Next Article in Journal
Relationships between Wheat Development, Soil Properties, and Rhizosphere Mycobiota
Previous Article in Journal
The Effects of Nicotine Pouches and E-Cigarettes on Oral Microbes: A Pilot Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 12
Issue 8
10.3390/microorganisms12081515
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Counteracting Grey Mould (Botrytis cinerea) in Grapevine ‘Glera’ Using Three Putative Biological Control Agent Strains (Paraburkholderia sp., Pseudomonas sp., and Acinetobacter sp.): Impact on Symptoms, Yield, and Gene Expression

by
Giovanni Mian
1,
Nicola Belfiore
2,
Patrick Marcuzzo
2,
Francesco Spinelli
1,
Diego Tomasi
3 and
Andrea Colautti
4,*
1
Department of Agricultural and Food Sciences, Alma Mater Studiorum Università di Bologna, 40129 Bologna, Italy
2
Council for Agricultural and Economics-Research-Centre for Viticulture and Oenology, Viale Aprile, 26, 31015 Conegliano, Italy
3
Consorzio Tutela del Vino Conegliano Valdobbiadene Prosecco, Piazza Libertà, 7, 31053 Pieve di Soligo, Italy
4
Department of Agricultural, Food, Environmental and Animal Science (Di4A), University of Udine, 33100 Udine, Italy
*
Author to whom correspondence should be addressed.
Microorganisms 2024, 12(8), 1515; https://doi.org/10.3390/microorganisms12081515
Submission received: 23 May 2024 / Revised: 17 July 2024 / Accepted: 22 July 2024 / Published: 24 July 2024
(This article belongs to the Section Plant Microbe Interactions)
Browse Figures
Versions Notes

Abstract

:
This study examined the potential use of three bacterial strains—Paraburkholderia sp. strain CRV74, Pseudomonas sp. strain CRV21, and Acinetobacter sp. strain CRV19—as biocontrol agents of Botrytis cinerea in grapevine. These strains were selected for their ability to inhibit B. cinerea growth in vitro and used in field conditions for the control of grey mould symptoms in ‘Glera’ grapes. To this end, after inoculating these microorganisms onto plants sprayed with B. cinerea spores, the final yield, the physicochemical characteristics of the must, disease incidence, and the possible influence on the expression of plant-defence proteins were evaluated. Strain CRV21 resulted as being the most effective in combating grey mould (−20% of disease incidence). Although yield was not affected, significantly different values of total soluble solids content was observed. Additionally, a significant up-regulation of the genes PR-1, PR-5, β-1,3-glucanase, and class III chitinase was observed. These findings highlight the potential application of strains with anti-botrytis activity as sustainable alternatives to chemical defence for the control of this pathogen.

1. Introduction

In the contemporary agricultural landscape, sustainable crop management plays an increasingly critical role. Modern agriculture faces the challenge of ensuring high yields and quality while adapting to a rapidly evolving environmental scenario [1]. In response to this challenge, the adoption of alternative biocontrol strategies has emerged as a promising approach to protecting crops from pathogens and diseases, simultaneously reducing the use of harmful synthetic pesticides, risks of residues, and mitigating environmental impacts [2,3]. Grapevine cultivation spans approximately 7.6 million hectares worldwide, with Italy leading the forefront as the highest-output and largest wine producer [4]. This prominence underscores the importance of effective crop protection strategies, particularly against prevalent threats such as grey mould, caused by the fungus Botrytis cinerea. Grey mould poses a significant challenge in grapevine cultivation, leading to heavy reliance on plant defence agrochemicals to mitigate economic losses. However, this reliance presents substantial obstacles to achieving eco-sustainability objectives driven by the growing environmental awareness of producers and consumers. B. cinerea also compromises the quality of grapes and wine derived from infected vines, resulting in notable economic losses within the wine production sector [5]. Furthermore, as the effects of climate change increase, the challenges posed by B. cinerea on grapevines become more severe. Rising temperatures and heightened humidity levels, common in regions affected by climate change, create ideal conditions for the growth and spread of this pathogen [6]. Warmer temperatures speed up the life cycle of B. cinerea, leading to its rapid proliferation throughout vineyards. Additionally, increased humidity provides the necessary moisture for spore germination and infection, exacerbating the threat of this fungal disease [7,8]. Consequently, grape growers are confronted with heightened difficulties in managing and mitigating the impact of grey mould.
Traditionally, agrochemicals are predominantly used to control this pathogen, but are costly and less effective against a wide range of plant diseases. Additionally, failure to apply chemical protection during grey mould-favourable weather conditions can lead to substantial yield reduction and can compromise the aromatic profile of the wine [9,10]. Moreover, chemical control methods not only fall short of offering sustainable solutions in agriculture, but also carry the risk of exacerbating ecological issues such as the diffusion of pesticide resistance, for example, to benzimidazole-based fungicides [11]. Hence, there is a pressing need to explore alternative methods for reducing losses and boosting grapevine productivity through the adoption of biological control strategies, which hold considerable promise in this regard [12]. The limitations of conventional chemical treatments in agriculture are increasingly evident, particularly in terms of their environmental impact, diminishing efficacy due to pathogen resistance, and the growing governmental push for more sustainable viticulture practices. Consequently, deepening our knowledge on biological control agents (BCAs) offers a promising outlook for sustainable agriculture as their use represents an effective and environmentally friendly alternative for managing fungal diseases in agricultural settings.
In light of these concerns, there is growing interest in natural products, including BCAs, such as yeasts, fungi, and bacteria, to promote sustainability throughout the wine supply chain. Numerous studies have demonstrated the ability of various microorganisms with BCA activity to suppress crop diseases. Furthermore, BCAs offer advantages over synthetic fungicides, including having minimal impact on consumer health and the environment, making them integral to anti-resistance strategies [13]. In this sense, the research on new BCAs aligns with the guidelines of the EU and its member states, which advocate for reducing chemical inputs in agriculture through the use of greener technologies. In this context, the use of these bacteria is well suited, especially as grapevine pathogens become increasingly resistant to active substances over time, complicating control efforts.
However, despite their potential, it is crucial to acknowledge that the efficacy of BCAs against B. cinerea may vary. Thus, targeted screening efforts are essential to identify microbial strains with superior antagonistic capabilities. The selection and development of more effective biocontrol agents tailored to the specific environmental and agronomic conditions of Vitis vinifera cultivation can improve the overall efficacy of biological control strategies [14]. In this sense, certain Burkholderia spp. are BCA bacteria reported to produce positive effects in horticultural crops, including grapes, able to stimulate the growth of inoculated plants, and enhance plant adaptation to environmental stresses [15,16,17,18]. Another promising BCA bacteria species are Pseudomonas spp., which, for the non-pathogenic species [19], have already shown the ability to control B. cinerea on in vitro grapevine grown-plantlets [20], reducing also grey mould incidence by triggering defence-related genes in Chardonnay vineyards [21]. Additionally, there have been reports of Pseudomonas fluorescens strains diminishing disease in plant tissues by triggering a defence mechanism (induced systemic resistance—ISR), thereby bolstering grapevine resilience against subsequent infections from B. cinerea [22,23]. Acinetobacter lwoffii was reported as being capable of triggering resistance against B. cinerea, via induced systemic resistance mechanisms and up-regulation of key defence proteins [24,25,26].
In this context, this study evaluated the effectiveness of three putative BCA bacterial strains, previously selected for their in vitro efficacy against B. cinerea conidia germination and antifungal activity as potential BCAs in mitigating the effects of grey mould on grapes. Notably, this is the first time they have been tested on the ‘Glera’ cultivar. This case study, part of broader research that will serve as a basis for future experiments under various conditions (cultivars, environments, etc.), represents a preliminary investigation into the survival of these microorganisms in the carposphere. The study assesses their effectiveness in improving plant yield and must parameters, as well as their ability to reduce the incidence of B. cinerea at harvest. To investigate the local and systemic response of grapevine to grey mould colonization, the expression pattern of four defence-related genes selected from three different functional groups (Pathogenesis-related protein -PR-, glucanase, and chitinase) was analysed by RT qPCR.

2. Materials and Methods

2.1. Microorganisms

The BCA microorganisms tested in this study (Paraburkholderia sp. strain CRV74, Pseudomonas sp. strain CRV21, and Acinetobacter sp. strain CRV19) were isolated from Glera grapes during previous studies [27]. In brief, these strains were selected from among 80 isolates as their supernatants exhibited superior activity against B. cinerea strain DSM 5145 (obtained from the Leibniz Institute DSMZ—Deutsche Sammlung von Mikroorganismen und Zellkulturen Collection, Germany). In particular, these strains were selected for their in vitro efficacy against conidia germination and antifungal activity, which was assessed following protocols reported in the literature [28,29]. Strains were cryopreserved at −80 °C in Nutrient Broth (Merck, Darmstadt, Germany) supplemented with 50% v/v glycerol (Merck, Germany) until the moment of use. For the different analyses, strains were revived in Nutrient Broth at 30 °C for 48 h and then streaked twice on Nutrient Agar (Merck, Germany) at 30 °C for 48 h to ensure purity. To perform a preliminary identification, their DNA was extracted using the MagAttract HMW DNA kit (Qiagen, Germany), then sequencing of the amplicons of the V1-V3 region of the 16S rRNA gene, obtained via the primer pair P1 (5′-GCGGCGTGCCTAATACATGC-3′) and P4 (5′-ATCTACGCATTTCACCGCTAC-3′) [30] occurred. Using the BLASTn suite (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&BLAST_SPEC=&LINK_LOC=blasttab&LAST_PAGE=tblastn, accessed on 3 June 2024), the most related sequence in the NCBI nucleotide sequence database was then determined [31]; a further phylogenetic analysis aligning the sequences with the reference genomes reported on NCBI for the most related species within the genus identified using TYGS [32] (Table 1) was performed, constructing then the phylogenetic tree using MAFFT [33] and FastTree [34], which was lastly plotted using FigTree. To test their efficacy against B. cinerea, pure colonies of each strain were inoculated in Nutrient Broth kept in agitation at 30 °C for 24 h. Bacterial cultures were then collected by centrifuging the growth media at 4500× g at 4 °C for 15 min. Pelleted cells were resuspended in sterile saline-peptone water (9 g/L NaCl, 1 g/L bacteriological peptone) to prepare standardized suspensions with an OD600 = 0.1 (corresponding to 107 CFU/mL). Then, 50 mL of these suspensions were sprayed on the grapes of each treated plant, to achieve a potential treatment spraying of 200 hL/ha. The persistence of inoculated strains was assessed during the evaluation of grey mould symptoms on grapes through species-specific PCR. To this end, 50 g of randomly collected grape berries were homogenized. From these, a 2 mL sample aliquot was taken for DNA extraction using the DNeasy PowerFood Microbial Kit (Qiagen, Hilden, Germany). Amplification was carried out using species-specific primers and protocols reported in the literature for Burkholderia spp. [35], Pseudomonas spp. [36], and Acinetobacter spp. [37], with amplifications performed using the MiniAmp Thermal Cycler (Thermofisher, Waltham, MA, USA). The inoculum of B. cinerea was obtained by culturing the mould on Potato Dextrose Agar (PDA) (Merck, Germany) at 20 °C for 20 days. The surface of the plates was then scraped to collect spores that were resuspended in in Potato Dextrose Broth (PDB) (Merck, Germany). Conidial concentrations were assessed using a Bürker counting chamber (Merck, Darmstadt, Germany), and the final density was adjusted to 105 conidia/mL. After 3 h of incubation at 20 °C and 150 rpm, 50 mL of PDB containing germinated spores were sprayed on each plant for inoculation.

2.2. Experimental Set Up

The trial was conducted during the 2023 growing season in a greenhouse scale using 4-years-old Vitis vinifera ‘Glera’ vines grafted onto 1103 P rootstock. The treatments were NT: not-treated control plants, BP: Paraburkholderia sp. strain CRV74 treated plants, PF: Pseudomonas sp. strain CRV21 treated plants, AL: Acinetobacter sp. strain CRV19 treated plants (five replicates each).
The artificial inoculation of grey mould (Botrytis cinerea) was performed at BBCH 69-71 (Biologische Bundesanstalt, Bundessortenamt and CHemical industry–phenological stages), replicating what naturally occurs in open field conditions. The BCAs were inoculated twice, at BBCH 75-77 and at BBCH 83-85 (Figure 1). Plants followed the same micro irrigation protocol, not fertilized, and plant agrochemicals (copper and sulphur), were applied in the same quantity across the treatments only to avoid possible infections of downy (Plasmopara viticola) and powdery (Erysiphe necator) mildews.

2.3. Evaluation of Grey Mould Symptoms on Grapes, and Yield

The effectiveness in controlling grey mould symptoms was evaluated visually by inspecting the grapes for B. cinereal symptoms, comparing treated and control grapes. Disease incidence was recorded as the percentage (%) of the infected grapes per each plant. The symptoms included greyish fuzzy mould growth on the surface of the berries, the presence of soft, rotting areas as well as discoloration and shrivelling of berries [38].
Furthermore, the total commercial yield of the plants was assessed. Grapes were hand-picked on the same day and weighed using a digital dynamometer (Sinergica soluzioni S.r.l., Milan, Italy) [39]. Total soluble solids content (TSS), expressed as °Brix, was measured with an automatic refractometer (Atago PR32, Tokyo, Japan). Total acidity of berries expressed both as pH and titratable acidity (i.e., g/L of tartaric acid) were measured using an automatic titrator (Crison Micro TT 2022, Alella, Spain) by titration with 0.1 N NaOH solution [40].

2.4. Gene Expression Analysis by Quantitative Real-Time PCR (qRT-PCR)

Grapevine berry peel samples were collected when the Botrytis-symptoms reached at least 50% in untreated vines. Twenty-five infected berries per replicate were collected from treated and untreated grapevines, and immediately frozen in liquid N2 and stored at −80 °C until RNA extraction. Total RNA extraction was performed using the Spectrum Plant total RNA kit (Merck, Germany), followed by quantification using NanoDrop 8000 (Thermo Fisher, USA) [41]. After treating the RNA with DNAse I (Invitrogen, Waltham, MA, USA), the first-strand cDNA synthesis was carried out using Superscript III (Invitrogen, USA) and oligo-dT primer from 1.0 μg of total RNA. Quantitative real-time PCR was carried out using Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, USA) and specific primer pairs (as detailed in Table 2) on the LightCycler 480 Instrument II, utilizing its SV1.5.0 software (Roche Diagnostics, Mannheim, Germany). PCR conditions included an initial step of 50 °C for 2 min and 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min [42]. Each sample underwent analysis in five technical replicates, and dissociation curves were examined to confirm amplification specificity. Relative gene expression was determined using the Pfaffl equation [43], with berries from control plants serving as calibrators. Actin was chosen as the constitutive gene for normalization due to its unaffected expression by treatments, with comparable results observed using actin primer pairs. The impact of each bacterial strain on grapevine defence response against B. cinerea infection was calculated as the ratio between expression levels in symptomatic berries of treated vs. untreated plants, with a 1.5-fold threshold used to identify enhanced expression. Mean expression and standard error values were calculated based on five replicates per sample.

2.5. Statistical Analyses

Statistical analysis on the collected data was performed using R version 4.1.2. Significant differences between treatment means were assessed using one-way ANOVA test (p ≤ 0.05), and performing Tukey HSD test (p ≤ 0.05) as a post-hoc test. The validation of the linear model hypotheses was conducted through the assessment of the normal distribution of values and residuals. The normal distribution was evaluated using the Shapiro–Wilk test. For all treatments, the calculated p-value exceeded the critical p-value (0.05); thus, the null hypothesis (H0) was always accepted. The normality of the residual’s distribution was assessed using the Kolmogorov–Smirnov test. For all treatments, the tabulated D value (0.265) was greater than the calculated D value; hence, the null hypothesis (H0) was consistently accepted.

3. Results

3.1. Strains

After sequencing of the V1–V4 region of the 16S rRNA gene, the most related sequence in the NCBI nucleotide sequence database was determined using the BLASTn suite for each strain (Table 3). For strain CRV19, the most related species resulted in Acinetobacter lwoffi; for strain CRV21, it resulted in Pseudomonas fluorescens; and for strain CRV74, it resulted in Paraburkholderia phytofirmans. However, after the phylogenetic analysis, it was not possible to obtain a unique identification of the strains. Indeed, for strain CRV19, the identification resulted in ambiguity between A. lwoffi and Acinetobacter idrijanensis due to identical 16S rRNA gene sequences (Figure 2A). It is worth noting that A. idrijanensis does not have a valid published name and may be a misdeposited reference strain. Similarly, for strain CRV74, the identification resulted in ambiguity between P. phytofirmans, Paraburkholderia aromaticivorans, and Paraburkholderia dipogonis due to identical sequences among these reference strains (Figure 2B). Lastly, strain CRV21 was misidentifiable between P. fluorescens and Pseudomonas salomonii, which also present identical sequences (Figure 2C). It should be emphasized that no matches with potential pathogenic species were found.

3.2. Harvest Yield and Must Parameters

In comparison to the control group (NT), which yielded 3.8 ± 0.2 kg, no significant differences were observed in the overall production yield for plants treated with BP (3.7 ± 0.4 kg), PF (3.8 ± 0.2 kg), or AL (3.7 ± 0.4 kg) (Figure 3A). However, significant impact on TSS was noted. In fact, PF application resulted in a significant decrease of TSS (20.5 ± 1.8 °Brix) in comparison to the control (NT: 23.8 ± 1.3 °Brix) and the other strains (AL: 23.1 ± 0.8 °Brix; BP: 22.4 ± 1.0 °Brix) (Figure 3B). Regarding acidity, the highest levels were observed in the PF treatment (4.0 ± 0.3 pH; 6.0 ± 0.58 g/L) compared to the NT control where lower acidity was observed (4.3 ± 0.3 pH; 5.12 ± 0.6 g/L), with intermediate values for BP (4.2 ± 0.4 pH; 5.7 ± 0.6 g/L) and AL (4.1 ± 0.3 pH; 5.3 ± 0.7 g/L); however, differences were not statistically significant (Figure 3C,D).

3.3. Symptoms Evaluation

After analysing the treatment-induced variances (Figure 4), significant variations (p < 0.05) in B. cinerea symptoms were observed. Specifically, compared to untreated control plants (NT) where the incidence of grey mould stood at 70.0 ± 7.9%, similar outcomes were observed for BP (66.0 ± 6.5%) and AL (64.0 ± 7.4%). In contrast, a significant reduction in symptoms was observed in grapes treated with PF (53.0 ± 7.6%) (Figure 5).

3.4. Modulation of Defence-Related Genes

Considering the modulation effects on defence-related genes PR-1, PR-5, β-1,3-glucanase, and class III chitinase, an upregulation effect induced by BCAs was consistently identified in each treatment (Figure 6). However, only PF exhibited statistically significative upregulation of all defence genes compared to the NT control. This indicates that PF effectively stimulated the upregulation of these genes, bolstering the plant’s defence mechanisms against grey mould infection. BP and AL also resulted in increased expression levels of defence genes compared to the untreated group, albeit with effects inferior to those of PF. Specifically, for these microorganisms, the only significant difference observed compared to the NT control was noted in the upregulation of the β-1,3-glucanase gene following treatment with AL.

4. Discussion

Botrytis cinerea is the causative agent of grey mould in over 500 dicot plants, including economically important crops like grapevines, by attacking various tissues such as stems, leaves, and fruits [45]. Estimating the economic impact of B. cinerea is difficult due to its wide host range, but annual losses are estimated between USD 10 billion and USD 100 billion globally [46]. Controlling this pathogen necessitates exploring alternatives to synthetic agrochemicals to minimize environmental harm [47,48]. Biological control agents (BCAs) like Paraburkholderia spp., Pseudomonas spp., and Acinetobacter spp. have shown effectiveness against grey mould. This study aims to evaluate the biocontrol efficacy of three strains of these BCAs on the grapevine variety ‘Glera’, which is important in the Italian grapevine industry.
As a first step of this study, a preliminary identification of the three selected bacterial strains was performed. At this stage of the research, the identification was performed by sequencing the V1–V4 region of the 16S rRNA gene due to its relatively low cost, ease of use, and the extensive database of 16S rRNA sequences available for comparison. However, in this case, 16S rRNA sequencing was not sufficient to obtain a unique identification of our strains due to the high similarity of our sequences to several reference strains in the BLAST database. For this reason, in future research, analyses based on whole genome sequencing will be conducted, not only to achieve a taxonomic identification but also to gain a deeper understanding of the resistance mechanisms induced, thanks to the possibility of conducting an in-depth genetic characterization of the strains.
The incidence of grey mould symptoms, yield, and the expression levels of key genes encoding proteins or enzymes involved in various defence-related metabolic pathways were then evaluated in BCA-treated grapes in comparison to non-treated controls. When assessing overall grapevine yield, no statistically significant differences were found among the treatments. However, a significant difference was noted in the °Brix values, especially within the NT untreated control group (where grapes also showed more pronounced botrytization) compared to the PF treatment. This phenomenon can be attributed to grape rot in various ways. B. cinerea infiltrates grape skins, triggering dehydration and leading to increased sugar concentration within the fruit. Simultaneously, the grapevine responds to infection by enhancing photosynthesis rates, thereby increasing sugar production [49,50]. Furthermore, lower TSS and higher acidity are also characteristic of unripe berries. The vulnerability of grape clusters to Botrytis rot steadily rises from the veraison stage to ripening. [51]. Since B. cinerea produces ethylene during the infection process, which is a hormone that promotes the ripening of berries, the higher TSS and lower acidity in non-treated grapes may be related to a more advanced ripening stage, induced by the higher incidence of grey mould of infected berries and the consequent exposure to ethylene produced by the pathogen. In this context, PF musts reached optimal technological levels of sugars and acidity, both crucial parameters for wine quality, especially considering the perspective of climate change, where rising temperatures significantly impact them [52,53,54]; these results were further confirmed by other works reported in the literature [55]. Furthermore, in comparison to control plants, the application of Pseudomonas sp. strain CRV21 was associated with a significant reduction in symptoms linked to B. cinerea; while considering BP and AL trials, although symptoms were reduced, these were not significant. Similar results with grey mould symptom reduction from 43% to 20% resulting from the application of P. fluorescens have been reported in the literature by other authors [23].
PF treatment efficacy was therefore reflected also in the modulation of plant defence gene expression (PR-1, PR-5, β-1,3-glucanase, and class III chitinase), which showed significant upregulation, which was also reported in other studies [22,24]. The ability of BCA microbes like Pseudomonas spp. (e.g., P. fluorescens) to induce the up-regulation of these genes, which play distinct roles in fortifying the plant’s defences [56,57], is crucial for enhancing plant health and resilience [58]. PR-1 and PR-5 are proteins involved in systemic acquired resistance (SAR), an advanced defence mechanism that primes the entire plant against invading pathogens. By triggering the synthesis of these pathogenesis-related proteins, P. fluorescens could function as an effective priming of the immune response, impeding pathogen proliferation, and safeguarding the plant from systemic infections [59]. Similarly, the upregulation of β-1,3-glucanase enhances the plant’s ability to dismantle fungal cell walls, a crucial defence system against fungal intrusion. The stimulation of enzymatic activity through the use of BCA bacteria can thus act as a frontline defence, impeding fungal colonization, and averting potential damage to the plant [60]. Similarly, class III chitinases provide another layer of defence against pathogens. Chitinase enzymes break down chitin, a structural component of fungal cell walls and insect exoskeletons. The ability to stimulate their production by Pseudomonas spp. can thus provide the plant with tools to degrade chitin, thereby thwarting fungal growth and infestation [22,61]. Overall, the coordinated upregulation of these defence proteins primes the plant’s immune system, enhancing its resilience against diverse pathogens. This priming effect not only enables a swift and robust response to immediate threats but also establishes a lasting defence readiness, ensuring the plant’s long-term health and productivity, in contrast to phytochemical treatments whose efficacy diminishes over time [62]. Thus, the symbiotic interaction between plants and beneficial microbial strains like Pseudomonas sp. strain CRV21 tested in this work exemplifies nature’s ingenious strategies for bolstering plant defence mechanisms.
In conclusion, the obtained data suggested the importance of selection of strains with BCA functions, that hold promise as an alternative strategy in combating B. cinerea on grapevines. In particular, Pseudomonas sp. strain CRV21 showed a significant ability to upregulate key defence proteins, and showed potential applications for fighting this fungal pathogen, reducing environmental impact, and offering prolonged efficacy compared to conventional treatments, as evidenced by symptom evaluation. These findings offer promising avenues for sustainable disease management in agriculture.

Author Contributions

Conceptualization, G.M. and A.C.; methodology, G.M. and A.C.; software, N.B. and A.C.; validation, G.M., N.B., P.M., F.S., and D.T.; formal analysis, G.M. and A.C.; investigation, G.M. and A.C.; resources, G.M. and A.C.; data curation, A.C. and N.B.; writing—original draft preparation, G.M. and A.C.; writing—review and editing, G.M., F.S., A.C., D.T., N.B., and P.M.; visualization, A.C.; supervision, G.M. and A.C.; project administration, G.M. and A.C.; funding acquisition, G.M. and A.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Giovanni Mian, Agronomist Freelancer, issued by CONAF FVG, n. 412.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Colautti, A.; Mian, G.; Tomasi, D.; Bell, L.; Marcuzzo, P. Exploring the Influence of Soil Salinity on Microbiota Dynamics in Vitis vinifera cv. “Glera”: Insights into the Rhizosphere, Carposphere, and Yield Outcomes. Diversity 2024, 16, 247. [Google Scholar] [CrossRef]
  2. Colautti, A.; Civilini, M.; Contin, M.; Celotti, E.; Iacumin, L. Organic vs. Conventional: Impact of Cultivation Treatments on the Soil Microbiota in the Vineyard. Front. Microbiol. 2023, 14, 1242267. [Google Scholar] [CrossRef] [PubMed]
  3. Mian, G.; Musetti, R.; Belfiore, N.; Boscaro, D.; Lovat, L.; Tomasi, D. Chitosan Application Reduces Downy Mildew Severity on Grapevine Leaves by Positively Affecting Gene Expression Pattern. Physiol. Mol. Plant Pathol. 2023, 125, 102025. [Google Scholar] [CrossRef]
  4. Mian, G.; Nassivera, F.; Sillani, S.; Iseppi, L. Grapevine Resistant Cultivars: A Story Review and the Importance on the Related Wine Consumption Inclination. Sustainability 2023, 15, 390. [Google Scholar] [CrossRef]
  5. Belfiore, N.; Lovat, L.; Zanchin, A.; Mian, G.; Gaiotti, F.; Franceschi, D.; Marcuzzo, P.; Tomasi, D. Agronomic Evaluation and Adaptability of Pinot Gris to an Environment with High Grey Mould Disease Pressure: A Comparative Analysis on 17 Clones. OENO One 2024, 58. [Google Scholar] [CrossRef]
  6. Ciliberti, N.; Fermaud, M.; Roudet, J.; Rossi, V. Environmental Conditions Affect Botrytis cinerea Infection of Mature Grape Berries More than the Strain or Transposon Genotype. Phytopathology 2015, 105, 1090–1096. [Google Scholar] [CrossRef] [PubMed]
  7. Schumacher, J. How Light Affects the Life of Botrytis. Fungal Genet. Biol. 2017, 106, 26–41. [Google Scholar] [CrossRef]
  8. Negri, S.; Lovato, A.; Boscaini, F.; Salvetti, E.; Torriani, S.; Commisso, M.; Danzi, R.; Ugliano, M.; Polverari, A.; Tornielli, G.B.; et al. The Induction of Noble Rot (Botrytis cinerea) Infection during Postharvest Withering Changes the Metabolome of Grapevine Berries (Vitis vinifera L., cv. Garganega). Front. Plant Sci. 2017, 8, 1–12. [Google Scholar] [CrossRef]
  9. Altieri, V.; Rossi, V.; Fedele, G. Biocontrol of Botrytis cinerea as Influenced by Grapevine Growth Stages and Environmental Conditions. Plants 2023, 12, 3430. [Google Scholar] [CrossRef]
  10. Santos, H.; Augusto, C.; Reis, P.; Rego, C.; Figueiredo, A.C.; Fortes, A.M. Volatile Metabolism of Wine Grape Trincadeira: Impact of Infection with Botrytis cinerea. Plants 2022, 11, 141. [Google Scholar] [CrossRef]
  11. Leroux, P.; Fritz, R.; Debieu, D.; Albertini, C.; Lanen, C.; Bach, J.; Gredt, M.; Chapeland, F. Mechanisms of Resistance to Fungicides in Field Strains of Botrytis cinerea. Pest Manag. Sci. 2002, 58, 876–888. [Google Scholar] [CrossRef] [PubMed]
  12. Fedorina, J.; Tikhonova, N.; Ukhatova, Y.; Ivanov, R.; Khlestkina, E. Grapevine Gene Systems for Resistance to Gray Mold Botrytis cinerea and Powdery Mildew Erysiphe necator. Agronomy 2022, 12, 499. [Google Scholar] [CrossRef]
  13. Fedele, G.; Brischetto, C.; González-Domínguez, E.; Rossi, V. The Colonization of Grape Bunch Trash by Microorganisms for the Biocontrol of Botrytis cinerea as Influenced by Temperature and Humidity. Agronomy 2020, 10, 1829. [Google Scholar] [CrossRef]
  14. Fedele, G.; González-Domínguez, E.; Delière, L.; Díez-Navajas, A.M.; Rossi, V. Consideration of Latent Infections Improves the Prediction of Botrytis Bunch Rot Severity in Vineyards. Plant Dis. 2020, 104, 1291–1297. [Google Scholar] [CrossRef] [PubMed]
  15. Ait Barka, E.; Nowak, J.; Clément, C. Enhancement of Chilling Resistance of Inoculated Grapevine Plantlets with a Plant Growth-Promoting Rhizobacterium, Burkholderia phytofirmans Strain PsJN. Appl. Environ. Microbiol. 2006, 72, 7246–7252. [Google Scholar] [CrossRef] [PubMed]
  16. Compant, S.; Reiter, B.; Sessitsch, A.; Nowak, J.; Clément, C.; Barka, E.A. Endophytic Colonization of Vitis vinifera L. by Plant Growth-Promoting Bacterium Burkholderia sp. Strain PsJN. Appl. Environ. Microbiol. 2005, 71, 1685–1693. [Google Scholar] [CrossRef] [PubMed]
  17. Fernandez, O.; Theocharis, A.; Bordiec, S.; Feil, R.; Jacquens, L.; Clément, C.; Fontaine, F.; Barka, E.A. Burkholderia Phytofirmans PsJN Acclimates Grapevine to Cold by Modulating Carbohydrate Metabolism. Mol. Plant-Microbe Interact. 2012, 25, 496–504. [Google Scholar] [CrossRef] [PubMed]
  18. Miotto-Vilanova, L.; Jacquard, C.; Courteaux, B.; Wortham, L.; Michel, J.; Clément, C.; Barka, E.A.; Sanchez, L. Burkholderia phytofirmans PsJN Confers Grapevine Resistance against Botrytis cinerea via a Direct Antimicrobial Effect Combined with a Better Resource Mobilization. Front. Plant Sci. 2016, 7, 1–15. [Google Scholar] [CrossRef]
  19. Höfte, M.; De Vos, P. Plant Pathogenic Pseudomonas Species. In Plant-Associated Bacteria; Springer: Dordrecht, The Netherlands, 2007; pp. 507–533. [Google Scholar]
  20. Ait Barka, E.; Gognies, S.; Nowak, J.; Audran, J.C.; Belarbi, A. Inhibitory Effect of Endophyte Bacteria on Botrytis cinerea and Its Influence to Promote the Grapevine Growth. Biol. Control 2002, 24, 135–142. [Google Scholar] [CrossRef]
  21. Magnin-Robert, M.; Trotel-Aziz, P.; Quantinet, D.; Biagianti, S.; Aziz, A. Biological Control of Botrytis cinerea by Selected Grapevine-Associated Bacteria and Stimulation of Chitinase and β-1,3 Glucanase Activities under Field Conditions. Eur. J. Plant Pathol. 2007, 118, 43–57. [Google Scholar] [CrossRef]
  22. Gruau, C.; Trotel-Aziz, P.; Villaume, S.; Rabenoelina, F.; Clement, C.; Baillieul, F.; Aziz, A. Pseudomonas Fluorescens PTA-CT2 Triggers Local and Systemic Immune Response against Botrytis cinerea in Grapevine. Mol. Plant-Microbe Interact. 2015, 28, 1117–1129. [Google Scholar] [CrossRef] [PubMed]
  23. Verhagen, B.W.M.; Trotel-Aziz, P.; Couderchet, M.; Höfte, M.; Aziz, A. Pseudomonas Spp.-Induced Systemic Resistance to Botrytis cinerea Is Associated with Induction and Priming of Defence Responses in Grapevine. J. Exp. Bot. 2010, 61, 249–260. [Google Scholar] [CrossRef] [PubMed]
  24. Magnin-Robert, M.; Quantinet, D.; Couderchet, M.; Aziz, A.; Trotel-Aziz, P. Differential Induction of Grapevine Resistance and Defense Reactions against Botrytis cinerea by Bacterial Mixtures in Vineyards. BioControl 2013, 58, 117–131. [Google Scholar] [CrossRef]
  25. Verhagen, B.; Trotel-Aziz, P.; Jeandet, P.; Baillieul, F.; Aziz, A. Improved Resistance against Botrytis cinerea by Grapevine-Associated Bacteria That Induce a Prime Oxidative Burst and Phytoalexin Production. Phytopathology 2011, 101, 768–777. [Google Scholar] [CrossRef] [PubMed]
  26. Trotel-Aziz, P.; Couderchet, M.; Biagianti, S.; Aziz, A. Characterization of New Bacterial Biocontrol Agents Acinetobacter, Bacillus, Pantoea and Pseudomonas sp. Mediating Grapevine Resistance against Botrytis cinerea. Environ. Exp. Bot. 2008, 64, 21–32. [Google Scholar] [CrossRef]
  27. Colautti, A.; Golinelli, F.; Iacumin, L.; Tomasi, D.; Cantone, P.; Mian, G. Triacontanol (Long-Chain Alcohol) Positively Enhances the Microbial Ecology of Berry Peel in Vitis vinifera cv. ‘Glera’ yet Promotes the Must Total Soluble Sugars Content. OENO One 2023, 57, 477–488. [Google Scholar] [CrossRef]
  28. Gao, P.; Qin, J.; Li, D.; Zhou, S. Inhibitory Effect and Possible Mechanism of a Pseudomonas Strain QBA5 against Gray Mold on Tomato Leaves and Fruits Caused by Botrytis cinerea. PLoS ONE 2018, 13, 1–15. [Google Scholar] [CrossRef] [PubMed]
  29. Zhao, H.; Liu, K.; Fan, Y.; Cao, J.; Li, H.; Song, W.; Liu, Y.; Miao, M. Cell-Free Supernatant of Bacillus velezensis Suppresses Mycelial Growth and Reduces Virulence of Botrytis cinerea by Inducing Oxidative Stress. Front. Microbiol. 2022, 13, 1–15. [Google Scholar] [CrossRef]
  30. Colautti, A.; Comi, G.; De Paoli, E.; Peterlunger, E.; Novello, M.; Braidotti, E.; Pasini, D.; Iacumin, L. Draft Genome Sequences of Eight Bacilli Isolated from an Ancient Roman Amphora. Microbiol. Resour. Announc. 2022, 11, 11–13. [Google Scholar] [CrossRef]
  31. Altschul, S. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef]
  32. Meier-Kolthoff, J.P.; Göker, M. TYGS Is an Automated High-Throughput Platform for State-of-the-Art Genome-Based Taxonomy. Nat. Commun. 2019, 10. [Google Scholar] [CrossRef] [PubMed]
  33. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  34. Price, M.N.; Dehal, P.S.; Arkin, A.P. Fasttree: Computing Large Minimum Evolution Trees with Profiles Instead of a Distance Matrix. Mol. Biol. Evol. 2009, 26, 1641–1650. [Google Scholar] [CrossRef] [PubMed]
  35. Asselin, J.E.; Bonasera, J.M.; Beer, S.V. PCR Primers for Detection of Pantoea ananatis, Burkholderia spp., and Enterobacter sp. from Onion. Plant Dis. 2016, 100, 836–846. [Google Scholar] [CrossRef]
  36. Scarpellini, M.; Franzetti, L.; Galli, A. Development of PCR Assay to Identify Pseudomonas fluorescens and Its Biotype. FEMS Microbiol. Lett. 2004, 236, 257–260. [Google Scholar] [CrossRef] [PubMed]
  37. Li, X.M.; Choi, J.A.; Choi, I.S.; Kook, J.K.; Chang, Y.H.; Park, G.; Jang, S.J.; Kang, S.H.; Moon, D.S. Development and Evaluation of Species-Specific PCR for Detection of Nine Acinetobacter Species. Ann. Clin. Lab. Sci. 2016, 46, 270–278. [Google Scholar]
  38. Xu, X.; Wedgwood, E.; Berrie, A.M.; Allen, J.; O’Neill, T.M. Management of Raspberry and Strawberry Grey Mould in Open Field and under Protection. A Review. Agron. Sustain. Dev. 2012, 32, 531–543. [Google Scholar] [CrossRef]
  39. Falginella, L.; Gaiotti, F.; Belfiore, N.; Mian, G.; Lovat, L.; Tomasi, D. Effect of Early Cane Pruning on Yield Components, Grape Composition, Carbohydrates Storage and Phenology in Vitis vinifera L. cv. Merlot. OENO One 2022, 56, 19–28. [Google Scholar] [CrossRef]
  40. Tomasi, D.; Marcuzzo, P.; Nardi, T.; Lonardi, A.; Lovat, L.; Flamini, R.; Mian, G. Influence of Soil Chemical Features on Aromatic Profile of V. vinifera cv. Corvina Grapes and Wines: A Study-Case in Valpolicella Area (Italy) in a Calcareous and Non-Calcareous Soil. Agriculture 2022, 12, 1980. [Google Scholar] [CrossRef]
  41. Bernardini, C.; Santi, S.; Mian, G.; Levy, A.; Buoso, S.; Suh, J.H.; Wang, Y.; Vincent, C.; van Bel, A.J.E.; Musetti, R. Increased Susceptibility to Chrysanthemum Yellows Phytoplasma Infection in Atcals7ko Plants Is Accompanied by Enhanced Expression of Carbohydrate Transporters. Planta 2022, 256, 1–17. [Google Scholar] [CrossRef]
  42. Perazzolli, M.; Roatti, B.; Bozza, E.; Pertot, I. Trichoderma harzianum T39 Induces Resistance against Downy Mildew by Priming for Defense without Costs for Grapevine. Biol. Control 2011, 58, 74–82. [Google Scholar] [CrossRef]
  43. Pfaffl, M. Development and Validation of an Externally Standardised Quantitative Insulin-like Growth Factor-1 RT-PCR Using LightCycler SYBR Green I Technology. In Rapid Cycle Real-Time PCR; Springer: Berlin/Heidelberg, Germany, 2001; pp. 281–291. [Google Scholar] [CrossRef]
  44. Landi, L.; Romanazzi, G. Seasonal Variation of Defense-Related Gene Expression in Leaves from Bois Noir Affected and Recovered Grapevines. J. Agric. Food Chem. 2011, 59, 6628–6637. [Google Scholar] [CrossRef] [PubMed]
  45. Orozco-Mosqueda, M.d.C.; Kumar, A.; Fadiji, A.E.; Babalola, O.O.; Puopolo, G.; Santoyo, G. Agroecological Management of the Grey Mould Fungus Botrytis cinerea by Plant Growth-Promoting Bacteria. Plants 2023, 12, 637. [Google Scholar] [CrossRef] [PubMed]
  46. Hua, L.; Yong, C.; Zhanquan, Z.; Boqiang, L.; Guozheng, Q.; Shiping, T. Pathogenic Mechanisms and Control Strategies of Botrytis cinerea Causing Post-Harvest Decay in Fruits and Vegetables. Food Qual. Saf. 2018, 2, 111–119. [Google Scholar] [CrossRef]
  47. Gomiero, T.; Pimentel, D.; Paoletti, M.G. Environmental Impact of Different Agricultural Management Practices: Conventional vs. Organic Agriculture. CRC. Crit. Rev. Plant Sci. 2011, 30, 95–124. [Google Scholar] [CrossRef]
  48. Abbey, J.A.; Percival, D.; Abbey, L.; Asiedu, S.K.; Prithiviraj, B.; Schilder, A. Biofungicides as Alternative to Synthetic Fungicide Control of Grey Mould (Botrytis cinerea)—Prospects and Challenges. Biocontrol Sci. Technol. 2019, 29, 241–262. [Google Scholar] [CrossRef]
  49. Darriet, P.; Stamatopoulos, P. Botrytized Wines, 2nd ed.; Elsevier: Amsterdam, The Netherlands, 2021; ISBN 9780081020654. [Google Scholar]
  50. De Simone, N.; Pace, B.; Grieco, F.; Chimienti, M.; Tyibilika, V.; Santoro, V.; Capozzi, V.; Colelli, G.; Spano, G.; Russo, P. Botrytis cinerea and Table Grapes: A Review of the Main Physical, Chemical, and Bio-Based Control Treatments in Post-Harvest. Foods 2020, 9, 1138. [Google Scholar] [CrossRef] [PubMed]
  51. Zhu, P.; Xu, L.; Zhang, C.; Toyoda, H.; Gan, S.S. Ethylene Produced by Botrytis cinerea Can Affect Early Fungal Development and Can Be Used as a Marker for Infection during Storage of Grapes. Postharvest Biol. Technol. 2012, 66, 23–29. [Google Scholar] [CrossRef]
  52. Parra, C.S.; Aguirreolea, J.; Sánchez-Díaz, M.; Irigoyen, J.J.; Morales, F. Effects of Climate Change Scenarios on Tempranillo Grapevine (Vitis vinifera L.) Ripening: Response to a Combination of Elevated CO2 and Temperature, and Moderate Drought. Plant Soil 2010, 337, 179–191. [Google Scholar] [CrossRef]
  53. Barnuud, N.N.; Zerihun, A.; Mpelasoka, F.; Gibberd, M.; Bates, B. Responses of Grape Berry Anthocyanin and Titratable Acidity to the Projected Climate Change across the Western Australian Wine Regions. Int. J. Biometeorol. 2014, 58, 1279–1293. [Google Scholar] [CrossRef]
  54. Marcuzzo, P.; Gaiotti, F.; Lucchetta, M.; Lovat, L.; Tomasi, D. Tuning Potassium Fertilization to Improve pH and Acidity in Glera Grapevine (Vitis vinifera L.) under a Warming Climate. Appl. Sci. 2021, 11, 11869. [Google Scholar] [CrossRef]
  55. Jacometti, M.A.; Wratten, S.D.; Walter, M. Understorey Management Increases Grape Quality, Yield and Resistance to Botrytis cinerea. Agric. Ecosyst. Environ. 2007, 122, 349–356. [Google Scholar] [CrossRef]
  56. Rockenbach, M.F.; Velho, A.C.; Alaniz, S.M.; Stadnik, M.J. Resistance of Apple Leaves to Infection by Colletotrichum fructicola Acts Independently of Hypersensitive Reaction and PR-1 and PR-10 Gene Expression. Trop. Plant Pathol. 2018, 43, 360–370. [Google Scholar] [CrossRef]
  57. Giannakis, C.; Bucheli, C.S.; Skene, K.G.M.; Robinson, S.P.; Steele Scott, N. Chitinase and β-1,3-Glucanase in Grapevine Leaves: A Possible Defence against Powdery Mildew Infection. Aust. J. Grape Wine Res. 1998, 4, 14–22. [Google Scholar] [CrossRef]
  58. Iavicoli, A.; Boutet, E.; Buchala, A.; Métraux, J.P. Induced Systemic Resistance in Arabidopsis thaliana in Response to Root Inoculation with Pseudomonas fluorescens CHA0. Mol. Plant-Microbe Interact. 2003, 16, 851–858. [Google Scholar] [CrossRef]
  59. Cabanás, C.G.L.; Schilirò, E.; Valverde-Corredor, A.; Mercado-Blanco, J. The Biocontrol Endophytic Bacterium Pseudomonas fluorescens PICF7 Induces Systemic Defense Responses in Aerial Tissues upon Colonization of Olive Roots. Front. Microbiol. 2014, 5, 1–14. [Google Scholar] [CrossRef]
  60. Fang, S.; Shang, X.; He, Q.; Li, W.; Song, X.; Zhang, B.; Guo, W. A Cell Wall-Localized β-1,3-Glucanase Promotes Fiber Cell Elongation and Secondary Cell Wall Deposition. Sci. J. Silesian Univ. Technol. Ser. Transp. 2024, 194, 106–123. [Google Scholar] [CrossRef]
  61. Langner, T.; Göhre, V. Fungal Chitinases: Function, Regulation, and Potential Roles in Plant/Pathogen Interactions. Curr. Genet. 2016, 62, 243–254. [Google Scholar] [CrossRef]
  62. Pastor, V.; Luna, E.; Mauch-Mani, B.; Ton, J.; Flors, V. Primed Plants Do Not Forget. Environ. Exp. Bot. 2013, 94, 46–56. [Google Scholar] [CrossRef]
Microorganisms 12 01515 g001
Figure 1. Plant experimental design. NT: not-treated control plants, BP: Paraburkholderia sp. strain CRV74 treated plants, PF: Pseudomonas sp. strain CRV21 treated plants, AL: Acinetobacter sp. strain CRV19 treated plants. B. cinerea inoculations were performed at BBCH 69-71, followed by two inoculums of BCAs at BBCH: 75-77, 83-85.
Figure 1. Plant experimental design. NT: not-treated control plants, BP: Paraburkholderia sp. strain CRV74 treated plants, PF: Pseudomonas sp. strain CRV21 treated plants, AL: Acinetobacter sp. strain CRV19 treated plants. B. cinerea inoculations were performed at BBCH 69-71, followed by two inoculums of BCAs at BBCH: 75-77, 83-85.
Microorganisms 12 01515 g001
Microorganisms 12 01515 g002
Figure 2. Phylogenetic trees for strain CRV19 (A), CRV21 (B), and CRV74 (C).
Figure 2. Phylogenetic trees for strain CRV19 (A), CRV21 (B), and CRV74 (C).
Microorganisms 12 01515 g002
Microorganisms 12 01515 g003
Figure 3. Effect of the application of Paraburkholderia sp. strain CRV74 (BP), Pseudomonas sp. strain CRV21 (PF), and Acinetobacter sp. strain CRV19 (AL) on yield and berry quality in comparison to untreated plants (NT). (A) Average plants yield, expressed in kilograms; (B) must total soluble solids (TSS), expressed as °Brix; (C) titratable acidity, expressed as g/L of tartaric acid and (D) pH values. Where present, different letters indicate significant differences identified through Tukey post hoc test (p < 0.05). Bars denote the standard deviation.
Figure 3. Effect of the application of Paraburkholderia sp. strain CRV74 (BP), Pseudomonas sp. strain CRV21 (PF), and Acinetobacter sp. strain CRV19 (AL) on yield and berry quality in comparison to untreated plants (NT). (A) Average plants yield, expressed in kilograms; (B) must total soluble solids (TSS), expressed as °Brix; (C) titratable acidity, expressed as g/L of tartaric acid and (D) pH values. Where present, different letters indicate significant differences identified through Tukey post hoc test (p < 0.05). Bars denote the standard deviation.
Microorganisms 12 01515 g003
Microorganisms 12 01515 g004
Figure 4. Image (A): PF-treated grape, (B,C): untreated grapes (% of infection: 55 to 65). The photos were taken at the same BBCH (87), showing that the development of grey mould was delayed on the PF treatment. Botrytis had already emerged from the infected berries (sporulation stage).
Figure 4. Image (A): PF-treated grape, (B,C): untreated grapes (% of infection: 55 to 65). The photos were taken at the same BBCH (87), showing that the development of grey mould was delayed on the PF treatment. Botrytis had already emerged from the infected berries (sporulation stage).
Microorganisms 12 01515 g004
Microorganisms 12 01515 g005
Figure 5. Incidence of symptomatic berries of ‘Glera’ in vines treated with Paraburkholderia sp. strain CRV74 (BP), Pseudomonas sp. strain CRV21 (PF), and Acinetobacter sp. strain CRV19 (AL), and in untreated plants (NT). Letters indicate significant differences identified through Tukey post hoc test (p < 0.05). Bars denote the standard deviation.
Figure 5. Incidence of symptomatic berries of ‘Glera’ in vines treated with Paraburkholderia sp. strain CRV74 (BP), Pseudomonas sp. strain CRV21 (PF), and Acinetobacter sp. strain CRV19 (AL), and in untreated plants (NT). Letters indicate significant differences identified through Tukey post hoc test (p < 0.05). Bars denote the standard deviation.
Microorganisms 12 01515 g005
Microorganisms 12 01515 g006
Figure 6. Relative gene expression of PR-1, PR-5, β-1,3-glucanase, and class III chitinase in relation to the treatment with Paraburkholderia sp. strain CRV74 (BP), Pseudomonas sp. strain CRV21 (PF), and Acinetobacter sp. strain CRV19 (AL) compared to untreated plants (NT). Statistical significance is reported as follows: *** p < 0.001, ** p < 0.01, * p < 0.05. Letters indicate significant differences identified through Tukey post hoc test. Bars denote the standard deviation.
Figure 6. Relative gene expression of PR-1, PR-5, β-1,3-glucanase, and class III chitinase in relation to the treatment with Paraburkholderia sp. strain CRV74 (BP), Pseudomonas sp. strain CRV21 (PF), and Acinetobacter sp. strain CRV19 (AL) compared to untreated plants (NT). Statistical significance is reported as follows: *** p < 0.001, ** p < 0.01, * p < 0.05. Letters indicate significant differences identified through Tukey post hoc test. Bars denote the standard deviation.
Microorganisms 12 01515 g006
Table 1. List of reference genomes with their accession numbers used for phylogenetic analysis.
Table 1. List of reference genomes with their accession numbers used for phylogenetic analysis.
Preferred NameDepositAssembly AccessionNotes
Acinetobacter terraeANC 4282GCA_013004375
Acinetobacter pseudolwoffiiANC 5044GCA_002803605
Acinetobacter kookiiJCM18512GCA_039543765
Acinetobacter mesopotamicus’DSM 26953GCA_011058205Not a valid published name
Acinetobacter shaoyimingii323-1TGCA_011578045
Prolinoborus fasciculusCIP 103579GCA_900322255
Acinetobacter variabilisNIPH 2171GCA_000369625
Acinetobacter lwoffiiNCTC 5866GCA_000487975
Acinetobacter schindleriCIP 107287GCA_000368625
Acinetobacter indicusCIP 110367GCA_000488255
Acinetobacter harbinensisHITLi 7GCA_000816495
‘Acinetobacter pecorum’Sa1BUA6GCF_014837015Not a valid published name
Acinetobacter terrestrisANC 4471 TGCA_004331155
‘Acinetobacter idrijaensis’MIIGCA_000761495Not a valid published name
Paraburkholderia phytofirmansPsJNGCA_000020125
Paraburkholderia dipogonisICMP 19430GCF_004402975
Paraburkholderia dioscoreaeMsb3TGCF_902459535
Paraburkholderia xenovoransLB400GCA_000013645
Paraburkholderia aromaticivoransBN5GCA_002278075
Paraburkholderia ultramaficaLMG 28614GCA_902859915
Paraburkholderia ginsengisoliNBRC 100965GCA_000739735
Paraburkholderia panacisoliDCY113GCA_008369935
Paraburkholderia terricolaLMG 20594GCA_900142195
Paraburkholderia insulsaLMG 28183GCA_003002115Reclassified as P. fungorum
Paraburkholderia fungorumNBRC 102489GCA_000685055
Paraburkholderia agricolarisBaQS159GCF_009455635
Paraburkholderia madsenianaRP11GCA_009690905
Paraburkholderia domusLMG 31832GCA_905220705
Paraburkholderia phenaziniaLMG 2247GCA_900100735No Match
Paraburkholderia sabiaeLMG24235GCF_904848645
Pseudomonas fluorescensDSM 50090GCA_001269845
Pseudomonas salomoniiLMG 22120GCA_001730645
Pseudomonas edaphicaRD25GCA_005863185
Pseudomonas antarcticaLMG 22709GCF_900103795
Pseudomonas kitaguniensisMAFF 212408TGCF_009296165
Pseudomonas costantiniiLMG 22119GCF_001870435
Pseudomonas cyclaminisMAFF 301449TGCA_015163715
Pseudomonas sivasensisP7GCA_013778505
Pseudomonas marginalisDSM 13124GCA_007858155
Pseudomonas aylmerensisS1E40GCA_001702265
Pseudomonas marginalisICMP 3553GCA_001645105
Pseudomonas petroseliniMAFF 311094GCA_021166635
Pseudomonas canadensis2-92GCF_000503215
Pseudomonas pergaminensis1008TGCF_024112395
Pseudomonas haemolyticaDSM 108987TGCF_009659625
Pseudomonas fildesensisKG01GCA_001050345
Table 2. List of primers used for the gene expression analyses in grapevine berries, cv. Glera, and NCBI accession numbers. References: PR-1 and PR-5. β-1,3-glucanase and class III chitinase. Housekeeping gene: Actin.
Table 2. List of primers used for the gene expression analyses in grapevine berries, cv. Glera, and NCBI accession numbers. References: PR-1 and PR-5. β-1,3-glucanase and class III chitinase. Housekeeping gene: Actin.
GenesPrimer PairsAccession Number *Reference
PR-1Forward: ACTTGTGGGTGGGGGAGAAAJ536326[3]
Reverse: TGTTGCATTGAACCCTAGCG
PR-5Forward: GACGGGCTGGTCAGGTCTC118300[3]
Reverse: CGCCGTTGCACTCTACCT
β-1,3-glucanaseForward: TGCTGTTTACTCGGCACTTGAJ277900[44]
Reverse: CTGGGGATTTCCTGTTCTCA
class III chitinaseForward: AAACTTATCAGCGCCTGGAADQ406693[44]
Reverse: ACCTCCATACTTGGGGGAAG
ActinForward: TCCTTGCCTTGCGTCATCTATTC134791[42]
Reverse: CACCAATCACTCTCCTGCTACAA
* Accession numbers from NCBI Gene Bank (www.ncbi.nlm.nih.gov) or TIGR Grape database v7.0 (https://www.genoscope.cns.fr/cgi-bin/ggb/vitis/12X/gbrowse/vitis/, accessed on 3 June 2024).
Table 3. 16S ribosomal RNA identification of isolates.
Table 3. 16S ribosomal RNA identification of isolates.
StrainAccession NumberSeq. Length (bp)SpeciesReference Strain WGSIdentity (%)Query Cover (%)
CRV19PP927971.1496Acinetobacter lwoffiGCA_019343495.199.20100
CRV21PP927970.1517Pseudomonas fluorescensGCA_900215245.198.84100
CRV74PP927969.1518Paraburkholderia phytofirmansGCA_000020125.199.23100
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mian, G.; Belfiore, N.; Marcuzzo, P.; Spinelli, F.; Tomasi, D.; Colautti, A. Counteracting Grey Mould (Botrytis cinerea) in Grapevine ‘Glera’ Using Three Putative Biological Control Agent Strains (Paraburkholderia sp., Pseudomonas sp., and Acinetobacter sp.): Impact on Symptoms, Yield, and Gene Expression. Microorganisms 2024, 12, 1515. https://doi.org/10.3390/microorganisms12081515

AMA Style

Mian G, Belfiore N, Marcuzzo P, Spinelli F, Tomasi D, Colautti A. Counteracting Grey Mould (Botrytis cinerea) in Grapevine ‘Glera’ Using Three Putative Biological Control Agent Strains (Paraburkholderia sp., Pseudomonas sp., and Acinetobacter sp.): Impact on Symptoms, Yield, and Gene Expression. Microorganisms. 2024; 12(8):1515. https://doi.org/10.3390/microorganisms12081515

Chicago/Turabian Style

Mian, Giovanni, Nicola Belfiore, Patrick Marcuzzo, Francesco Spinelli, Diego Tomasi, and Andrea Colautti. 2024. "Counteracting Grey Mould (Botrytis cinerea) in Grapevine ‘Glera’ Using Three Putative Biological Control Agent Strains (Paraburkholderia sp., Pseudomonas sp., and Acinetobacter sp.): Impact on Symptoms, Yield, and Gene Expression" Microorganisms 12, no. 8: 1515. https://doi.org/10.3390/microorganisms12081515

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Article metric data becomes available approximately 24 hours after publication online.
Back to TopTop