Multiplexed Reverse Transcription Loop-Mediated Isothermal Amplification Coupled with a Nucleic Acid-Based Lateral Flow Dipstick as a Rapid Diagnostic Method to Detect SARS-CoV-2
Abstract
1. Introduction
2. Materials and Methods
2.1. Primer Design for PCR and LAMP Assays
2.2. Preparation of DNA Template
2.3. Recombinant Plasmid Construction for Positive Control for PCR and LAMP Analysis
2.4. RNA Synthesis for RT-LAMP Protocol Verification
2.5. Optimization of LAMP and RT-LAMP Reaction Condition with UV Analysis
2.6. Sensitivity Test for the Detection of SARS-CoV-2 Nucleocapsid, Envelope and Membrane Genes Using End Point-PCR and Quantitative PCR
2.7. Sensitivity Test for the Detection of SARS-CoV-2 Nucleocapsid, Envelope and Membrane Genes Using LAMP-UV, LAMP-SYBR Green and LAMP-LFD Analyses
2.8. Specificity Test of LAMP Assay
3. Results
3.1. LAMP and RT-LAMP Optimization Using UV Analyses
3.2. Sensitivity Test of End Point-PCR, Quantitative PCR, LAMP-UV and LAMP-SYBR for the Detection of SARS-CoV-2 Genes
3.3. Specificity Test of LAMP-UV, LAMP-SYBR Green and LAMP-LFD
3.4. Visualization of Multiplexed LAMP on a Single Strip of LFD
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| No. | Accession Number | Country of Origin |
|---|---|---|
| 1 | EPI_ISL_416866 | Malaysia |
| 2 | EPI_ISL_430441 | Malaysia |
| 3 | EPI_ISL_455312 | Malaysia |
| 4 | EPI_ISL_501182 | Malaysia |
| 5 | EPI_ISL_719133 | Malaysia |
| 6 | EPI_ISL_718138 | Malaysia |
| 7 | EPI_ISL_718174 | Malaysia |
| 8 | EPI_ISL_738086 | Malaysia |
| 9 | EPI_ISL_807150 | Malaysia |
| 10 | EPI_ISL_807153 | Malaysia |
| 11 | EPI_ISL_936488 | Malaysia |
| 12 | EPI_ISL_936495 | Malaysia |
| 13 | EPI_ISL_615652 | Denmark |
| 14 | EPI_ISL_616802 | Denmark |
| 15 | EPI_ISL_641491 | Denmark |
| 16 | EPI_ISL_581117 | United Kingdom |
| 17 | EPI_ISL_601443 | United Kingdom |
| 18 | EPI_ISL_678386 | Australia |
| 19 | EPI_ISL_728189 | Singapore |
| 20 | EPI_ISL_733573 | Hong Kong |
| 21 | EPI_ISL_739662 | Canada |
| 22 | EPI_ISL_745260 | Canada |
| 23 | EPI_ISL_755593 | USA |
| 24 | EPI_ISL_755594 | USA |
| 25 | EPI_ISL_755595 | USA |
| 26 | EPI_ISL_755627 | New Zealand |
| 27 | EPI_ISL_763074 | Brazil |
| 28 | EPI_ISL_794625 | New Zealand |
| 29 | EPI_ISL_803963 | Singapore |
| 30 | EPI_ISL_842652 | Argentina |
| 31 | EPI_ISL_843071 | United Kingdom |
| 32 | EPI_ISL_845923 | United Kingdom |
| 33 | EPI_ISL_846595 | United Kingdom |
| 34 | EPI_ISL_849760 | Australia |
| 35 | EPI_ISL_852526 | United Kingdom |
| 36 | EPI_ISL_678594 | South Africa |
| 37 | EPI_ISL_978596 | South Africa |
| 38 | EPI_ISL_678597 | South Africa |
| 39 | EPI_ISL_745169 | South Africa |
| 40 | EPI_ISL_762992 | South Korea |
| 41 | EPI_ISL_770472 | Botswana |
| 42 | EPI_ISL_825398 | Japan |
| 43 | EPI_ISL_825489 | South Africa |
| 44 | EPI_ISL_843196 | New Zealand |
| 45 | EPI_ISL_852547 | United Kingdom |
| 46 | EPI_ISL_855369 | France |
| 47 | EPI_ISL_855514 | Kenya |
| 48 | EPI_ISL_1562503 | USA |
| 49 | EPI_ISL_2550714 | Malaysia |
| 50 | EPI_ISL_2803686 | Zambia |
| 51 | EPI_ISL_2815331 | Malaysia |
| 52 | EPI_ISL_2839566 | Australia |
| 53 | EPI_ISL_2854187 | Malaysia |
| 54 | EPI_ISL_2868394 | Botswana |
| 55 | EPI_ISL_2876397 | South Africa |
| 56 | EPI_ISL_2924057 | Malaysia |
| 57 | EPI_ISL_2931921 | Malaysia |
| 58 | EPI_ISL_2984856 | South Africa |
| 59 | EPI_ISL_3019329 | India |
| 60 | EPI_ISL_3049843 | Kenya |
| 61 | EPI_ISL_3050795 | Australia |
| 62 | EPI_ISL_3060617 | India |
| 63 | EPI_ISL_3066408 | India |
| 64 | EPI_ISL_3066431 | India |
| 65 | EPI_ISL_3066449 | India |
| 66 | EPI_ISL_3067537 | USA |
| 67 | EPI_ISL_3071976 | USA |
| 68 | EPI_ISL_833366 | Japan |
| 69 | EPI_ISL_1250700 | New Zealand |
| 70 | EPI_ISL_1416322 | Australia |
| 71 | EPI_ISL_1428640 | Japan |
| 72 | EPI_ISL_1543939 | Singapore |
| 73 | EPI_ISL_1931621 | Japan |
| 74 | EPI_ISL_2349709 | Singapore |
| 75 | EPI_ISL_2769807 | Japan |
| 76 | EPI_ISL_2933406 | France |
| 77 | EPI_ISL_2956430 | Germany |
| 78 | EPI_ISL_2988020 | Turkiye |
| 79 | EPI_ISL_3033191 | USA |
| 80 | EPI_ISL_3043979 | Germany |
| 81 | EPI_ISL_3050309 | Brazil |
| 82 | EPI_ISL_3050508 | Brazil |
| 83 | EPI_ISL_3050610 | Brazil |
| 84 | EPI_ISL_3072221 | Brazil |
| 85 | EPI_ISL_3072616 | Brazil |
| 86 | EPI_ISL_3087264 | Belgium |
| 87 | EPI_ISL_3089659 | Canada |
| 88 | EPI_ISL_416036 | Brazil |
| 89 | EPI_ISL_431180 | Fujian |
| 90 | EPI_ISL_445380 | Thailand |
| 91 | EPI_ISL_490026 | Australia |
| 92 | EPI_ISL_508266 | India |
| 93 | EPI_ISL_522491 | South Korea |
| 94 | EPI_ISL_579320 | New Zealand |
| 95 | EPI_ISL_591450 | Japan |
| 96 | EPI_ISL_630998 | United Kingdom |
| 97 | EPI_ISL_640129 | South Africa |
| 98 | EPI_ISL_640130 | South Africa |
| 99 | EPI_ISL_672711 | Brazil |
| 100 | EPI_ISL_690818 | Japan |
| 101 | EPI_ISL_728187 | Singapore |
| 102 | EPI_ISL_732179 | Portugal |
| 103 | EPI_ISL_733300 | Russia |
| 104 | EPI_ISL_746686 | Chile |
| 105 | EPI_ISL_779245 | Japan |
| 106 | EPI_ISL_779617 | Australia |
| 107 | EPI_ISL_801402 | Brazil |
| 108 | EPI_ISL_850198 | South Korea |
| 109 | EPI_ISL_875048 | United Kingdom |
| 110 | EPI_ISL_877765 | Italy |
| 111 | EPI_ISL_901605 | Japan |
| 112 | EPI_ISL_920984 | Northern Ireland |
| 113 | EPI_ISL_941896 | Portugal |
| 114 | EPI_ISL_985178 | Brazil |
| 115 | EPI_ISL_1004317 | Switzerland |
| 116 | EPI_ISL_648527 | USA |
| 117 | EPI_ISL_707800 | New Zealand |
| 118 | EPI_ISL_717710 | Australia |
| 119 | EPI_ISL_755638 | New Zealand |
| 120 | EPI_ISL_768628 | Singapore |
| 121 | EPI_ISL_779199 | Japan |
| 122 | EPI_ISL_818613 | Denmark |
| 123 | EPI_ISL_846181 | United Kingdom |
| 124 | EPI_ISL_857314 | Taiwan |
| 125 | EPI_ISL_860112 | Japan |
| 126 | EPI_ISL_872584 | Australia |
| 127 | EPI_ISL_873881 | United Kingdom |
| 128 | EPI_ISL_904760 | Aruba |
| 129 | EPI_ISL_905242 | Aruba |
| 130 | EPI_ISL_956331 | Taiwan |
| 131 | EPI_ISL_967766 | USA |
| 132 | EPI_ISL_972791 | Denmark |
| 133 | EPI_ISL_982043 | USA |
| 134 | EPI_ISL_984780 | USA |
| 135 | EPI_ISL_985140 | USA |
| 136 | EPI_ISL_762449 | United Kingdom |
| 137 | EPI_ISL_906277 | Nigeria |
| 138 | EPI_ISL_944748 | Australia |
| 139 | EPI_ISL_995301 | Singapore |
| 140 | EPI_ISL_1168766 | USA |
| 141 | EPI_ISL_1168768 | USA |
| 142 | EPI_ISL_1173226 | Nigeria |
| 143 | EPI_ISL_1583653 | Brazil |
| 144 | EPI_ISL_1896666 | Denmark |
| 145 | EPI_ISL_1914650 | Singapore |
| 146 | EPI_ISL_2155777 | Philippines |
| 147 | EPI_ISL_2242809 | Nigeria |
| 148 | EPI_ISL_2385974 | Australia |
| 149 | EPI_ISL_2535627 | Malaysia |
| 150 | EPI_ISL_3031386 | Kenya |
| 151 | EPI_ISL_3063476 | Turkiye |
| 152 | EPI_ISL_3089260 | USA |
| 153 | EPI_ISL_861280 | USA |
| 154 | EPI_ISL_896394 | USA |
| 155 | EPI_ISL_1158385 | USA |
| 156 | EPI_ISL_1698346 | United Kingdom |
| 157 | EPI_ISL_1699692 | United Kingdom |
| 158 | EPI_ISL_1721838 | Germany |
| 159 | EPI_ISL_1994447 | USA |
| 160 | EPI_ISL_2254415 | USA |
| 161 | EPI_ISL_2967806 | Spain |
| 162 | EPI_ISL_3032634 | Turkiye |
| 163 | EPI_ISL_1360328 | India |
| 164 | EPI_ISL_1442952 | Singapore |
| 165 | EPI_ISL_1547802 | India |
| 166 | EPI_ISL_1623010 | Rep. Ireland |
| 167 | EPI_ISL_1647348 | South Korea |
| 168 | EPI_ISL_1663320 | India |
| 169 | EPI_ISL_1847409 | Germany |
| 170 | EPI_ISL_2710315 | South Africa |
| 171 | EPI_ISL_2762283 | Germany |
| 172 | EPI_ISL_2882750 | USA |
| 173 | EPI_ISL_1111128 | Peru |
| 174 | EPI_ISL_1111321 | Peru |
| 175 | EPI_ISL_1111341 | Peru |
| 176 | EPI_ISL_1445272 | Brazil |
| 177 | EPI_ISL_1477056 | Spain |
| 178 | EPI_ISL_1494722 | Australia |
| 179 | EPI_ISL_2492441 | Mexico |
| 180 | EPI_ISL_2508552 | Chile |
| 181 | EPI_ISL_2837340 | USA |
| 182 | EPI_ISL_2876943 | South Africa |
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A novel coronavirus from patients with pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef] [PubMed]
- Karami, H.; Sadeghi, K.; Zadheidar, S.; Saadatmand, F.; Mirsalehi, N.; Ardestani, N.H.; Mokhtari-Azad, T. Surveillance of endemic coronaviruses during the COVID-19 pandemic in Iran, 2021–2022. Influ. Other Respir. Viruses 2023, 17, e13128. [Google Scholar] [CrossRef]
- Su, S.; Wong, G.; Shi, W.; Liu, J.; Lai, A.C.; Zhou, J.; Gao, G.F. Epidemiology, genetic recombination, and pathogenesis of coronaviruses. Trends Microbiol. 2016, 24, 490–502. [Google Scholar] [CrossRef]
- Moguerza, J.M.; Oliver, S.P.; de Diego, I.M.; Aceña, V.; Lancho, C.; Cuesta, M.; Fernández, C.G. Health Sufficiency Indicators for Pandemic Monitoring. Int. J. Environ. Res. Public Health 2021, 18, 5358. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, S.J.R.; Pena, L. Collapse of the public health system and the emergence of new variants during the second wave of the COVID-19 pandemic in Brazil. One Health 2021, 13, 100287. [Google Scholar] [CrossRef] [PubMed]
- Williams, G.H.; Llewelyn, A.; Brandao, R.; Chowdhary, K.; Hardisty, K.M.; Loddo, M. SARS-CoV-2 testing and sequencing for international arrivals reveals significant cross border transmission of high risk variants into the United Kingdom. EClinicalMedicine 2021, 38, 101021. [Google Scholar] [CrossRef]
- Douglas, J.; Winter, D.; McNeill, A.; Carr, S.; Bunce, M.; French, N.; Geoghegan, J.L. Tracing the international arrivals of SARS-CoV-2 Omicron variants after Aotearoa New Zealand reopened its border. Nat. Commun. 2022, 13, 6484. [Google Scholar] [CrossRef]
- Laine, P.; Nihtilä, H.; Mustanoja, E.; Lyyski, A.; Ylinen, A.; Hurme, J.; Meri, T. SARS-CoV-2 variant with mutations in N gene affecting detection by widely used PCR primers. J. Med. Virol. 2022, 94, 1227–1231. [Google Scholar] [CrossRef]
- Rotondo, J.C.; Martini, F.; Maritati, M.; Caselli, E.; Gallenga, C.E.; Guarino, M.; Giorgio, R.D.; Mazziotta, C.; Tramarin, M.L.; Badiale, G.; et al. Advanced molecular and immunological diagnostic methods to detect SARS-CoV-2 infection. Microorganisms 2022, 10, 1193. [Google Scholar] [CrossRef]
- Vasudevan, H.N.; Xu, P.; Servellita, V.; Miller, S.; Liu, L.; Gopez, A.; Chiu, C.Y.; Abate, A.R. Digital droplet PCR accurately quantifies SARS-CoV-2 viral load from crude lysate without nucleic acid purification. Sci. Rep. 2021, 11, 780. [Google Scholar] [CrossRef]
- Jayamohan, H.; Lambert, C.J.; Sant, H.J.; Jafek, A.; Patel, D.; Feng, H.; Beeman, M.; Mahmood, T.; Nze, U.; Gale, B.K. SARS-CoV-2 pandemic: A review of molecular diagnostic tools including sample collection and commercial response with associated advantages and limitations. Anal. Bioanal. Chem. 2020, 413, 49–71. [Google Scholar] [CrossRef] [PubMed]
- Kevadiya, B.D.; Machhi, J.; Herskovitz, J. Diagnostics for SARS-CoV-2 infections. Nat. Mater. 2021, 20, 593–605. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.Y.; Yau, H.S.; Yu, M.Y.; Tsang, H.F.; Chan, L.W.C.; Cho, W.C.S.; Yu, A.C.S.; Yim, A.K.Y.; Li, M.J.W.; Wong, Y.K.E.; et al. The diagnostic methods in the COVID-19 pandemic, today and in the future. Expert Rev. Mol. Diagn. 2020, 20, 985–993. [Google Scholar] [CrossRef] [PubMed]
- Peaper, D.R.; Landry, M.L. Laboratory Diagnosis of Viral Infection. In Handbook of Clinical Neurology; Tselis, A.C., Booss, J., Eds.; Elsevier: Amsterdam, The Netherlands, 2014; Volume 123, pp. 123–147. [Google Scholar] [CrossRef]
- Tang, Y.W.; Schmitz, J.E.; Persing, D.H.; Stratton, C.W. Laboratory diagnosis of COVID-19: Current issues and challenges. J. Clin. Microbiol. 2020, 58, e00512-20. [Google Scholar] [CrossRef]
- Chaouch, M. Loop-Mediated Isothermal Amplification (LAMP): An Effective Molecular Point-of-Care Technique for the Rapid Diagnosis of Coronavirus SARS-CoV-2. Rev. Med. Virol. 2021, 31, e2215. [Google Scholar] [CrossRef] [PubMed]
- Moore, K.J.; Cahill, J.; Aidelberg, G.; Aronoff, R.; Bektaş, A.; Bezdan, D.; Butler, D.J.; Chittur, S.V.; Codyre, M.; Federici, F.; et al. Loop-mediated isothermal amplification detection of SARS-CoV-2 and myriad other applications. J. Biomol. Tech. 2021, 32, 228. [Google Scholar] [CrossRef] [PubMed]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-Mediated Isothermal Amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef]
- Mori, Y.; Notomi, T. Loop-Mediated Isothermal Amplification (LAMP): A rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother. 2009, 15, 62–69. [Google Scholar] [CrossRef]
- Curtis, K.A.; Morrison, D.; Rudolph, D.L.; Shankar, A.; Bloomfield, L.S.; Switzer, W.M.; Owen, S.M. A multiplexed RT-LAMP assay for detection of group M HIV-1 in plasma or whole blood. J. Virol. Methods 2018, 255, 91–97. [Google Scholar] [CrossRef]
- Kim, J.H.; Kang, M.; Park, E.; Chung, D.R.; Kim, J.; Hwang, E.S. A simple and multiplex Loop-Mediated Isothermal Amplification (LAMP) assay for rapid detection of SARS-CoV. BioChip J. 2019, 13, 341–351. [Google Scholar] [CrossRef]
- Shirato, K.; Yano, T.; Senba, S.; Akachi, S.; Kobayashi, T.; Nishinaka, T.; Notomi, T.; Matsuyama, S. Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP). Virol. J. 2014, 11, 139. [Google Scholar] [CrossRef] [PubMed]
- Geojith, G.; Dhanasekaran, S.; Chandran, S.P.; Kenneth, J. Efficacy of loop mediated isothermal amplification (LAMP) assay for the laboratory identification of Mycobacterium tuberculosis isolates in a resource limited setting. J. Microbiol. Methods 2011, 84, 71–73. [Google Scholar] [CrossRef] [PubMed]
- Kokkinos, P.A.; Ziros, P.G.; Bellou, M.; Vantarakis, A. Loop-Mediated Isothermal Amplification (LAMP) for the Detection of Salmonella in Food. Food Anal. Methods 2014, 7, 512–526. [Google Scholar] [CrossRef]
- Comini, S.; Bianco, G.; Boattini, M.; Iannaccone, M.; Casale, R.; Banche, G.; Cavallo, R.; Costa, C. Evaluation of the Amplex eazyplex SuperBug Acineto test for direct detection of multi-drug-resistant Acinetobacter baumannii bloodstream infections in high endemicity settings. J. Hosp. Infect. 2021, 117, 179–181. [Google Scholar] [CrossRef] [PubMed]
- Scharmann, U.; Kirchhoff, L.; Schmidt, D.; Buer, J.; Steinmann, J.; Rath, P.M. Evaluation of a commercial Loop-mediated Isothermal Amplification (LAMP) assay for rapid detection of Pneumocystis jirovecii. Mycoses 2020, 63, 1107–1114. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Xu, W.; Tu, G.; Zhou, Y.; Wu, X. Sensitive and Rapid Detection of Ortleppascaris sinensis (Nematoda: Ascaridoidea) by Loop-Mediated Isothermal Amplification. PeerJ 2019, 7, e7607. [Google Scholar] [CrossRef] [PubMed]
- Tomlinson, J.A.; Barker, I.; Boonham, N. Faster, simpler, more-specific methods for improved molecular detection of Phytophthora ramorum in the field. Appl. Environ. Microbiol. 2007, 73, 4040–4047. [Google Scholar] [CrossRef] [PubMed]
- Comini, S.; Bianco, G.; Boattini, M.; Banche, G.; Ricciardelli, G.; Allizond, V.; Cavallo, R.; Costa, C. Evaluation of a diagnostic algorithm for rapid identification of Gram-negative species and detection of extended-spectrum β-lactamase and carbapenemase directly from blood cultures. J. Antimicrob. Chemother. 2022, 77, 2632–2641. [Google Scholar] [CrossRef]
- Rahman, A.M.A.; Ransangan, J.; Subbiah, V.K. Improvements to the rapid detection of the marine pathogenic bacterium, Vibrio harveyi, using Loop-Mediated Isothermal Amplification (LAMP) in combination with SYBR Green. Microorganisms 2022, 10, 2346. [Google Scholar] [CrossRef]
- Walker, S.E.; Lorsch, J. RNA Purification–Precipitation Methods. In Methods in Enzymology; Lorch, J., Ed.; Academic Press: Cambridge, MA, USA, 2013; Volume 530, pp. 337–343. [Google Scholar] [CrossRef]
- Silva, S.J.R.D.; Paiva, M.H.S.; Guedes, D.R.D.; Krokovsky, L.; Melo, F.L.D.; Silva, M.A.L.D.; Barreto-Vieira, D.F.; Santos, C.N.D.; Pena, L.J. Development and validation of Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for rapid detection of ZIKV in mosquito samples from Brazil. Sci. Rep. 2019, 9, 4494. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Viehweger, A.; Krautwurst, S.; Lamkiewicz, K.; Madhugiri, R.; Ziebuhr, J.; Hölzer, M.; Marz, M. Direct RNA nanopore sequencing of full-length coronavirus genomes provides novel insights into structural variants and enables modification analysis. Genome Res. 2019, 29, 1545–1554. [Google Scholar] [CrossRef]
- Yang, W.; Dang, X.; Wang, Q.; Xu, M.; Zhao, Q.; Zhou, Y.; Zhao, H.; Wang, L.; Xu, Y.; Wang, J.; et al. Rapid detection of SARS-CoV-2 using Reverse Transcription RT-LAMP method. medRxiv 2020. [Google Scholar] [CrossRef]
- Lu, R.; Wu, X.; Wan, Z.; Li, Y.; Jin, X.; Zhang, C. A novel Reverse Transcription Loop-Mediated Isothermal Amplification method for rapid detection of SARS-CoV-2. Int. J. Mol. Sci. 2020, 21, 2826. [Google Scholar] [CrossRef] [PubMed]
- Mautner, L.; Baillie, C.K.; Herold, H.M.; Volkwein, W.; Guertler, P.; Eberle, U.; Ackermann, N.; Sing, A.; Pavlovic, M.; Goerlich, O.; et al. Rapid Point-of-Care detection of SARS-CoV-2 using Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP). Virol. J. 2020, 17, 160. [Google Scholar] [CrossRef] [PubMed]
- Baek, Y.H.; Um, J.; Antigua, K.J.C.; Park, J.H.; Kim, Y.; Oh, S.; Kim, Y.; Choi, W.S.; Kim, S.G.; Jeong, J.H.; et al. Development of a Reverse Transcription-Loop-Mediated Isothermal Amplification as a Rapid Early-Detection method for novel SARS-CoV-2. Emerg. Microbes Infect. 2020, 9, 998–1007. [Google Scholar] [CrossRef]
- Iijima, T.; Ando, S.; Kanamori, D.; Kuroda, K.; Nomura, T.; Tisi, L.; Kilgore, P.E.; Pecry, N.; Kohase, H.; Hayakawa, S.; et al. Detection of SARS-CoV-2 and the L452R Spike Mutation Using Reverse Transcription Loop-Mediated Isothermal Amplification Plus Bioluminescent Assay in Real-Time (RT-LAMP-BART). PLoS ONE 2022, 17, e0265748. [Google Scholar] [CrossRef]
- Huang, W.E.; Lim, B.; Hsu, C.C.; Xiong, D.; Wu, W.; Yu, Y.; Jia, H.; Wang, Y.; Zeng, Y.; Ji, M.; et al. RT-LAMP for Rapid Diagnosis of Coronavirus SARS-CoV-2. Microb. Biotechnol. 2020, 13, 950–961. [Google Scholar] [CrossRef]
- Mohon, A.N.; Oberding, L.; Hundt, J.; van Marle, G.; Pabbaraju, K.; Berenger, B.M.; Lisboa, L.; Griener, T.; Czub, M.; Doolan, C.; et al. Optimization and clinical validation of dual-target RT-LAMP for SARS-CoV-2. J. Virol. Methods 2020, 286, 113972. [Google Scholar] [CrossRef]
- Zimmermann, F.; Urban, M.; Krüger, C.; Walter, M.; Wölfel, R.; Zwirglmaier, K. In vitro evaluation of the effect of mutations in primer binding sites on detection of SARS-CoV-2 by RT-qPCR. J. Virol. Methods 2022, 299, 114352. [Google Scholar] [CrossRef]
- Cao, Y.T.; Wu, Z.H.; Jian, J.C.; Lu, Y.S. Evaluation of a loop-mediated isothermal amplification method for the rapid detection of Vibrio harveyi in cultured marine shellfish. Lett. Appl. Microbiol. 2010, 51, 24–29. [Google Scholar] [CrossRef] [PubMed]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Ghaith, D.M.; Ghazaleh, R.A. Carboxamide and N-alkylcarboxamide additives can greatly reduce non specific amplification in Loop-Mediated Isothermal Amplification for Foot-and-Mouth disease Virus (FMDV) using Bst 3.0 polymerase. J. Virol. Methods 2021, 298, 114284. [Google Scholar] [CrossRef] [PubMed]
- Arunrut, N.; Prombun, P.; Saksmerprome, V.; Flegel, T.W.; Kiatpathomchai, W. Rapid and sensitive detection of infectious hypodermal and hematopoietic necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 2011, 171, 21–25. [Google Scholar] [CrossRef]
- Parida, M.; Sannarangaiah, S.; Dash, P.K.; Rao, P.V.L.; Morita, K. Loop mediated isothermal amplification (LAMP): A new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev. Med. Virol. 2008, 18, 407–421. [Google Scholar] [CrossRef]
- Chen, D.; Liang, Z.; Ren, S.; Alali, W.; Chen, L. Rapid and visualized detection of virulence-related genes of Vibrio cholerae in water and aquatic products by loop-mediated isothermal amplification. J. Food Prot. 2022, 85, 44–53. [Google Scholar] [CrossRef]
- Loo, K.Y.; Law, J.W.F.; Tan, L.T.H.; Pusparajah, P.; Letchumanan, V.; Lee, L.H. Diagnostic techniques for rapid detection of Vibrio species. Aquaculture 2022, 561, 738628. [Google Scholar] [CrossRef]
- Garg, N.; Ahmad, F.J.; Kar, S. Recent advances in loop-mediated isothermal amplification (LAMP) for rapid and efficient detection of pathogens. Curr. Res. Microb. Sci. 2022, 3, 100120. [Google Scholar] [CrossRef]
- Thi, V.L.D.; Herbst, K.; Boerner, K.; Meurer, M.; Kremer, L.P.; Kirrmaier, D.; Freistaedter, A.; Papagiannidis, D.; Galmozzi, C.; Stanifer, M.L.; et al. A colorimetric RT-LAMP assay and LAMP-Sequencing for detecting SARS-CoV-2 RNA in clinical samples. Sci. Transl. Med. 2020, 12, eabc7075. [Google Scholar] [CrossRef]
- Zen, L.P.Y.; Lai, M.Y.; binti Rozlan, S.I.; Hamid, M.H.A.; Jelip, J.; Mudin, R.N.; Lau, Y.L. End-point detection of loop-mediated isothermal amplification (LAMP) on malaria by direct observation with colorimetric dyes. Exp. Parasitol. 2022, 239, 108310. [Google Scholar] [CrossRef]
- Park, G.S.; Ku, K.; Baek, S.-H.; Kim, S.-J.; Kim, S.I.; Kim, B.T.; Maeng, J.-S. Development of Reverse Transcription Loop-Mediated Isothermal Amplification assays targeting Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). J. Mol. Diagn. 2020, 22, 729–735. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Ye, C.; Xiao, H.; Yin, J.; Liang, Y.; Ruan, Z.; Yang, Y.; Lin, Y.; Shen, Y.; Luo, D.; et al. Optimization of Loop-Mediated Isothermal Amplification (LAMP) assay for robust visualization in SARS-CoV-2 and emerging variants diagnosis. Chem. Eng. Sci. 2022, 251, 117430. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Deng, Q.; Li, J.; Chen, J.; Wang, Z.; Zhang, X.; Ding, X.; Yang, M.; Lv, S.; Xu, Y.; et al. Development and clinical application of a rapid and sensitive Loop-Mediated Isothermal Amplification test for SARS-CoV-2 infection. mSphere 2020, 5, e00808-20. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Mazumdar, D.; Lu, Y. A simple and sensitive “dipstick” test in serum based on lateral flow separation of aptamer-linked nanostructures. Angew. Chem. Int. Ed. 2006, 45, 7955–7959. [Google Scholar] [CrossRef] [PubMed]
- Jung, J.H.; Oh, S.J.; Kim, Y.T.; Kim, S.Y.; Kim, W.J.; Jung, J.; Seo, T.S. Combination of multiplex reverse-transcription loop-mediated isothermal amplification with an immunochromatographic strip for subtyping influenza A virus. Anal. Chim. Acta 2015, 853, 541–547. [Google Scholar] [CrossRef]
- Jiang, Y.; Chen, S.; Zhao, Y.; Yang, X.; Fu, S.; McKillip, J.L.; Fox, E.M.; Man, C. Multiplex loop-mediated isothermal amplification-based lateral flow dipstick for simultaneous detection of 3 food-borne pathogens in powdered infant formula. J. Dairy Sci. 2020, 103, 4002–4012. [Google Scholar] [CrossRef]
- Lamb, L.E.; Bartolone, S.N.; Ward, E.; Chancellor, M.B. Rapid detection of novel coronavirus (COVID-19) by reverse transcription-loop-mediated isothermal amplification. MedRxiv 2020. [Google Scholar] [CrossRef]
- Zhu, X.; Wang, X.; Han, L.; Chen, T.; Wang, L.; Li, H.; Li, S.; He, L.; Fu, X.; Chen, S.; et al. Multiplex reverse transcription loop-mediated isothermal amplification combined with nanoparticle-based lateral flow biosensor for the diagnosis of COVID-19. Biosens. Bioelectron. 2020, 166, 112437. [Google Scholar] [CrossRef]
- Quesada-González, D.; Merkoçi, A. Nanoparticle-based lateral flow biosensors. Biosens. Bioelectron. 2015, 73, 47–63. [Google Scholar] [CrossRef]
- Nam, D.; Kim, S.; Kim, J.H.; Lee, S.; Kim, D.; Son, J.; Kim, D.; Cha, B.S.; Lee, E.S.; Park, K.S. Low-Temperature Loop-Mediated Isothermal Amplification Operating at Physiological Temperature. Biosensors 2023, 13, 367. [Google Scholar] [CrossRef]
- Zhang, C.; Lv, J.; Cao, Y.; Yao, X.; Yin, M.; Li, S.; Zheng, J.; Liu, H. A triple-target reverse transcription loop-mediated isothermal amplification (RT-LAMP) for rapid and accurate detection of SARS-CoV-2 virus. Anal. Chim. Acta 2023, 1255, 341146. [Google Scholar] [CrossRef] [PubMed]
- Bhadra, S.; Riedel, T.E.; Lakhotia, S.; Tran, N.D.; Ellington, A.D. High-surety isothermal amplification and detection of SARS-CoV-2. MSphere 2021, 6, e00911-20. [Google Scholar] [CrossRef] [PubMed]
- El-Kafrawy, S.A.; El-Daly, M.M.; Hassan, A.M.; Harakeh, S.M.; Alandijany, T.A.; Azhar, E.I. Rapid and reliable detection of SARS-CoV-2 using direct RT-LAMP. Diagnostics 2022, 12, 828. [Google Scholar] [CrossRef] [PubMed]
- Tom, M.R.; Mina, M.J. To interpret the SARS-CoV-2 test, consider the cycle threshold value. Clin. Infect. Dis. 2020, 71, 2252–2254. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Xu, X.; Lu, Q.; Hu, Z.; Jiang, Y.; Song, C.; Chen, W.; Li, P.; Wang, W.; Xu, C.; et al. High viral load suggests increased COVID-19 severity in a longitudinal cohort. Front. Med. 2020, 7, 566888. [Google Scholar] [CrossRef]
- Zou, L.; Ruan, F.; Huang, M.; Liang, L.; Huang, H.; Hong, Z.; Yu, J.; Kang, M.; Song, Y.; Xia, J.; et al. SARS-CoV-2 viral load in upper respiratory specimens of infected patients. N. Engl. J. Med. 2020, 382, 1177–1179. [Google Scholar] [CrossRef] [PubMed]
- Young, B.E.; Ong, S.W.X.; Kalimuddin, S.; Low, J.G.; Tan, S.Y.; Loh, J.; Ng, O.-T.; Marimuthu, K.; Ang, L.E.; Mak, T.M.; et al. Epidemiologic features and clinical course of patients infected with SARS-CoV-2 in Singapore. JAMA 2020, 323, 1488–1494. [Google Scholar] [CrossRef]
- COVID-19 Investigation Team; Kujawski, S.A.; Wong, K.K.; Collins, J.P.; Epstein, L.; Killerby, M.E.; Midgley, C.M.; Abedi, G.R.; Ahmed, N.S.; Almendares, O.; et al. First 12 patients with coronavirus disease 2019 (COVID-19) in the United States. medRxiv 2020. [Google Scholar] [CrossRef]
- He, X.; Lau, E.H.; Wu, P.; Deng, X.; Wang, J.; Hao, X.; Lau, Y.C.; Wong, J.Y.; Guan, Y.; Tan, X.; et al. Temporal dynamics in viral shedding and transmissibility of COVID-19. Nat. Med. 2020, 26, 672–675. [Google Scholar] [CrossRef]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.; Bleicker, T.; Brunink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance 2020, 25, 2000045. [Google Scholar] [CrossRef]
- Ranoa, D.R.E.; Holland, R.L.; Alnaji, F.G.; Green, K.J.; Wang, L.; Brooke, C.B.; Burke, M.D.; Fan, T.M.; Hergenrother, P.J. Saliva-Based molecular testing for SARS-CoV-2 that bypasses RNA extraction. bioRxiv 2020. [Google Scholar] [CrossRef]
- Ott, I.M.; Strine, M.S.; Watkins, A.E.; Boot, M.; Kalinich, C.C.; Harden, C.A.; Vogels, C.B.F.; Casanovas-Massana, A.; Moore, A.J.; Muenker, M.C.; et al. Simply saliva: Stability of SARS-CoV-2 detection negates the need for expensive collection devices. medRxiv 2020. [Google Scholar] [CrossRef]
- Alekseenko, A.; Barrett, D.; Pareja-Sanchez, Y.; Howard, R.J.; Strandback, E.; Ampah-Korsah, H.; Rovšnik, U.; Zuniga-Veliz, S.; Klenov, A.; Malloo, J.; et al. Direct detection of SARS-CoV-2 using non-commercial RT-LAMP reagents on heat-inactivated samples. Sci. Rep. 2021, 11, 1820. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.; Shin, Y.; Chung, S.; Hwang, K.S.; Yoon, D.S.; Lee, J.H. Simple and highly sensitive molecular diagnosis of Zika virus by lateral flow assays. Anal. Chem. 2016, 88, 12272–12278. [Google Scholar] [CrossRef]
- Beckmann, J.F.; Fallon, A.M. Decapitation improves detection of Wolbachia pipientis (Rickettsiales: Anaplasmataceae) in Culex pipiens (Diptera: Culicidae) mosquitoes by the polymerase chain reaction. J. Med. Entomol. 2014, 49, 1103–1108. [Google Scholar] [CrossRef]






| Primer Set | Target Gene | Primer Name | Sequence (5′ → 3′) | Target Size (bp) |
|---|---|---|---|---|
| N1 | Nucleocapsid | F3_N1 | CCAGAATGGAGAACGCAGTG | 202 |
| B3_N1 | CCGTCACCACCACGAATT | |||
| FIP_N1 | Biotin-AGCGGTGAACCAAGACGCAGTTTTGGCGCGATCAAAACAACG | |||
| BIP_N1 | DIG-AATTCCCTCGAGGACAAGGCGTTTTAGCTCTTCGGTAGTAGCCAA | |||
| LF_N1 | TTATTGGGTAAACCTTGGGGC | |||
| LB_N1 | TTCCAATTAACACCAATAGCAGTCC | |||
| N2 | Nucleocapsid | F3_N2 | AGATCACATTGGCACCCG | 213 |
| B3_N2 | CCATTGCCAGCCATTCTAGC | |||
| FIP_N2 | Biotin-TGCTCCCTTCTGCGTAGAAGCTTTTCAATGCTGCAATCGTGCTAC | |||
| BIP_N2 | FAM-GGCGGCAGTCAAGCCTCTTCTTTTCCTACTGCTGCCTGGAGTT | |||
| LF_N2 | AGATCACATTGGCACCCG | |||
| LB_N2 | CCATTGCCAGCCATTCTAGC | |||
| M | Membrane | F3_M | TCTTCTCAACGTGCCACT | 220 |
| B3_M | CTGAGTCACCTGCTACAC | |||
| FIP_M | Biotin-TACGAAGATGTCCACGAAGGATTTTTCAGACCGCTTCTAGAAAGT | |||
| BIP_M | FAM-GGACACCATCTAGGACGCTGTTTTTAATAAGAAAGCGTTCGTGATG | |||
| LF_M | CACAGCTCCGATTACGAGTTC | |||
| LB_M | TGACATCAAGGACCTGCCT | |||
| E | Envelope | F3_E | TCATTCGTTTCGGAAGAGA | 205 |
| B3_E | GAACTCTAGAAGAATTCAGA | |||
| FIP_E | Biotin-CGCAGTAAGGATGGCTAGTGTATTTTCAGGTACGTTAATAGTTAATAGCG | |||
| BIP_E | DIG-TCGATTGTGTGCGTACTGCTGTTTTTTTTTAACACGAGAGTAAACGT | |||
| LF_E | CTAGCAAGAATACCACGAAAGC | |||
| LB_E | CAATATTGTTAACGTGAGTCTTGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Simon, D.S.; Yew, C.-W.; Kumar, V.S. Multiplexed Reverse Transcription Loop-Mediated Isothermal Amplification Coupled with a Nucleic Acid-Based Lateral Flow Dipstick as a Rapid Diagnostic Method to Detect SARS-CoV-2. Microorganisms 2023, 11, 1233. https://doi.org/10.3390/microorganisms11051233
Simon DS, Yew C-W, Kumar VS. Multiplexed Reverse Transcription Loop-Mediated Isothermal Amplification Coupled with a Nucleic Acid-Based Lateral Flow Dipstick as a Rapid Diagnostic Method to Detect SARS-CoV-2. Microorganisms. 2023; 11(5):1233. https://doi.org/10.3390/microorganisms11051233
Chicago/Turabian StyleSimon, Derich Shalbie, Chee-Wei Yew, and Vijay Subbiah Kumar. 2023. "Multiplexed Reverse Transcription Loop-Mediated Isothermal Amplification Coupled with a Nucleic Acid-Based Lateral Flow Dipstick as a Rapid Diagnostic Method to Detect SARS-CoV-2" Microorganisms 11, no. 5: 1233. https://doi.org/10.3390/microorganisms11051233
APA StyleSimon, D. S., Yew, C.-W., & Kumar, V. S. (2023). Multiplexed Reverse Transcription Loop-Mediated Isothermal Amplification Coupled with a Nucleic Acid-Based Lateral Flow Dipstick as a Rapid Diagnostic Method to Detect SARS-CoV-2. Microorganisms, 11(5), 1233. https://doi.org/10.3390/microorganisms11051233

