Gene Expression of Ethanol and Acetate Metabolic Pathways in the Acinetobacter baumannii EmaSR Regulon
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, Primers, and Growth of Strains
2.2. Green Florescence Assay
2.3. Purification of DJ41_2796 and Enzymatic Assay
3. Results
3.1. Genes of EmaSR Regulons Were Upregulated in a Low-Concentration Ethanol Environment
3.2. EmaSR Regulates DJ41_2796 and DJ41_3218 in Acetate Culture Conditions
3.3. EmaR Enhances the Expression of PemaS and PemaR in Acetate
3.4. DJ41_2796 Possesses Acetate: Succinyl-CoA Transferase Enzymatic Activity
3.5. Kinetic Characterization of DJ41_2796
4. Discussion
4.1. Expression of Emas in Ethanol and Acetate May Be Inhibited by Other Regulatory Proteins
4.2. DJ41_2796 Plays a Crucial Role in the Ethanol and Acetate Metabolism of A. baumannii ATCC19606
4.3. EmaSR May Influence the Pyruvate Metabolism by Regulating the Metabolism of Ethanol and Acetate
4.4. EmaSR Regulation of Pyruvate Metabolism and the Relationship with Virulence
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lo, E.A.-G.; Law, L.S.-C.; Tan, K.; Ashokka, B. A review of the science and clinical use of alcohol-based hand rubs. Int. J. Infect. Control 2022, 18, 20611. [Google Scholar] [CrossRef]
- Yeung, Y.W.S.; Ma, Y.; Liu, S.Y.; Pun, W.H.; Chua, S.L. Prevalence of alcohol-tolerant and antibiotic-resistant bacterial pathogens on public hand sanitizer dispensers. J. Hosp. Infect. 2022, 127, 26–33. [Google Scholar] [CrossRef]
- Kampf, G. Ethanol. In Antiseptic Stewardship: Biocide Resistance and Clinical Implications; Kampf, G., Ed.; Springer: Cham, Switzerland, 2018; pp. 9–35. [Google Scholar]
- Tashiro, Y.; Inagaki, A.; Ono, K.; Inaba, T.; Yawata, Y.; Uchiyama, H.; Nomura, N. Low concentrations of ethanol stimulate biofilm and pellicle formation in Pseudomonas aeruginosa. Biosci. Biotechnol. Biochem. 2014, 78, 178–181. [Google Scholar] [CrossRef]
- Reid, M.F.; Fewson, C.A. Molecular characterization of microbial alcohol dehydrogenases. Crit. Rev. Microbiol. 1994, 20, 13–56. [Google Scholar] [CrossRef]
- Shortall, K.; Djeghader, A.; Magner, E.; Soulimane, T. Insights into Aldehyde Dehydrogenase Enzymes: A Structural Perspective. Front. Mol. Biosci. 2021, 8, 659550. [Google Scholar] [CrossRef]
- Xiong, R.G.; Zhou, D.D.; Wu, S.X.; Huang, S.Y.; Saimaiti, A.; Yang, Z.J.; Shang, A.; Zhao, C.N.; Gan, R.Y.; Li, H.B. Health Benefits and Side Effects of Short-Chain Fatty Acids. Foods 2022, 11, 2863. [Google Scholar] [CrossRef]
- Machado, M.G.; Patente, T.A.; Rouillé, Y.; Heumel, S.; Melo, E.M.; Deruyter, L.; Pourcet, B.; Sencio, V.; Teixeira, M.M.; Trottein, F. Acetate Improves the Killing of Streptococcus pneumoniae by Alveolar Macrophages via NLRP3 Inflammasome and Glycolysis-HIF-1α Axis. Front. Immunol. 2022, 13, 773261. [Google Scholar] [CrossRef]
- El-Mansi, M. Control of central metabolism’s architecture in Escherichia coli: An overview. Microbiol. Res. 2023, 266, 127224. [Google Scholar] [CrossRef]
- Mutyala, S.; Kim, J.R. Recent advances and challenges in the bioconversion of acetate to value-added chemicals. Bioresour. Technol. 2022, 364, 128064. [Google Scholar] [CrossRef]
- Hempel, N.; Görisch, H.; Mern, D.S. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa. J. Bacteriol. 2013, 195, 3925–3932. [Google Scholar] [CrossRef] [PubMed]
- Badal, D.; Jayarani, A.V.; Kollaran, M.A.; Prakash, D.; Monisha, P.; Singh, V. Foraging Signals Promote Swarming in Starving Pseudomonas aeruginosa. mBio 2021, 12, e0203321. [Google Scholar] [CrossRef] [PubMed]
- Henríquez, T.; Hsu, J.S.; Hernandez, J.S.; Kuppermann, S.; Eder, M.; Jung, H. Contribution of Uncharacterized Target Genes of MxtR/ErdR to Carbon Source Utilization by Pseudomonas putida KT2440. Microbiol. Spectr. 2023, 11, e0292322. [Google Scholar] [CrossRef] [PubMed]
- Casella, L.G.; Torres, N.J.; Tomlinson, B.R.; Shepherd, M.; Shaw, L.N. The novel two-component system AmsSR governs alternative metabolic pathway usage in Acinetobacter baumannii. Front. Microbiol. 2023, 14, 1139253. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Huang, X.; Jin, Q.; Tang, J.; Zhang, H.; Zhang, J.R.; Wu, H. Two-Component Response Regulator OmpR Regulates Mucoviscosity through Energy Metabolism in Klebsiella pneumoniae. Microbiol. Spectr. 2023, 11, e0054423. [Google Scholar] [CrossRef] [PubMed]
- Wittekind, M.A. The Small Protein ScrA Is a Novel Regulator of Staphylococcus aureus Virulence Acting as an Intermediary between the ArlRS and SaeRS Two-Component Systems. Ph.D. Dissertation, Ohio University, Athens, OH, USA. Available online: https://www.proquest.com/dissertations-theses/small-protein-scra-is-novel-regulator-em/docview/2856749705/se-2 (accessed on 5 May 2023).
- Lin, G.H.; Hsieh, M.C.; Shu, H.Y. Role of Iron-Containing Alcohol Dehydrogenases in Acinetobacter baumannii ATCC 19606 Stress Resistance and Virulence. Int. J. Mol. Sci. 2021, 22, 9921. [Google Scholar] [CrossRef] [PubMed]
- Shu, H.Y.; Huang, Y.W.; Tsai, P.Y.; Hsieh, K.S.; Lin, G.H. Role of EmaSR in Ethanol Metabolism by Acinetobacter baumannii. Int. J. Mol. Sci. 2022, 23, 12606. [Google Scholar] [CrossRef]
- Hunger, M.; Schmucker, R.; Kishan, V.; Hillen, W. Analysis and nucleotide sequence of an origin of DNA replication in Acinetobacter calcoaceticus and its use for Escherichia coli shuttle plasmids. Gene 1990, 87, 45–51. [Google Scholar] [CrossRef]
- Bouvet, P.J.M.; Grimont, P.A.D. Taxonomy of the genus Acinetobacter with the recognition of Acinetobacter baumannii sp. nov., Acinetobacter haemolyticus sp. nov., Acinetobacter johnsonii sp. nov., and Acinetobacter junii sp. nov. and emended descriptions of Acinetobacter calcoaceticus and Acinetobacter lwoffii. Int. J. Syst. Evol. Microbiol. 1986, 36, 228–240. [Google Scholar]
- Chen, T.L.; Siu, L.K.; Wu, R.C.; Shaio, M.F.; Huang, L.Y.; Fung, C.P.; Lee, C.M.; Cho, W.L. Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii. Clin. Microbiol. Infect. 2007, 13, 801–806. [Google Scholar] [CrossRef]
- Crameri, A.; Whitehorn, E.A.; Tate, E.; Stemmer, W.P. Improved green fluorescent protein by molecular evolution using DNA shuffling. Nat. Biotechnol. 1996, 14, 315–319. [Google Scholar] [CrossRef]
- Mullins, E.A.; Kappock, T.J. Crystal structures of Acetobacter aceti succinyl-coenzyme A (CoA): Acetate CoA-transferase reveal specificity determinants and illustrate the mechanism used by class I CoA-transferases. Biochemistry 2012, 51, 8422–8434. [Google Scholar] [CrossRef] [PubMed]
- Mochizuki, K.; Inaoka, D.K.; Mazet, M.; Shiba, T.; Fukuda, K.; Kurasawa, H.; Millerioux, Y.; Boshart, M.; Balogun, E.O.; Harada, S.; et al. The ASCT/SCS cycle fuels mitochondrial ATP and acetate production in Trypanosoma brucei. Biochim. Biophys. Acta Bioenerg. 2020, 1861, 148283. [Google Scholar] [CrossRef] [PubMed]
- Eyer, P.; Worek, F.; Kiderlen, D.; Sinko, G.; Stuglin, A.; Simeon-Rudolf, V.; Reiner, E. Molar absorption coefficients for the reduced Ellman reagent: Reassessment. Anal. Biochem. 2003, 312, 224–227. [Google Scholar] [CrossRef] [PubMed]
- Römling, U.; Cao, L.Y.; Bai, F.W. Evolution of cyclic di-GMP signalling on a short and long term time scale. Microbiology 2023, 169, 001354. [Google Scholar] [CrossRef] [PubMed]
- Xia, K.; Han, C.; Xu, J.; Liang, X. Transcriptome response of Acetobacter pasteurianus Ab3 to high acetic acid stress during vinegar production. Appl. Microbiol. Biotechnol. 2020, 104, 10585–10599. [Google Scholar] [CrossRef]
- Yang, H.; Chen, T.; Wang, M.; Zhou, J.; Liebl, W.; Barja, F.; Chen, F. Molecular biology: Fantastic toolkits to improve knowledge and application of acetic acid bacteria. Biotechnol. Adv. 2022, 58, 107911. [Google Scholar] [CrossRef]
- Kwong, W.K.; Zheng, H.; Moran, N.A. Convergent evolution of a modified, acetate-driven TCA cycle in bacteria. Nat. Microbiol. 2017, 2, 17067. [Google Scholar] [CrossRef]
- Zhang, B.; Lingga, C.; Bowman, C.; Hackmann, T.J. A New Pathway for Forming Acetate and Synthesizing ATP during Fermentation in Bacteria. Appl. Environ. Microbiol. 2021, 87, e0295920. [Google Scholar] [CrossRef]
- Arai, H.; Sakurai, K.; Ishii, M. Metabolic Features of Acetobacter aceti. In Acetic Acid Bacteria: Ecology and Physiology; Matsushita, K., Toyama, H., Tonouchi, N., Okamoto-Kainuma, A., Eds.; Springer: Tokyo, Japan, 2016; pp. 255–271. [Google Scholar]
- Doan, T.; Servant, P.; Tojo, S.; Yamaguchi, H.; Lerondel, G.; Yoshida, K.I.; Fujita, Y.; Aymerich, S. The Bacillus subtilis ywkA gene encodes a malic enzyme and its transcription is activated by the YufL/YufM two-component system in response to malate. Microbiology 2003, 149, 2331–2343. [Google Scholar] [CrossRef]
- Charbonnier, T.; Le Coq, D.; McGovern, S.; Calabre, M.; Delumeau, O.; Aymerich, S.; Jules, M. Molecular and Physiological Logics of the Pyruvate-Induced Response of a Novel Transporter in Bacillus subtilis. mBio 2017, 8, e00976-17. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, M. Studies on regulatory functions of malic enzymes. IV. Effects of sulfhydryl group modification on the catalytic function of NAD-linked malic enzyme from Escherichia coli. J. Biochem. 1979, 86, 325–333. [Google Scholar] [CrossRef] [PubMed]
- Echlin, H.; Frank, M.; Rock, C.; Rosch, J.W. Role of the pyruvate metabolic network on carbohydrate metabolism and virulence in Streptococcus pneumoniae. Mol. Microbiol. 2020, 114, 536–552. [Google Scholar] [CrossRef] [PubMed]
No. | Description | References or Source | |
---|---|---|---|
Escherichia coli (E. coli) | |||
1 | DH5α | F−, supE44, hsdR17, reA1, gyrA96, endA1, thi-1, relA1, delR, λ− | ATCC 53868 |
2 | DH5α/pQE80LK-DJ41_2796 | DH5α contain pQE80LK-DJ41_2796, Kmr | This study |
3 | DH5α/TCSG | DH5α contain TCSG, Apr | This study |
4 | DH5α/TCS-PemaSG | DH5α contain TCS-PemaSG, Apr | This study |
5 | DH5α/TCS-PemaRG | DH5α contain TCS-PemaRG, Apr | This study |
6 | DH5α/TCS-P571G | DH5α contain TCS-P571G, Apr | This study |
7 | DH5α/TCS-P2796G | DH5α contain TCS-P2796G, Apr | This study |
8 | DH5α/TCS-P3218G | DH5α contain TCS-P3218G, Apr | This study |
9 | DH5α/TCS-P3568G | DH5α contain TCS-P3568G, Apr | This study |
10 | DH5α/pWH1266 | DH5α contain pWH1266, Apr; Tetr | [19] |
11 | DH5α/pWH1266G | DH5α contain pWH1266G, Tetr | This study |
12 | DH5α/pWH1266-PemaSG | DH5α contain pWH1266-PemaSG, Tetr | This study |
13 | DH5α/pWH1266-PemaRG | DH5α contain pWH1266-PemaRG, Tetr | This study |
14 | DH5α/pWH1266-P571G | DH5α contain pWH1266-P571G, Tetr | This study |
15 | DH5α/pWH1266-P2796G | DH5α contain pWH1266-P2796G, Tetr | This study |
16 | DH5α/pWH1266-P3218G | DH5α contain pWH1266-P3218G, Tetr | This study |
17 | DH5α/pWH1266-P3568G | DH5α contain pWH1266-P3568G, Tetr | This study |
Acinetobacter baumannii (A. baumannii) | |||
18 | ATCC 19606 | Apr, clinical isolate, wild type | [20] |
19 | ATCC 19606/pWH1266G | ATCC 19606 contain pWH1266G, Apr, Tetr | This study |
20 | ATCC 19606/pWH1266-PemaSG | ATCC 19606 contain pWH1266-PemaSG, Apr, Tetr | This study |
21 | ATCC 19606/pWH1266-PemaRG | ATCC 19606 contain pWH1266-PemaRG, Apr, Tetr | This study |
22 | ATCC 19606/pWH1266-P2796G | ATCC 19606 contain pWH1266-P2796G, Apr, Tetr | This study |
23 | ATCC 19606/pWH1266-P3218G | ATCC 19606 contain pWH1266-P3218G, Apr, Tetr | This study |
24 | ATCC 19606/pWH1266-P3568G | ATCC 19606 contain pWH1266-P3568G, Apr, Tetr | This study |
25 | ∆emaS | ATCC 19606, ∆emaS, Apr | [18] |
26 | ∆emaS/pWH1266G | ∆emaS contain pWH1266G, Apr, Tetr | This study |
27 | ∆emaS/pWH1266-PemaSG | ∆emaS contain pWH1266-PemaSG, Apr, Tetr | This study |
28 | ∆emaS/pWH1266-PemaRG | ∆emaS contain pWH1266-PemaRG, Apr, Tetr | This study |
29 | ∆emaS/pWH1266-P571G | ∆emaS contain pWH1266-P571G, Apr, Tetr | This study |
30 | ∆emaS/pWH1266-P2796G | ∆emaS contain pWH1266-P2796G, Apr, Tetr | This study |
31 | ∆emaS/pWH1266-P3218G | ∆emaS contain pWH1266-P3218G, Apr, Tetr | This study |
32 | ∆emaS/pWH1266-P3568G | ∆emaS contain pWH1266-P3568G, Apr, Tetr | This study |
33 | ∆emaR | ATCC 19606, ∆emaR, Apr | [18] |
34 | ∆emaR/pWH1266G | ∆emaR contain pWH1266G, Apr, Tetr | This study |
35 | ∆emaR/pWH1266-PemaSG | ∆emaR contain pWH1266-PemaSG, Apr, Tetr | This study |
36 | ∆emaR/pWH1266-PemaRG | ∆emaR contain pWH1266-PemaRG, Apr, Tetr | This study |
37 | ∆emaR/pWH1266-P571G | ∆emaR contain pWH1266-P571G, Apr, Tetr | This study |
38 | ∆emaR/pWH1266-P2796G | ∆emaR contain pWH1266-P2796G, Apr, Tetr | This study |
39 | ∆emaR/pWH1266-P3218G | ∆emaR contain pWH1266-P3218G, Apr, Tetr | This study |
40 | ∆emaR/pWH1266-P3568G | ∆emaS contain pWH1266-P3568G, Apr, Tetr | This study |
41 | ∆emaSR | ATCC 19606, ∆emaSR, Apr | [18] |
42 | ∆emaSR/pWH1266G | ∆emaSR contain pWH1266G, Apr, Tetr | This study |
43 | ∆emaSR/pWH1266-PemaSG | ∆emaSR contain pWH1266-PemaSG, Apr, Tetr | This study |
44 | ∆emaSR/pWH1266-PemaRG | ∆emaSR contain pWH1266-PemaRG, Apr, Tetr | This study |
45 | ∆emaSR/pWH1266-P571G | ∆emaSR contain pWH1266-P571G, Apr, Tetr | This study |
46 | ∆emaSR/pWH1266-P2796G | ∆emaSR contain pWH1266-P2796G, Apr, Tetr | This study |
47 | ∆emaSR/pWH1266-P3218G | ∆emaSR contain pWH1266-P3218G, Apr, Tetr | This study |
48 | emaSR/pWH1266-P3568G | ∆emaSR contain pWH1266-P3568G, Apr, Tetr | This study |
No | Description | References or Source | |
---|---|---|---|
1 | pQE80LK | expression vector, pUC ori; Kmr | This study |
2 | pQE80LK-DJ41_2796 | pQE80LK/DJ41_2796; Kmr | This study |
3 | TCSG | pGFPuv/emaS; emaR; gfpuv; Apr | This study |
4 | TCS-PemaSG | pGFPuv/emaS; emaR; PemaS-gfpuv; Apr | This study |
5 | TCS-PemaRG | pGFPuv/emaS; emaR; PemaR-gfpuv; Apr | This study |
6 | TCS-P571G | pGFPuv/emaS; emaR; P571-gfpuv; Apr | This study |
7 | TCS-P2796G | pGFPuv/emaS; emaR; P2796-gfpuv; Apr | This study |
8 | TCS-P3218G | pGFPuv/emaS; emaR; P3218-gfpuv; Apr | This study |
9 | TCS-P3568G | pGFPuv/emaS; emaR; P3568-gfpuv; Apr | This study |
10 | pWH1266 | E. coli–A. baumannii shuttle vector; Apr; Tetr | [19] |
11 | pWH1266G | pWH1266G/gfpuv; Tetr | This study |
12 | pWH1266-PemaSG | pWH1266G/PemaS-gfpuv; Tetr | This study |
13 | pWH1266-PemaRG | pWH1266G/PemaR-gfpuv; Tetr | This study |
14 | pWH1266-P571G | pWH1266G/P571-gfpuv; Tetr | This study |
15 | pWH1266-P2796G | pWH1266G/P2796-gfpuv; Tetr | This study |
16 | pWH1266-P3218G | pWH1266G/P3218-gfpuv; Tetr | This study |
17 | pWH1266-P3568G | pWH1266G/P3568-gfpuv; Tetr | This study |
No. | Sequences (5′-3′) | References or Source | |
---|---|---|---|
1 | pQE80LK-DJ41_2796-eF | AAGGATCCATGTCTTTAAGTCGTATT | This study |
2 | pQE80LK-DJ41_2796-eR | AACTGCAGTTAAGCTGATTTTGCAAC | This study |
3 | TCSG-PemaS-gF | GGCTGCAGTAACCAAACTCCTTACATAG | This study |
4 | TCSG-PemaR-gF | GGCTGCAGCCCGAATAGTTGATTTTTAT | This study |
5 | TCSG-P571-gF | GGCTGCAGTTTGTTTTACAAGTATATGA | This study |
6 | TCSG-P2796-gF | GGCTGCAGGCGCTATTTTAAACCTCAAA | This study |
7 | TCSG-P3218-gF | GGCTGCAGGTCAGATATAGAGTTGAGAA | This study |
8 | TCSG-P3568-gF | GGCTGCAGTCCCGATGCAGTGATTTTAC | This study |
9 | pWH-Pgfp-F | ACGTTGTTGCCATTGCTGCAAAAAATCTAATGCATGCCTGC | This study |
10 | TCSG-PemaS-gR | CCTCTAGAATGACCTACATAAGTGAAAC | This study |
11 | TCSG-PemaR-gR | CCTCTAGAAAGCGATTAAAGTAATCTTG | This study |
12 | TCSG-P571-gR | CCTCTAGAATCCTTTTCCTTTATTATCT | This study |
13 | TCSG-P2796-gR | CCTCTAGATGGACATCCTCAATATTGTC | This study |
14 | TCSG-P3218-gR | CCTCTAGATGCCTATCTCATTTTCCAGC | This study |
15 | TCSG-P3568-gR | CCTCTAGATCAATAGATCTCCTGTCCTG | This study |
16 | pWH-Pgfp-reR | GATAAGCTGTCAAACATGAGCATTATTTGTAGAGCTCATCCA | This study |
17 | GFP-34R | TTCACCCTCTCCACTGACAGA | This study |
18 | TcR | GATGCGTCCGGCGTAGAG | This study |
19 | P-Ab-ITSB | AGAGCACTGTGCACTTAAG | [21] |
20 | P-Ab-ITSF | CATTATCACGGTAATTAGTG | [21] |
Name | Ratio | Strand | Position * | Sequence (5′-3′) † |
---|---|---|---|---|
DJ41_566-571 | 2.85~6.42 | + | −109 to −130 | AAACTTATTTAAAACTTTTTAG |
DJ41_3218 | 1.14 | + | −64 to −85 | AGTCTTAAGCTTACGCATACAA |
DJ41_3568 | 1.66 | + | −74 to −95 | AATCTTATAGCAAATTTTGACA |
DJ41_2796 | 6.21 | - | −105 to −126 | TAAAAATCATAAAAATAAGTTA |
emaR | 2.94 | - | −14 to −35 | GGCCATACTTATGCTCAAGATT |
emaS | 2.30 | - | −18 to −39 | GGGTTATGATAGGCATAAGGTT |
Potassium Phosphate Buffer, pH = 8.0 | |||
---|---|---|---|
Potassium Acetate * | Sodium Acetate * | Succinyl-CoA * | |
Vmax (nmole·min−1) | 41.55 | 33.51 | 34.97 |
KM (mM) | 39 | 14.74 | 0.3418 |
kcat (s−1) | 8.31 | 6.702 | 6.994 |
kcat/KM (mM−1s−1) | 0.2131 | 0.4547 | 20.4623 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, Y.-W.; Shu, H.-Y.; Lin, G.-H. Gene Expression of Ethanol and Acetate Metabolic Pathways in the Acinetobacter baumannii EmaSR Regulon. Microorganisms 2024, 12, 331. https://doi.org/10.3390/microorganisms12020331
Huang Y-W, Shu H-Y, Lin G-H. Gene Expression of Ethanol and Acetate Metabolic Pathways in the Acinetobacter baumannii EmaSR Regulon. Microorganisms. 2024; 12(2):331. https://doi.org/10.3390/microorganisms12020331
Chicago/Turabian StyleHuang, Yu-Weng, Hung-Yu Shu, and Guang-Huey Lin. 2024. "Gene Expression of Ethanol and Acetate Metabolic Pathways in the Acinetobacter baumannii EmaSR Regulon" Microorganisms 12, no. 2: 331. https://doi.org/10.3390/microorganisms12020331