Intestinal Colonization of Campylobacter jejuni and Its Hepatic Dissemination Are Associated with Local and Systemic Immune Responses in Broiler Chickens
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design and Sample Collection
2.2. RNA Extraction from Cecal Tonsils and Liver Samples, and Reverse Transcription
2.3. Real-Time Quantitative PCR (qPCR) from cDNA
2.4. Quantification of Serum Amyloid A in Sera
2.5. Determination of Anti-C. jejuni IgY Titers in Sera
2.6. Statistical Analyses
3. Results
3.1. Transcript Levels of Chemokine, Cytokines, and Host Defense Peptides in Cecal Tonsils of Chickens Inoculated with C. jejuni
3.2. Transcript Levels of Chemokine and Cytokines in the Liver of Broiler Chickens Inoculated with C. jejuni
3.3. Serum Amyloid A Quantification in Sera of Chickens Inoculated by C. jejuni
3.4. Anti-C. jejuni IgY Antibody Levels in Sera of Chickens Inoculated with C. jejuni
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Keithlin, J.; Sargeant, J.; Thomas, M.K.; Fazil, A. Systematic review and meta-analysis of the proportion of Campylobacter cases that develop chronic sequelae. BMC Public Health 2014, 14, 1203. [Google Scholar] [CrossRef]
- European Food Safety Authority and European Centre for Disease Prevention and Control. The European Union One Health 2021 Zoonoses Report. EFSA J. 2022, 20, e07666. [Google Scholar] [CrossRef]
- Public Health Agency of Canada. FoodNet Canada Annual Report 2018. Available online: https://www.canada.ca/en/public-health/services/surveillance/foodnet-canada/publications/foodnet-canada-annual-report-2018.html (accessed on 14 December 2022).
- Kaakoush, N.O.; Castano-Rodriguez, N.; Mitchell, H.M.; Man, S.M. Global Epidemiology of Campylobacter Infection. Clin. Microbiol. Rev. 2015, 28, 687–720. [Google Scholar] [CrossRef] [PubMed]
- Tack, D.M.; Marder, E.P.; Griffin, P.M.; Cieslak, P.R.; Dunn, J.; Hurd, S.; Scallan, E.; Lathrop, S.; Muse, A.; Ryan, P.; et al. Preliminary Incidence and Trends of Infections with Pathogens Transmitted Commonly through Food—Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 2015–2018. MMWR Morb. Mortal Wkly Rep. 2019, 68, 369–373. [Google Scholar] [CrossRef]
- Domingues, A.R.; Pires, S.M.; Halasa, T.; Hald, T. Source attribution of human campylobacteriosis using a meta-analysis of case-control studies of sporadic infections. Epidemiol. Infect. 2012, 140, 970–981. [Google Scholar] [CrossRef]
- Little, C.L.; Gormley, F.J.; Rawal, N.; Richardson, J.F. A recipe for disaster: Outbreaks of campylobacteriosis associated with poultry liver pate in England and Wales. Epidemiol. Infect. 2010, 138, 1691–1694. [Google Scholar] [CrossRef]
- Lanier, W.A.; Hale, K.R.; Geissler, A.L.; Dewey-Mattia, D. Chicken Liver-Associated Outbreaks of Campylobacteriosis and Salmonellosis, United States, 2000–2016: Identifying Opportunities for Prevention. Foodborne Pathog. Dis. 2018, 15, 726–733. [Google Scholar] [CrossRef]
- de Zoete, M.R.; Keestra, A.M.; Roszczenko, P.; van Putten, J.P. Activation of human and chicken toll-like receptors by Campylobacter spp. Infect. Immun. 2010, 78, 1229–1238. [Google Scholar] [CrossRef] [PubMed]
- Brisbin, J.T.; Gong, J.; Sharif, S. Interactions between commensal bacteria and the gut-associated immune system of the chicken. Anim. Health Res. Rev. 2008, 9, 101–110. [Google Scholar] [CrossRef]
- Smith, C.K.; Abuoun, M.; Cawthraw, S.A.; Humphrey, T.J.; Rothwell, L.; Kaiser, P.; Barrow, P.A.; Jones, M.A. Campylobacter colonization of the chicken induces a proinflammatory response in mucosal tissues. FEMS Immunol. Med. Microbiol. 2008, 54, 114–121. [Google Scholar] [CrossRef]
- Humphrey, S.; Chaloner, G.; Kemmett, K.; Davidson, N.; Williams, N.; Kipar, A.; Humphrey, T.; Wigley, P. Campylobacter jejuni is not merely a commensal in commercial broiler chickens and affects bird welfare. mBio 2014, 5, e01364-14. [Google Scholar] [CrossRef] [PubMed]
- Reid, W.D.; Close, A.J.; Humphrey, S.; Chaloner, G.; Lacharme-Lora, L.; Rothwell, L.; Kaiser, P.; Williams, N.J.; Humphrey, T.J.; Wigley, P.; et al. Cytokine responses in birds challenged with the human food-borne pathogen Campylobacter jejuni implies a Th17 response. R. Soc. Open Sci. 2016, 3, 150541. [Google Scholar] [CrossRef] [PubMed]
- Connerton, P.L.; Richards, P.J.; Lafontaine, G.M.; O’Kane, P.M.; Ghaffar, N.; Cummings, N.J.; Smith, D.L.; Fish, N.M.; Connerton, I.F. The effect of the timing of exposure to Campylobacter jejuni on the gut microbiome and inflammatory responses of broiler chickens. Microbiome 2018, 6, 88. [Google Scholar] [CrossRef]
- Han, Z.; Willer, T.; Pielsticker, C.; Gerzova, L.; Rychlik, I.; Rautenschlein, S. Differences in host breed and diet influence colonization by Campylobacter jejuni and induction of local immune responses in chicken. Gut Pathog. 2016, 8, 56. [Google Scholar] [CrossRef] [PubMed]
- Munoz, L.R.; Bailey, M.A.; Krehling, J.T.; Bourassa, D.V.; Hauck, R.; Pacheco, W.J.; Chaves-Cordoba, B.; Chasteen, K.S.; Talorico, A.A.; Escobar, C.; et al. Effects of dietary yeast cell wall supplementation on growth performance, intestinal Campylobacter jejuni colonization, innate immune response, villus height, crypt depth, and slaughter characteristics of broiler chickens inoculated with Campylobacter jejuni at day 21. Poult. Sci. 2023, 102, 102609. [Google Scholar] [CrossRef]
- van Dijk, A.; Herrebout, M.; Tersteeg-Zijderveld, M.H.; Tjeerdsma-van Bokhoven, J.L.; Bleumink-Pluym, N.; Jansman, A.J.; Veldhuizen, E.J.; Haagsman, H.P. Campylobacter jejuni is highly susceptible to killing by chicken host defense peptide cathelicidin-2 and suppresses intestinal cathelicidin-2 expression in young broilers. Vet. Microbiol. 2012, 160, 347–354. [Google Scholar] [CrossRef]
- Garcia, J.S.; Byrd, J.A.; Wong, E.A. Expression of nutrient transporters and host defense peptides in Campylobacter challenged broilers. Poult Sci. 2018, 97, 3671–3680. [Google Scholar] [CrossRef]
- Li, P.; Cui, Y.; Guo, F.; Guo, J.; Cao, X.; Lin, J.; Ding, B.; Xu, F. Campylobacter jejuni infection induces dynamic expression of avian host defense peptides in vitro and in vivo. Vet. Microbiol. 2023, 277, 109631. [Google Scholar] [CrossRef]
- Vaezirad, M.M.; Keestra-Gounder, A.M.; de Zoete, M.R.; Koene, M.G.; Wagenaar, J.A.; van Putten, J.P.M. Invasive behavior of Campylobacter jejuni in immunosuppressed chicken. Virulence 2017, 8, 248–260. [Google Scholar] [CrossRef]
- Littman, D.R.; Rudensky, A.Y. Th17 and regulatory T cells in mediating and restraining inflammation. Cell 2010, 140, 845–858. [Google Scholar] [CrossRef]
- Mortada, M.; Cosby, D.E.; Akerele, G.; Ramadan, N.; Oxford, J.; Shanmugasundaram, R.; Ng, T.T.; Selvaraj, R.K. Characterizing the immune response of chickens to Campylobacter jejuni (Strain A74C). PLoS ONE 2021, 16, e0247080. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Swaggerty, C.L.; Kogut, M.H.; Chiang, H.I.; Wang, Y.; Genovese, K.J.; He, H.; Zhou, H. Gene expression profiling of the local cecal response of genetic chicken lines that differ in their susceptibility to Campylobacter jejuni colonization. PLoS ONE 2010, 5, e11827. [Google Scholar] [CrossRef] [PubMed]
- Pielsticker, C.; Glunder, G.; Aung, Y.H.; Rautenschlein, S. Colonization pattern of C. jejuni isolates of human and avian origin and differences in the induction of immune responses in chicken. Vet. Immunol. Immunopathol. 2016, 169, 1–9. [Google Scholar] [CrossRef]
- Han, Z.; Willer, T.; Li, L.; Pielsticker, C.; Rychlik, I.; Velge, P.; Kaspers, B.; Rautenschlein, S. Influence of the Gut Microbiota Composition on Campylobacter jejuni Colonization in Chickens. Infect. Immun. 2017, 85, e00380-17. [Google Scholar] [CrossRef]
- Han, Z.; Pielsticker, C.; Gerzova, L.; Rychlik, I.; Rautenschlein, S. The influence of age on Campylobacter jejuni infection in chicken. Dev. Comp. Immunol. 2016, 62, 58–71. [Google Scholar] [CrossRef]
- Meade, K.G.; Narciandi, F.; Cahalane, S.; Reiman, C.; Allan, B.; O’Farrelly, C. Comparative in vivo infection models yield insights on early host immune response to Campylobacter in chickens. Immunogenetics 2009, 61, 101–110. [Google Scholar] [CrossRef]
- Cawthraw, S.; Ayling, R.; Nuijten, P.; Wassenaar, T.; Newell, D.G. Isotype, specificity, and kinetics of systemic and mucosal antibodies to Campylobacter jejuni antigens, including flagellin, during experimental oral infections of chickens. Avian Dis. 1994, 38, 341–349. [Google Scholar] [CrossRef]
- Sylte, M.J.; Sivasankaran, S.K.; Trachsel, J.; Sato, Y.; Wu, Z.; Johnson, T.A.; Chandra, L.C.; Zhang, Q.; Looft, T. The Acute Host-Response of Turkeys Colonized with Campylobacter coli. Front. Vet. Sci. 2021, 8, 613203. [Google Scholar] [CrossRef] [PubMed]
- Genovese, K.J.; He, H.; Swaggerty, C.L.; Byrd, J.A.; Kogut, M.H. Leukocyte Response to Campylobacter Intra-Abdominal Infection in One Day Old Leghorn Chickens. Microorganisms 2023, 11, 613. [Google Scholar] [CrossRef] [PubMed]
- Jennings, J.L.; Sait, L.C.; Perrett, C.A.; Foster, C.; Williams, L.K.; Humphrey, T.J.; Cogan, T.A. Campylobacter jejuni is associated with, but not sufficient to cause vibrionic hepatitis in chickens. Vet. Microbiol. 2011, 149, 193–199. [Google Scholar] [CrossRef] [PubMed]
- Gibbs, K.; Lacharme-Lora, L.; Dersjant-Li, Y.; Evans, C.; Wigley, P. A probiotic and mixed-enzymes combination reduces the inflammatory response, faecal shedding and systemic spread of Campylobacter jejuni in broilers. J. Appl. Anim. Nutr. 2021, 9, 65–75. [Google Scholar] [CrossRef]
- Thomas, L.M.; Long, K.A.; Good, R.T.; Panaccio, M.; Widders, P.R. Genotypic Diversity among Campylobacter jejuni Isolates in a Commercial Broiler Flock. Appl. Environ. Microbiol. 1997, 63, 1874–1877. [Google Scholar] [CrossRef]
- Hiett, K.L.; Stern, N.J.; Fedorka-Cray, P.; Cox, N.A.; Musgrove, M.T.; Ladely, S. Molecular subtype analyses of Campylobacter spp. from Arkansas and California poultry operations. Appl. Environ. Microbiol. 2002, 68, 6220–6236. [Google Scholar] [CrossRef]
- Messens, W.; Herman, L.; De Zutter, L.; Heyndrickx, M. Multiple typing for the epidemiological study of contamination of broilers with thermotolerant Campylobacter. Vet. Microbiol. 2009, 138, 120–131. [Google Scholar] [CrossRef] [PubMed]
- Chaloner, G.; Wigley, P.; Humphrey, S.; Kemmett, K.; Lacharme-Lora, L.; Humphrey, T.; Williams, N. Dynamics of dual infection with Campylobacter jejuni strains in chickens reveals distinct strain-to-strain variation in infection ecology. Appl. Environ. Microbiol. 2014, 80, 6366–6372. [Google Scholar] [CrossRef] [PubMed]
- Chagneau, S.; Gaucher, M.-L.; Thériault, W.P.; Fravalo, P.; Thibodeau, A. Observations supporting hypothetical commensalism and competition between two Campylobacter jejuni strains colonizing the broiler chicken gut. Front. Microbiol. 2023, 13, 1071175. [Google Scholar] [CrossRef]
- Humphrey, S.; Lacharme-Lora, L.; Chaloner, G.; Gibbs, K.; Humphrey, T.; Williams, N.; Wigley, P. Heterogeneity in the Infection Biology of Campylobacter jejuni Isolates in Three Infection Models Reveals an Invasive and Virulent Phenotype in a ST21 Isolate from Poultry. PLoS ONE 2015, 10, e0141182. [Google Scholar] [CrossRef] [PubMed]
- Thibodeau, A.; Fravalo, P.; Taboada, E.N.; Laurent-Lewandowski, S.; Guevremont, E.; Quessy, S.; Letellier, A. Extensive characterization of Campylobacter jejuni chicken isolates to uncover genes involved in the ability to compete for gut colonization. BMC Microbiol. 2015, 15, 97. [Google Scholar] [CrossRef] [PubMed]
- St Paul, M.; Mallick, A.I.; Haq, K.; Orouji, S.; Abdul-Careem, M.F.; Sharif, S. In vivo administration of ligands for chicken toll-like receptors 4 and 21 induces the expression of immune system genes in the spleen. Vet. Immunol. Immunopathol. 2011, 144, 228–237. [Google Scholar] [CrossRef]
- Bages, S.; Estany, J.; Tor, M.; Pena, R.N. Investigating reference genes for quantitative real-time PCR analysis across four chicken tissues. Gene 2015, 561, 82–87. [Google Scholar] [CrossRef]
- Taha-Abdelaziz, K.; Alkie, T.N.; Hodgins, D.C.; Yitbarek, A.; Shojadoost, B.; Sharif, S. Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni. Vet. Microbiol. 2017, 212, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Akbari, M.R.; Haghighi, H.R.; Chambers, J.R.; Brisbin, J.; Read, L.R.; Sharif, S. Expression of antimicrobial peptides in cecal tonsils of chickens treated with probiotics and infected with Salmonella enterica serovar typhimurium. Clin. Vaccine Immunol. 2008, 15, 1689–1693. [Google Scholar] [CrossRef]
- Kaab, H.T. Acute Phase Proteins as a Biomarker of Health and Disease in Chickens. Ph.D. Thesis, University of Glasgow, Glasgow, UK, 2019. [Google Scholar]
- Kaiser, P.; Stäheli, P. Chapter 10—Avian Cytokines and Chemokines. In Avian Immunology, 2nd ed.; Schat, K.A., Kaspers, B., Kaiser, P., Eds.; Academic Press: Boston, MA, USA, 2014; pp. 189–204. [Google Scholar]
- Cuperus, T.; Coorens, M.; van Dijk, A.; Haagsman, H.P. Avian host defense peptides. Dev. Comp. Immunol. 2013, 41, 352–369. [Google Scholar] [CrossRef]
- van Dijk, A.; Tersteeg-Zijderveld, M.H.; Tjeerdsma-van Bokhoven, J.L.; Jansman, A.J.; Veldhuizen, E.J.; Haagsman, H.P. Chicken heterophils are recruited to the site of Salmonella infection and release antibacterial mature Cathelicidin-2 upon stimulation with LPS. Mol. Immunol. 2009, 46, 1517–1526. [Google Scholar] [CrossRef]
- Cray, C.; Zaias, J.; Altman, N.H. Acute phase response in animals: A review. Comp. Med. 2009, 59, 517–526. [Google Scholar]
- Shah, C.; Hari-Dass, R.; Raynes, J.G. Serum amyloid A is an innate immune opsonin for Gram-negative bacteria. Blood 2006, 108, 1751–1757. [Google Scholar] [CrossRef]
- Sack, G.H., Jr. Serum amyloid A—A review. Mol. Med. 2018, 24, 46. [Google Scholar] [CrossRef] [PubMed]
- Kaab, H.; Bain, M.M.; Eckersall, P.D. Acute phase proteins and stress markers in the immediate response to a combined vaccination against Newcastle disease and infectious bronchitis viruses in specific pathogen free (SPF) layer chicks. Poult. Sci. 2018, 97, 463–469. [Google Scholar] [CrossRef] [PubMed]
- Kromann, S.; Olsen, R.H.; Bojesen, A.M.; Jensen, H.E.; Thofner, I. Assessment of automated assays for serum amyloid A, haptoglobin (PIT54) and basic biochemistry in broiler breeders experimentally infected with Escherichia coli. Vet. Res. 2022, 53, 25. [Google Scholar] [CrossRef]
- Yazdani, A.; Asasi, K.; Nazifi, S. Evaluation of acute-phase proteins and inflammatory mediators changes in native chickens experimentally infected with Salmonella typhimurium. Comp. Clin. Pathol. 2015, 24, 733–739. [Google Scholar] [CrossRef]
- Hawkins, J.S.; Wu, Q.; Wang, Y.; Lu, C.Y. Deficits in serum amyloid A contribute to increased neonatal mortality during murine listeriosis. Pediatr. Res. 2013, 74, 668–674. [Google Scholar] [CrossRef] [PubMed][Green Version]






| Target Gene | Primer Sequences (5′–3′) | Annealing Temperature | Reference |
|---|---|---|---|
| β-actin | F: CAACACAGTGCTGTCTGGTGGTA R: ATCGTACTCCTGCTTGCTGATCC | 60 | [40] |
| Ribosomal protein L32 (RPL32) | F: ATGGGAGCAACAAGAAGACG R: TTGGAAGACACGTTGTGAGC | 58 | [41] |
| Chemokine [C-X-C motif] ligand i2 (CXCLi2) | F: CCAAGCACACCTCTCTTCCA R: GCAAGGTAGGACGCTGGTAA | 60 | [40] |
| Interleukin-1β (IL-1β) | F: GTGAGGCTCAACATTGCGCTGTA R: TGTCCAGGCGGTAGAAGATGAAG | 63 | [40] |
| Interleukin-10 (IL-10) | F: TTTGGCTGCCAGTCTGTGTC R: CTCATCCATCTTCTCGAACGTC | 60 | [42] |
| Interleukin-17A (IL-17A) | F: CATGGGATTACAGGATCGATGA R: GCGGCACTGGGCATCA | 60 | [13] |
| Interleukin-13 (IL-13) | F: ACTTGTCCAAGCTGAAGCTGTC R: TCTTGCAGTCGGTCATGTTGTC | 60 | [40] |
| Interferon-γ (IFN-γ) | F: ACACTGACAAGTCAAAGCCGCACA R: AGTCGTTCATCGGGAGCTTGGC | 60 | [40] |
| Avian β-defensin1 (AvBD1) | F: GGTTCTTACTGCCTTGCTGT R: TGACTTCCTTCCTAGAGCCT | 57 | [43] |
| Cathelicidin-2 (CATH2) | F: GATGGTGACCTTAGGGCGGAA R: CGAGATCAATCTACGCTGCAGAG | 62 | [17] |
| Conditions | Control #1 | 103 D2008b | 103 G2008b | Mix #1 |
|---|---|---|---|---|
| Cecal colonization of C. jejuni | No | No | Yes | Yes |
| Hepatic spread of C. jejuni | No | No | No | Yes (at 21 dpi only) |
| Cecal immunity a | No Th17 induction | Th17 induction at 7 dpi Significant increase in IL-10 mRNA levels at 7 dpi | No Th17 induction Significant increase in IL-10 mRNA levels at 7 dpi | |
| Hepatic Immunity b | No induction of immune responses | No induction of immune responses | Significant increase in IL-1β, IL-10, IFNγ, and IL-13 mRNA levels at 21 dpi | |
| Systemic immunity | No increase in specific IgY levels | No significant increase in specific IgY levels at 21 dpi (compared to control) | Significant increase in specific IgY levels at 21 dpi |
| Conditions | Control #2 | 107 D2008b | 103 G2008b | Mix #2 |
|---|---|---|---|---|
| Cecal colonization of C. jejuni | No | Yes | Yes | Yes |
| Hepatic spread of C. jejuni | No | Yes (at 21 dpi only) | No | Yes (at 7 and 21 dpi only) |
| Cecal immunity a | Significant increase in CXCLi2 mRNA levels at 1 dpi, but no Th17 induction at 7 dpi Significant increase in IL-10 mRNA levels at 7 dpi | Th17 induction at 7 dpi Significant increase in IL-10 mRNA levels at 7 dpi | No Th17 induction Significant increase in IL-10 mRNA levels at 7 dpi | |
| Hepatic Immunity b | Significant increase in IL-1β mRNA levels at 7 dpi; and IL-1β, IL-10, IFNγ, and IL-13 at 21 dpi | No induction of immune responses | Significant increase in CXCLi2, IL-1β, IL-10, IFNγ, and IL-13 mRNA levels at 7 dpi; and IL-1β at 21 dpi | |
| Systemic immunity | Significant increase in SAA concentration at 7 dpi Significant increase in specific IgY levels at 21 dpi | No significant in-crease in specific IgY levels at 21 dpi (compared to control) | Significant increase in specific IgY levels at 21 dpi |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chagneau, S.; Gaucher, M.-L.; Fravalo, P.; Thériault, W.P.; Thibodeau, A. Intestinal Colonization of Campylobacter jejuni and Its Hepatic Dissemination Are Associated with Local and Systemic Immune Responses in Broiler Chickens. Microorganisms 2023, 11, 1677. https://doi.org/10.3390/microorganisms11071677
Chagneau S, Gaucher M-L, Fravalo P, Thériault WP, Thibodeau A. Intestinal Colonization of Campylobacter jejuni and Its Hepatic Dissemination Are Associated with Local and Systemic Immune Responses in Broiler Chickens. Microorganisms. 2023; 11(7):1677. https://doi.org/10.3390/microorganisms11071677
Chicago/Turabian StyleChagneau, Sophie, Marie-Lou Gaucher, Philippe Fravalo, William P. Thériault, and Alexandre Thibodeau. 2023. "Intestinal Colonization of Campylobacter jejuni and Its Hepatic Dissemination Are Associated with Local and Systemic Immune Responses in Broiler Chickens" Microorganisms 11, no. 7: 1677. https://doi.org/10.3390/microorganisms11071677
APA StyleChagneau, S., Gaucher, M.-L., Fravalo, P., Thériault, W. P., & Thibodeau, A. (2023). Intestinal Colonization of Campylobacter jejuni and Its Hepatic Dissemination Are Associated with Local and Systemic Immune Responses in Broiler Chickens. Microorganisms, 11(7), 1677. https://doi.org/10.3390/microorganisms11071677
