Bacteriomic Profiles of Rock-Dwelling Lichens from the Venezuelan Guiana Shield and the South African Highveld Plateau
Abstract
:1. Introduction
2. Materials and Methods
2.1. Collection of Epilithic Lichen Samples
2.2. Bulk DNA Extraction from Lichen Thalli
2.3. Amplification and Sequencing of Fungal/Algal 18S rDNA
2.4. Amplification and Sequencing of V3–V4 Region of Bacterial 16S rDNA
2.5. Sequence Data Analysis and OTU Determination
2.6. Diversity Indices and Bioinformatic Analyses of OTUs
3. Results
3.1. Identification of Mycobionts and Photobionts of the Epilithic Lichens
3.2. MiSeq-Generated V3–V4 Sequences and OTUs
3.3. Taxonomic Composition of Lichen-Associated Bacterial Community
3.4. Alpha and Beta Diversity
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nash, T.H., III (Ed.) Lichen Biology, 2nd ed.; Cambridge University Press: Cambridge, UK, 2008; 502p. [Google Scholar]
- Nimis, P.L.; Scheidegger, C.; Wolseley, P.A. (Eds.) Monitoring with Lichens—Monitoring Lichens; Springer Science & Business Media: Berlin, Germany, 2002; 424p. [Google Scholar]
- Jung, P.; Büdel, B. 2.3 Lichens as pioneers on rock surfaces. In Life at Rock Surfaces: Challenged by Extreme Light, Temperature and Hydration Fluctuations; Büdel, B., Friedl, T., Eds.; De Gruyter: Berlin, Germany, 2021; pp. 141–160. [Google Scholar] [CrossRef]
- Blackwell, M. The Fungi: 1, 2, 3 … 5.1 million species? Am. J. Bot. 2011, 98, 426–438. [Google Scholar] [CrossRef] [PubMed]
- Index Fungorum. Available online: http://www.indexfungorum.org/ (accessed on 12 December 2023).
- Lücking, R.; Hodkinson, B.P.; Leavitt, S.D. The 2016 classification of lichenized fungi in the Ascomycota and Basidiomycota—Approaching one thousand genera. Bryologist 2017, 119, 361–416. [Google Scholar] [CrossRef]
- Purvis, O.W.; Coppins, B.J. Checklist of Lichens of Great Britain and Ireland; British Lichen Society: London, UK, 2002; 96p. [Google Scholar]
- Øvstedal, D.O.; Lewis Smith, R.I. Lichens of Antarctica and South Georgia: A Guide to Their Identification and Ecology; Cambridge University Press: Cambridge, UK, 2001; 424p. [Google Scholar]
- Grube, M.; Berg, G. Microbial consortia of bacteria and fungi with a focus on the lichen symbiosis. Fung. Biol. Rev. 2009, 23, 72–85. [Google Scholar] [CrossRef]
- Aschenbrenner, I.A.; Cernava, T.; Berg, G.; Grube, M. Understanding microbial multi-species symbioses. Front. Microbiol. 2016, 7, 180. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Naganuma, T. Chronicle of research into lichen-associated bacteria. Microorganisms 2022, 10, 2111. [Google Scholar] [CrossRef] [PubMed]
- Grube, M.; Cardinale, M.; de Castro, J.; Müller, H.; Berg, G. Species-specific structural and functional diversity of bacterial communities in lichen symbioses. ISME J. 2009, 3, 1105–1115. [Google Scholar] [CrossRef]
- Hodkinson, B.P.; Lutzoni, F. A microbiotic survey of lichen-associated bacteria reveals a new lineage from the Rhizobiales. Symbiosis 2009, 49, 163–180. [Google Scholar] [CrossRef]
- Bates, S.T.; Cropsey, G.W.G.; Caporaso, J.G.; Knight, R.; Fierer, N. Bacterial communities associated with the lichen symbiosis. Appl. Environ. Microbiol. 2011, 77, 1309–1314. [Google Scholar] [CrossRef]
- Bjelland, T.; Grube, M.; Hoem, S.; Jorgensen, S.L.; Daae, F.L.; Thorseth, I.H.; Øvreås, L. Microbial metacommunities in the lichen-rock habitat: Microbial metacommunities in the lichen-rock habitat. Environ. Microbiol. Rep. 2011, 3, 434–442. [Google Scholar] [CrossRef]
- Cardinale, M.; Steinová, J.; Rabensteiner, J.; Berg, G.; Grube, M. Age, sun and substrate: Triggers of bacterial communities in lichens: Ecology of lichen-associated bacterial communities. Environ. Microbiol. Rep. 2012, 4, 23–28. [Google Scholar] [CrossRef]
- Sierra, M.A.; Danko, D.C.; Sandoval, T.A.; Pishchany, G.; Moncada, B.; Kolter, R.; Mason, C.E.; Zambrano, M.M. The Microbiomes of seven Lichen genera reveal host specificity, a reduced core community and potential as source of antimicrobials. Front. Microbiol. 2020, 11, 398. [Google Scholar] [CrossRef] [PubMed]
- Tzovaras, B.G.; Segers, F.H.I.D.; Bicker, A.; Dal Grande, F.; Otte, J.; Anvar, S.Y.; Hankeln, T.; Schmitt, I.; Ebersberger, I. What Is in Umbilicaria pustulata? A metagenomic approach to reconstruct the holo-genome of a lichen. Genome Biol. Evol. 2020, 12, 309–324. [Google Scholar] [CrossRef] [PubMed]
- Rolshausen, G.; Dal Grande, F.; Otte, J.; Schmitt, I. Lichen holobionts show compositional structure along elevation. Mol. Ecol. 2023, 32, 6619–6630. [Google Scholar] [CrossRef] [PubMed]
- Faluaburu, M.S.; Nakai, R.; Imura, S.; Naganuma, T. Phylotypic characterization of mycobionts and photobionts of rock tripe lichen in East Antarctica. Microorganisms 2019, 7, 203. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Naganuma, T.; Nakai, R.; Imura, S.; Tsujimoto, M.; Convey, P. Microbiomic analysis of bacteria associated with rock tripe lichens in continental and maritime Antarctic regions. J. Fungi 2022, 8, 817. [Google Scholar] [CrossRef] [PubMed]
- Lumbsch, H.T.; Leavitt, S.D. Introduction of subfamily names for four clades in Cladoniaceae and Peltigeraceae (Lecanoromycetes). Mycotaxon 2019, 134, 271–273. [Google Scholar] [CrossRef]
- Rikkinen, J. Molecular studies on cyanobacterial diversity in lichen symbioses. MycoKeys 2013, 6, 3–32. [Google Scholar] [CrossRef]
- Liu, Q.; He, Z.; Naganuma, T.; Nakai, R.; Rodríguez, L.M.; Carreño, R.; Urbani, F. Phylotypic diversity of bacteria associated with speleothems of a silicate cave in a Guiana Shield tepui. Microorganisms 2022, 10, 1395. [Google Scholar] [CrossRef]
- Briceño, H.; Schubert, C.; Paolini, J. Table-mountain geology and surficial geochemistry: Chimantá Massif, Venezuelan Guayana shield. J. S. Am. Earth Sci. 1990, 3, 179–194. [Google Scholar] [CrossRef]
- Huber, O. Geographical and physical features. In Flora of the Venezuelan Guayana. Vol. 1. Introduction; Steyermark, J.A., Berry, P.E., Holst, B.K., Eds.; Missouri Botanical Garden and Timber Press: Portland, OR, USA, 1995; pp. 1–61. [Google Scholar]
- Aubrecht, R.; Barrio-Amorós, C.L.; Breure, A.S.H.; Brewer-Carías, C.; Derka, T.; Fuentes-Ramos, O.A.; Gregor, M.; Kodada, J.; Kováčik, Ľ.; Lánczos, T.; et al. Venezuelan Tepuis: Their Caves and Biota; Acta Geologica Slovaca Monograph; Comenius University: Bratislava, Slovakia, 2012; 167p, Available online: https://digitalcommons.usf.edu/kip_monographs/24/ (accessed on 12 December 2023).
- Golden Gate Highlands National Park. South African National Parks. Available online: https://www.sanparks.org/parks/golden_gate/ (accessed on 12 December 2023).
- Grab, S.W.; Goudie, A.S.; Viles, H.A.; Webb, N. Sandstone geomorphology of the Golden Gate Highlands National Park, South Africa, in a global context. Koedoe 2011, 53, 985. [Google Scholar] [CrossRef]
- NOAA National Geophysical Data Center. ETOPO1 1 Arc-Minute Global Relief Model. NOAA National Centers for Environmental Information. 2009. Available online: https://doi.org/10.7289/V5C8276M (accessed on 12 December 2023).
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef]
- Jumpponen, A. Soil fungal communities underneath willow canopies on a primary successional glacier forefront: rDNA sequence results can be affected by primer selection and chimeric data. Microb. Ecol. 2007, 53, 233–246. [Google Scholar] [CrossRef] [PubMed]
- Yoon, S.H.; Ha, S.M.; Kwon, S.; Lim, J.; Kim, Y.; Seo, H.; Chun, J. Introducing EzBioCloud: A taxonomically united database of 16S rRNA and whole genome assemblies. Int. J. Syst. Evol. Microbiol. 2017, 67, 1613–1617. [Google Scholar] [CrossRef] [PubMed]
- Yarza, P.; Yilmaz, P.; Pruesse, E.; Glöckner, F.O.; Ludwig, W.; Schleifer, K.; Whitman, W.B.; Euzéby, J.; Amann, R.; Rosselló-Móra, R. Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences. Nat. Rev. Microbiol. 2014, 12, 635–645. [Google Scholar] [CrossRef] [PubMed]
- Chao, A.; Jost, L. Coverage-based rarefaction and extrapolation: Standardizing samples by completeness rather than size. Ecology 2012, 93, 2533–2547. [Google Scholar] [CrossRef]
- Jost, L. Entropy and diversity. Oikos 2006, 113, 363–375. [Google Scholar] [CrossRef]
- Lozupone, C.A.; Hamady, M.; Kelley, S.T.; Knight, R. Quantitative and qualitative beta diversity measures lead to different insights into factors that structure microbial communities. Appl. Environ. Microbiol. 2007, 73, 1576–1585. [Google Scholar] [CrossRef]
- Fisher, R.A. The use of multiple measurements in taxonomic problems. Ann. Eugen. 1936, 7, 179–188. [Google Scholar] [CrossRef]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef]
- Lin, H.; Peddada, S.D. Analysis of compositions of microbiomes with bias correction. Nat. Commun. 2020, 11, 3514. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S.; Sato, Y.; Kawashima, M.; Furumichi, M.; Tanabe, M. Data, information, knowledge and principle: Back to metabolism in KEGG. Nucleic Acids Res. 2014, 42, D199–D205. [Google Scholar] [CrossRef]
- Junker, B.H.; Klukas, C.; Schreiber, F. VANTED: A system for advanced data analysis and visualization in the context of biological networks. BMC Bioinform. 2006, 7, 109. [Google Scholar] [CrossRef] [PubMed]
- Douglas, G.M.; Maffei, V.J.; Zaneveld, J.R.; Yurgel, S.N.; Brown, J.R.; Taylor, C.M.; Huttenhower, C.; Langille, M.G.I. PICRUSt2 for prediction of metagenome functions. Nat. Biotechnol. 2020, 38, 685–688. [Google Scholar] [CrossRef] [PubMed]
- Miadlikowska, J.; Kauff, F.; Hofstetter, V.; Fraker, E.; Grube, M.; Hafellner, J.; Reeb, V.; Hodkinson, B.P.; Kukwa, M.; Lucking, R.; et al. New insights into classification and evolution of the Lecanoromycetes (Pezizomycotina, Ascomycota) from phylogenetic analyses of three ribosomal RNA- and two protein-coding genes. Mycologia 2006, 98, 1088–1103. [Google Scholar] [CrossRef] [PubMed]
- Allen, J.; Yahr, R.; Lymbery, C.; Batallas-Molina, R.; Bungartz, F.; Dal Forno, M.; Howe, N.; Lendemer, J.; McMullin, T.; Mertens, A.; et al. Canoparmelia caroliniana. The IUCN Red List of Threatened Species 2021: E.T194662208A194678189. Available online: https://doi.org/10.2305/IUCN.UK.2021-2.RLTS.T194662208A194678189.en (accessed on 12 December 2023).
- Rambold, G.; Davydov, E.; Elix, J.A.; Haiduk, E.; Nash, T.H., III; Scheidegger, C.; Zedda, L. (Eds.) LIAS Light—A Database for Rapid Identification of Lichens. 2001 Onwards. Available online: http://liaslight.lias.net/Descriptions/ItemID_3723.html (accessed on 12 December 2023).
- Consortium of Lichen Herbaria. Available online: https://lichenportal.org/portal/taxa/index.php?taxon=54736&clid=1090 (accessed on 12 December 2023).
- Moncada, B.; Reidy, B.; Lücking, R. A phylogenetic revision of Hawaiian Pseudocyphellaria sensu lato (lichenized Ascomycota: Lobariaceae) reveals eight new species and a high degree of inferred endemism. Bryologist 2014, 117, 119–160. Available online: https://www.jstor.org/stable/43188679 (accessed on 12 December 2023). [CrossRef]
- Škaloud, P.; Steinová, J.; Řídká, T.; Vančurová, L.; Peksa, O. Assembling the challenging puzzle of algal biodiversity: Species delimitation within the genus Asterochloris (Trebouxiophyceae, Chlorophyta). J. Phycol. 2015, 51, 507–527. [Google Scholar] [CrossRef] [PubMed]
- Vančurová, L.; Peksa, O.; Němcová, Y.; Škaloud, P. Vulcanochloris (Trebouxiales, Trebouxiophyceae), a new genus of lichen photobiont from La Palma, Canary Islands, Spain. Phytotaxa 2015, 219, 118–132. [Google Scholar] [CrossRef]
- Friedl, T.; Rokitta, C. Species relationships in the lichen alga Trebouxia (chlorophyta, trebouxiophyceae): Molecular phylogenetic analyses of nuclear-encoded large subunit rRNA gene sequences. Symbiosis 1997, 23, 125–148. Available online: http://hdl.handle.net/10222/77587 (accessed on 12 December 2023).
- Navarro-Noya, Y.E.; Jiménez-Aguilar, A.; Valenzuela-Encinas, C.; Alcántara-Hernández, R.J.; Víctor, M.; Ruíz-Valdiviezo, V.M.; Ponce-Mendoza, A.; Luna-Guido, M.; Marsch, R.; Dendooven, L. Bacterial communities in soil under moss and lichen-moss crusts. Geomicrobiol. J. 2014, 31, 152–160. [Google Scholar] [CrossRef]
- Warren-Rhodes, K.A.; Kevin L., R.; Boyle, L.N.; Pointing, S.B.; Chen, Y.; Liu, S.; Zhuo, P.; McKay, C.P. Cyanobacterial ecology across environmental gradients and spatial scales in China’s hot and cold deserts. FEMS Microbiol. Ecol. 2007, 61, 470–482. [Google Scholar] [CrossRef] [PubMed]
- Weber, C.E.; King, G.M. Distribution and diversity of carbon monoxide-oxidizing bacteria and bulk bacterial communities across a succession gradient on a Hawaiian volcanic deposit. Environ. Microbiol. 2010, 12, 1855–1867. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-S.; Sparovek, G.; Longo, M.L.; De Melo, W.J.; Crowley, D. Bacterial diversity of terra preta and pristine forest soil from the Western Amazon. Soil Biol. Biochem. 2007, 39, 684–690. [Google Scholar] [CrossRef]
- Weeraphan, T.; Somphong, A.; Poengsungnoen, V.; Buaruang, K.; Harunari, E.; Igarashi, Y.; Tanasupawat, S.; Phongsopitanun, W. Bacterial microbiome in tropical lichens and the effect of the isolation method on culturable lichen-derived actinobacteria. Sci. Rep. 2023, 13, 5483. [Google Scholar] [CrossRef]
- Kers, J.G.; Saccenti, E. The power of microbiome studies: Some considerations on which alpha and beta metrics to use and how to report results. Front. Microbiol. 2022, 12, 796025. [Google Scholar] [CrossRef]
- Pankratov, T.A.; Grouzdev, D.S.; Patutina, E.O.; Kolganova, T.V.; Suzina, N.E.; Berestovskaya, J.I. Lichenibacterium ramalinae gen. nov, sp. nov., Lichenibacterium minor sp. nov., the first endophytic, beta-carotene producing bacterial representatives from lichen thalli and the proposal of the new family Lichenibacteriaceae within the order Rhizobiales. Antonie Leeuwenhoek 2020, 113, 477–489. [Google Scholar] [CrossRef] [PubMed]
- Hördt, A.; López, M.G.; Meier-Kolthoff, J.P.; Schleuning, M.; Weinhold, L.M.; Tindall, B.J.; Gronow, S.; Kyrpides, N.C.; Woyke, T.; Göker, M. Analysis of 1000+ type-strain genomes substantially improves taxonomic classification of Alphaproteobacteria. Front. Microbiol. 2020, 11, 468. [Google Scholar] [CrossRef]
- Grimm, M.; Grube, M.; Schiefelbein, U.; Zühlke, D.; Bernhardt, J.; Riedel, K. The lichens’ microbiota, still a mystery? Front. Microbiol. 2021, 12, 623839. [Google Scholar] [CrossRef]
- Noh, H.J.; Baek, K.; Hwang, C.Y.; Shin, S.C.; Hong, S.G.; Lee, Y.M. Lichenihabitans psoromatis gen. nov., sp. nov., a member of a novel lineage (Lichenihabitantaceae fam. nov.) within the order of Rhizobiales isolated from Antarctic lichen. Int. J. Syst. Evol. Microbiol. 2019, 69, 3837–3842. [Google Scholar] [CrossRef]
- Wedin, M.; Westberg, M. Lichens. In The Fungi, 2nd ed.; Mueller, G.M., Bills, G.F., Foster, M.S., Eds.; Academic Press: San Diego, CA, USA, 2011; pp. 353–369. [Google Scholar]
- Paul, F.; Otte, J.; Schmitt, I.; Dal Grande, F. Comparing Sanger sequencing and high-throughput metabarcoding for inferring photobiont diversity in lichens. Sci. Rep. 2018, 8, 8624. [Google Scholar] [CrossRef]
- Rikkinen, J. Symbiotic cyanobacteria in lichens. In Algal and Cyanobacterial Symbioses; Grube, M., Seckbach, J., Muggia, L., Eds.; World Scientific Publishing: London, UK, 2017; pp. 147–167. [Google Scholar] [CrossRef]
- Lange, O.L.; Kilian, E.; Ziegler, H. Water vapor uptake and photosynthesis of lichens: Performance differences in species with green and blue-green algae as phycobionts. Oecologia 1986, 71, 104–110. [Google Scholar] [CrossRef] [PubMed]
- Sharnoff, S. Lichens and Invertebrates: A Brief Review and Bibliography. 1998. Available online: https://www.sharnoffphotos.com/lichen_info/invertebrates.html (accessed on 12 December 2023).
- Rikkinen, J. Cyanobacteria in terrestrial symbiotic systems. In Modern Topics in the Phototrophic Prokaryotes: Environmental and Applied Aspects; Hallenbeck, P., Ed.; Springer International Publishing AG: London, UK, 2017; pp. 243–294. [Google Scholar] [CrossRef]
- Jung, P.; Brust, K.; Schultz, M.; Büdel, B.; Donner, A.; Lakatos, M. Opening the gap: Rare lichens with rare cyanobionts—Unexpected cyanobiont diversity in cyanobacterial lichens of the order Lichinales. Front. Microbiol. 2021, 12, 728378. [Google Scholar] [CrossRef]
- Paulsrud, P.; Rikkinen, J.; Lindblad, P. Spatial patterns of photobiont diversity in some Nostoc-containing lichens. New Phytol. 2000, 146, 291–299. [Google Scholar] [CrossRef] [PubMed]
- Paulsrud, P.; Rikkinen, J.; Lindblad, P. Field investigations on cyanobacterial specificity in Peltigera aphthosa. New Phytol. 2001, 152, 117–123. [Google Scholar] [CrossRef] [PubMed]
- Hyvärinen, M.; Härdling, R.; Tuomi, J. Cyanobacterial lichen symbiosis: The fungal partner as an optimal harvester. Oikos 2002, 98, 498–504. [Google Scholar] [CrossRef]
- Palmqvist, K. Cyanolichens: Carbon metabolism. In Cyanobacteria in Symbiosis; Rai, A.N., Bergman, B., Rasmussen, U., Eds.; Springer: Dordrecht, The Netherlands, 2002. [Google Scholar] [CrossRef]
Region | Sample Code | Latitude | Longitude | Altitude |
---|---|---|---|---|
Churi Tepui, Guiana Shield, Venezuela | G01 | 05°15′11″ N to 05°15′13″ N | 62°00′40″ W to 62°00′42″ W | 2380 m to 2385 m |
G02 | ||||
G03 | ||||
G04 | ||||
G05 | ||||
G06 | ||||
G07 | ||||
G08 | ||||
G08 | ||||
G10 | ||||
G11 | ||||
G12 | ||||
Golden Gate National Park, Highveld Plateau, South Africa | SA01 | 28°30′03″ S | 28°37′17″ E | 2011 m |
SA02 | 28°30′04″ S | 28°37′17″ E | 2019 m | |
SA03 | 28°29′34″ S | 28°39′36″ E | 2020 m | |
SA04 | 28°30′04″ S | 28°37′17″ E | 2019 m | |
SA05 | 28°29′22″ S | 28°41′50″ E | 1884 m | |
SA06 | 28°30′04″ S | 28°37′17″ E | 2019 m | |
SA07 | 28°30′05″ S | 28°36′58″ E | 1997 m | |
SA08 | 28°30′04″ S | 28°37′17″ E | 2019 m |
Target Sequence | Primer Designation | F/R | Length (-mer) | 5′ → 3′ | Expected Product Size |
---|---|---|---|---|---|
Fungal 18S rDNA | NS17UCB | F | 19 | CATGTCTAAGTTTAAGCAA | 2.0 kbp |
NS24UCB | R | 20 | AAACCTTGTTACGACTTTTA | ||
Algal 18S rDNA | Euk F | F | 21 | AACCTGGTTGATCCTGCCAGT | 1.8 kbp |
Al1700r * | R | 18 | CTCCTTCCTCTAGGTGGG | ||
V3–V4 region of 16S rDNA | 341F | F | 17 | CCTACGGGNGGCWGCAG | 460 bp |
806R | R | 21 | GACTACHVGGGTATCTAATCC |
Sample Code | Closest Species | Common Name | Growth Form | |||
---|---|---|---|---|---|---|
Order | Family | Genus | Species | |||
G01 | Lecanorales | Parmeliaceae | Alectoria | sarmentosa | Witch’s hair lichen | Fruticose |
G02 | ||||||
G03 | Usnea | florida | Beard lichen | |||
G04 | ||||||
G05 | Menegazzia | terebrata | Honeycombed lichen | Foliose | ||
G06 | ||||||
G07 | Canoparmelia | caroliniana | Carolina shield lichen | |||
G08 | ||||||
G09 | ||||||
G10 | ||||||
G11 | ||||||
G12 | ||||||
SA01 | ||||||
SA02 | ||||||
SA03 | Xanthoparmelia | conspersa | Rock-shield lichen | |||
SA04 | ||||||
SA05 | ||||||
SA06 | Peltigerales | Peltigeraceae subfamily Lobarioideae | Crocodia | aurata | Specklebelly lichen | |
SA07 | ||||||
SA08 |
Sample Code | Raw Read | Valid Read | OTU | Species | Genus | Family | Order | Class | Phylum | Mean Length (bp) |
---|---|---|---|---|---|---|---|---|---|---|
G01 | 38,482 | 33,984 | 326 | 249 | 119 | 62 | 42 | 27 | 12 | 396.5 |
G02 | 60,137 | 36,389 | 220 | 127 | 77 | 44 | 31 | 24 | 12 | 402.0 |
G03 | 39,256 | 32,219 | 392 | 195 | 115 | 58 | 39 | 29 | 12 | 400.3 |
G04 | 45,447 | 39,756 | 350 | 198 | 113 | 60 | 40 | 25 | 10 | 397.2 |
G05 | 100,000 | 83,914 | 1457 | 312 | 162 | 86 | 51 | 37 | 14 | 402.9 |
G06 | 37,458 | 35,926 | 800 | 566 | 224 | 94 | 59 | 38 | 15 | 402.0 |
G07 | 78,983 | 72,353 | 1202 | 536 | 222 | 90 | 58 | 39 | 17 | 407.4 |
G08 | 79,798 | 68,704 | 1141 | 309 | 176 | 89 | 53 | 38 | 14 | 402.5 |
G09 | 48,630 | 44,686 | 945 | 617 | 240 | 99 | 59 | 38 | 16 | 402.5 |
G10 | 37,557 | 36,431 | 669 | 386 | 164 | 77 | 51 | 33 | 14 | 398.7 |
G11 | 91,956 | 84,812 | 1666 | 782 | 273 | 113 | 71 | 44 | 19 | 406.4 |
G12 | 69,524 | 61,874 | 1104 | 507 | 218 | 93 | 58 | 38 | 16 | 402.6 |
Subtotal | 727,228 | 631,048 | 3328 | 1399 | 547 | 204 | 106 | 60 | 23 | 401.8 |
SA01 | 28,046 | 22,570 | 1127 | 751 | 323 | 136 | 71 | 40 | 15 | 406.1 |
SA02 | 25,357 | 17,658 | 1074 | 750 | 305 | 134 | 69 | 38 | 17 | 406.9 |
SA03 | 65,414 | 53,190 | 1462 | 688 | 302 | 144 | 90 | 52 | 16 | 407.1 |
SA04 | 20,358 | 11,952 | 1204 | 909 | 392 | 157 | 78 | 46 | 19 | 407.3 |
SA05 | 38,753 | 32,312 | 1075 | 705 | 283 | 121 | 69 | 40 | 17 | 405.5 |
SA06 | 16,328 | 12,163 | 834 | 601 | 268 | 117 | 54 | 33 | 14 | 405.6 |
SA07 | 55,206 | 44,936 | 1644 | 1054 | 421 | 163 | 91 | 46 | 17 | 407.5 |
SA08 | 33,318 | 22,985 | 1423 | 893 | 378 | 148 | 74 | 41 | 15 | 408.1 |
Subtotal | 282,780 | 217,766 | 3782 | 2221 | 755 | 275 | 133 | 67 | 23 | 406.8 |
Total | 1,010,008 | 848,814 | 6051 | 2908 | 973 | 331 | 157 | 79 | 26 | 403.8 |
Distribution | Observed OTU | Species | Genus | Family | Order | Class | Phylum |
---|---|---|---|---|---|---|---|
Only in the Guiana region | 2269 | 687 | 218 | 56 | 24 | 12 | 3 |
Only in the South Africa region | 2723 | 1509 | 426 | 127 | 51 | 19 | 3 |
Common to both regions | 1059 | 712 | 329 | 148 | 82 | 48 | 20 |
Total | 6051 | 2908 | 973 | 331 | 157 | 79 | 26 |
Sample Code | Observed OTU | Chao1 | Shannon (ENS) | Simpson (ENS) | ||
---|---|---|---|---|---|---|
G01 | 326 | 373.7 | 3.30 | 27.1 | 0.09 | 11.1 |
G02 | 220 | 229.6 | 1.57 | 4.8 | 0.49 | 2.0 |
G03 | 392 | 400.9 | 3.76 | 42.9 | 0.08 | 12.5 |
G04 | 350 | 363.4 | 3.31 | 27.4 | 0.14 | 7.1 |
G05 | 1457 | 1461.9 | 5.41 | 223.6 | 0.01 | 100.0 |
G06 | 800 | 846.8 | 5.09 | 162.4 | 0.01 | 100.0 |
G07 | 1202 | 1223.9 | 5.27 | 194.4 | 0.01 | 100.0 |
G08 | 1141 | 1147.3 | 5.27 | 194.4 | 0.01 | 100.0 |
G09 | 945 | 994.1 | 5.11 | 165.7 | 0.01 | 100.0 |
G10 | 669 | 689.0 | 5.19 | 179.5 | 0.01 | 100.0 |
G11 | 1666 | 1699.7 | 5.59 | 267.7 | 0.01 | 100.0 |
G12 | 1104 | 1117.5 | 4.98 | 145.5 | 0.02 | 50.0 |
Average | 856.0 | 879.0 | 4.49 | 136.3 | 0.07 | 65.2 |
SA01 | 1127 | 1200.3 | 5.36 | 212.7 | 0.01 | 100.0 |
SA02 | 1074 | 1169.0 | 5.31 | 202.4 | 0.01 | 100.0 |
SA03 | 1462 | 1502.7 | 5.15 | 172.4 | 0.02 | 50.0 |
SA04 | 1204 | 1341.4 | 5.68 | 292.9 | 0.01 | 100.0 |
SA05 | 1075 | 1117.2 | 5.04 | 154.5 | 0.02 | 50.0 |
SA06 | 834 | 906.4 | 5.18 | 177.7 | 0.02 | 50.0 |
SA07 | 1644 | 1720.4 | 5.71 | 301.9 | 0.01 | 100.0 |
SA08 | 1423 | 1514.7 | 5.68 | 292.9 | 0.01 | 100.0 |
Average | 1230.4 | 1309.0 | 5.39 | 225.9 | 0.01 | 81.3 |
Region | Code in Figure 4 | Rank of Biomarker | LDA Score | p-Value | ||||
---|---|---|---|---|---|---|---|---|
Phylum | Class | Order | Family | Genus | ||||
Venezuelan Guiana Shield | b8 | Pseudomonadota | Alphaproteobacteria | Rhodospirillales | 4.5925 | 0.025260 | ||
b7 | Pseudomonadota | Alphaproteobacteria | Rhodospirillales | Acetobacteraceae | 4.5848 | 0.025260 | ||
South African Highveld Plateau | - | Actinomycetota | 4.9213 | 0.000288 | ||||
k | Actinomycetota | Actinomycetota_c | 4.9016 | 0.000213 | ||||
d | Actinomycetota | Actinomycetota_c | Frankiales | 4.5269 | 0.000213 | |||
b0 | Pseudomonadota | Alphaproteobacteria | Hyphomicrobiales syn. Rhizobiales | Lichenibacteriaceae | EU289441_g | 4.5234 | 0.013555 | |
c2 | Pseudomonadota | Alphaproteobacteria | Sphingomonadales | 4.6048 | 0.000213 | |||
c1 | Pseudomonadota | Alphaproteobacteria | Sphingomonadales | Sphingomonadaceae | 4.6021 | 0.000288 | ||
c0 | Pseudomonadota | Alphaproteobacteria | Sphingomonadales | Sphingomonadaceae | Sphingomonas | 4.5524 | 0.000517 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, Z.; Naganuma, T.; Melville, H.I.A.S. Bacteriomic Profiles of Rock-Dwelling Lichens from the Venezuelan Guiana Shield and the South African Highveld Plateau. Microorganisms 2024, 12, 290. https://doi.org/10.3390/microorganisms12020290
He Z, Naganuma T, Melville HIAS. Bacteriomic Profiles of Rock-Dwelling Lichens from the Venezuelan Guiana Shield and the South African Highveld Plateau. Microorganisms. 2024; 12(2):290. https://doi.org/10.3390/microorganisms12020290
Chicago/Turabian StyleHe, Zichen, Takeshi Naganuma, and Haemish I. A. S. Melville. 2024. "Bacteriomic Profiles of Rock-Dwelling Lichens from the Venezuelan Guiana Shield and the South African Highveld Plateau" Microorganisms 12, no. 2: 290. https://doi.org/10.3390/microorganisms12020290