 2018R. parkeri, R. slovaca, R. conorii, R. sibirica subsp. mongolotimonae99.6% (251/252)
Rickettsia sp. AvBat ompB nymph 191 Uppland 2018R. parkeri, R. slovaca, R. conorii, R. sibirica subsp. mongolotimonae98.8% (249/252)
gltA (II)1/47 *Rickettsia sp. AvBat gltA adult 179 Uppland 2018R. parkeri100% (333/333)
rrs4/47 *Rickettsia sp. AvBat rrsuncultured Rickettsia species100% (1256/1356)
Rickettsia sp. AvBat rrs nymph 159 Uppland 2018uncultured Rickettsia species99.4% (1248/1256)
Rickettsia sp. AvBat rrs nymph 161 Uppland 2018R. conorii94.7% (1325/1399)
* Seven samples could not be analysed due to insufficient volumes of NA.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tompa, E.; Jaenson, T.G.T.; Wilhelmsson, P. First Records of Possibly Human Pathogenic Rickettsia Species in Bat Ticks, Carios vespertilionis, in Sweden. Microorganisms 2023, 11, 357. https://doi.org/10.3390/microorganisms11020357

AMA Style

Tompa E, Jaenson TGT, Wilhelmsson P. First Records of Possibly Human Pathogenic Rickettsia Species in Bat Ticks, Carios vespertilionis, in Sweden. Microorganisms. 2023; 11(2):357. https://doi.org/10.3390/microorganisms11020357

Chicago/Turabian Style

Tompa, Eszter, Thomas G. T. Jaenson, and Peter Wilhelmsson. 2023. "First Records of Possibly Human Pathogenic Rickettsia Species in Bat Ticks, Carios vespertilionis, in Sweden" Microorganisms 11, no. 2: 357. https://doi.org/10.3390/microorganisms11020357

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop