Next Article in Journal
Grazing Intensity Modifies Soil Microbial Diversity and Their Co-Occurrence Networks in an Alpine Steppe, Central Tibet
Next Article in Special Issue
Actinobacillus succinogenes in Bioelectrochemical Systems: Influence of Electric Potentials and Carbon Fabric Electrodes on Fermentation Performance
Previous Article in Journal
A Comprehensive 10-Year Nationwide Pharmacovigilance Surveillance on Antibacterial Agents in Korea: Data Mining for Signal Detection of Trends and Seriousness of Adverse Events
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

De Novo Assembly of the Polyhydroxybutyrate (PHB) Producer Azohydromonas lata Strain H1 Genome and Genomic Analysis of PHB Production Machinery

by
Daniele Traversa
1,
Carlo Pazzani
2,
Pietro D’Addabbo
2,
Lucia Trisolini
2,
Matteo Chiara
1,3,
Marta Oliva
2,
Angelo Marzella
2,
Camilla Mandorino
2,
Carla Calia
2,
Guglielmina Chimienti
2,
Caterina Manzari
3,
Graziano Pesole
2,3 and
Maria Scrascia
2,*
1
Department of Biosciences, University of Milan, 20133 Milan, Italy
2
Department of Biosciences, Biotechnology and Environment, University of Bari Aldo Moro, 70125 Bari, Italy
3
Institute of Biomembranes, Bioenergetics and Molecular Biotechnology, Consiglio Nazionale delle Ricerche, 70126 Bari, Italy
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(1), 137; https://doi.org/10.3390/microorganisms13010137
Submission received: 16 December 2024 / Revised: 30 December 2024 / Accepted: 6 January 2025 / Published: 10 January 2025
(This article belongs to the Special Issue Microbial Bioprocesses)

Abstract

Polyhydroxybutyrate (PHB) is a biodegradable natural polymer produced by different prokaryotes as a valuable carbon and energy storage compound. Its biosynthesis pathway requires the sole expression of the phaCAB operon, although auxiliary genes play a role in controlling polymer accumulation, degradation, granule formation and stabilization. Due to its biodegradability, PHB is currently regarded as a promising alternative to synthetic plastics for industrial/biotechnological applications. Azohydromonas lata strain H1 has been reported to accumulate PHB by using simple, inexpensive carbon sources. Here, we present the first de novo genome assembly of the A. lata strain H1. The genome assembly is over 7.7 Mb in size, including a circular megaplasmid of approximately 456 Kbp. In addition to the phaCAB operon, single genes ascribable to PhaC and PhaA functions and auxiliary genes were also detected. A comparative genomic analysis of the available genomes of the genus Azohydromonas revealed the presence of phaCAB and auxiliary genes in all Azohydromonas species investigated, suggesting that the PHB production is a common feature of the genus. Based on sequence identity, we also suggest A. australica as the closest species to which the phaCAB operon of the strain H1, reported in 1998, is similar.

1. Introduction

The exponential increase in fossil-derived plastic waste and the growing demand for plastics [1,2] create the urgency to replace petrochemical-based plastics with biodegradable polymers [3,4,5]. Polyhydroxyalkanoates (PHAs) are a group of bio-based polyesters that are biodegradable, resemble synthetic plastics, produced by a range of diverse prokaryotes and accumulated in the cytoplasm as granules reserve of carbon and energy [6,7,8]. Based on the carbon atoms content per monomer unit, PHAs can be classified as short-chain-length (scl-PHAs), with 3–5 carbon atoms, and medium-chain-length (mcl-PHAs), containing 6–14 carbon atoms, per unit. Scl-PHAs are rigid and fragile with a high melting temperature and low glass transition temperature; they are the most abundant PHAs among prokaryotes. Mcl-PHAs are elastic with lower melting and glass transition temperatures, as compared to scl-PHAs [7].
Among the scl-PHAs, the homopolymer polyhydroxybutyrate (PHB) is one of those considered for large-scale production due to its biodegradability and biocompatibility, being proposed in medical and pharmaceutical fields as well [9]. Thus, PHB is currently regarded as one of the most promising PHAs for biotechnological applications, with increasing studies on PHBs producing bacteria and a growing interest to make PHB more competitive in commercial markets [10,11]. From the view of a circular economy, many efforts target efficient and low-cost PHB production by using, in addition to native producers, bacteria (e.g., Escherichia coli) engineered with heterologous PHB genes/operons with the objective of producing PHB efficiently from renewable biomass (e.g., whey waste, starch, wastewater) [12].
Gram-negatives, such as Azohydromonas lata (formerly Alcaligenes latus) strain H1 (DSM1123; ATCC 29714), Azotobacter spp., Cupriavidus necator (formerly Ralstonia eutropha) strain H16 (DSM 428; ATCC17699), Pseudomonas spp. and also recombinant Escherichia coli expressing the PHB biosynthetic genes from native producers strains, can accumulate large amounts of PHB and are considered the most promising systems for large-scale PHB production [9,13]. C. necator H16, in particular, represents the model organism for the study of PHB production [12,14]. Three main distinct pathways for PHB synthesis are described [7]; in C. necator, three genes, usually organized in an operon (phaCAB), are deemed sufficient for PHB biosynthesis: PHA synthase (phaC), 3-chetothiolase (phaA) and acetoacetyl-CoA reductase (phaB). PhaCs (the crucial function common to all the known pathways) are generally categorized into four classes (I to IV) based on amino acid sequence, in vivo substrate specificities of the enzymes and the number/composition subunits forming the catalytic complex [15]. An additional class (class V) was recently proposed by Tan and colleagues, based on the PhaC of Janthinobacterium sp. [16]. Beyond the three main genes (phaA, phaB and phaC), many auxiliary genes have been identified and characterized to encode important functions in controlling polymer accumulation and degradation. These include the regulatory gene phaR, the depolymerase phaZ, the extracellular oligomer hydrolase phaY, and the phasin phaP involved in granule formation/stabilization [17,18,19].
Since the availability of the reference C. necator H16 genome [20,21], the phaCAB operon, auxiliary genes associated with PHB production and isologs of PhaA (beta-ketothiolases) and PhaB (reductases) with different substrate specificity, have been characterized and studied in this bacterium [21,22]. However, equivalent considerations do not apply to the A. lata strain H1. Expanding the repertoire of known/characterized PHB genes could provide crucial insights for the optimization of biotechnological applications based on the genetic engineering of the pathway. Here, we present the first de novo genome assembly of A. lata strain H1, whose information might be exploitable for biotechnological applications [13,14]. Although the sequence of the phaCAB operon of A. lata H1 has been previously determined [23], we reasoned that the assembly of the genome sequence could offer significant advances in the identification of genes associated with PHB production and offer a more complete representation of the organization of the PHB operon, together with the number and configuration of auxiliary genes and potential isologs in A. lata. Moreover, our comparative genomic analyses of phaCAB and related genes within the genus Azohydromonas could advance the general knowledge of the genomic organization and conservation of these genes and inform the design of prospective biotechnological applications.

2. Materials and Methods

2.1. Genome Sequencing, Assembly and Annotation

A. lata strain H1 was obtained from the Leibniz institute DSMZ–German Collection of Microorganisms and cell culture GmbH (Braunschweig, Germany) (strain code DSM1123). The genomic DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen Inc., Hilden, Germany) Kit (QIAGEN, Hilden, Germany) and purified using Amicon Ultra-0.5. MWCO 30 kDa (Millipore, Burlington, MS, USA) according to the manufacturer’s protocols. The purity and concentration were assessed using a NanoDrop spectrophotometer and Qubit 3.0 (Thermo Scientific, Waltham, MA, USA), respectively. The library was prepared from the purified bacteria genomic DNA using Illumina DNA Prep (Illumina, San Diego, CA, USA). The sequencing was carried out using Miseq Reagent Kit v2 (500 cycles) and the Illumina MiSeq platform (Illumina, San Diego, CA, USA). Adaptor sequences and low-quality regions were removed by using Trimmomatic with default parameters [24]. Overlapping paired-end reads were merged by Pear [25]. Genome assembly was performed using the Unicycler workflow, using the SPAdes assembler ([26] GATK team). The following kmers sizes were used: 27, 53, 71, 87, 99, 111, 119, 127. Contigs shorter than 200 bp in size were discarded. The genome was deposited at NCBI under the GenBank accession number GCA_034427735.1. Gene annotation was performed by the NCBI Prokaryotic Genome Annotation Pipeline (PGAP) [27]. The annotation of rRNA were manually refined by performing blastn (v2.9.0-2) [28] sequence similarity searches and manual alignment with the 5S, 16S and 23S rRNA genes from the draft genome assembly of the A. lata type strain NBRC 102462 (GenBank accession number GCA_001571085.1). CRISPR-Cas systems and CRISPR array(s) were annotated by CRISPRCasFinder with default parameters [29]. The potential self-targeting of spacers was assessed by blastn sequence similarity searches of the spacers’ sequences in the genome. Default parameters were used and only matches showing an e-value ≤ 10−50 and identity ≥ 90% were considered. The spacers’ sequences were also searched in the NCBI nr/nt (https://ftp.ncbi.nlm.nih.gov/blast/db/ accessed on 4 March 2024) database to assess the presence of sequences of exogenous origin. Default parameters were used. The CRISPR array subtype was inferred based on sequence similarity with the most similar sequence in the NCBI nr/nt database (https://ftp.ncbi.nlm.nih.gov/blast/db/ accessed on 6 March 2024). Candidate transposases, resistance genes and Toxin–Antitoxin (TA) systems were inferred according to the PGAP annotation. The general features and genome statistics were computed using custom scripts written in Python (v 3.8.10) and R (v 4.2.0) and standard bash shell utilities. The circular map of the candidate plasmid sequence was generated with the web-based implementation of Proksee [30].

2.2. ANI and dDDH

The Average Nucleotide Identity (ANI) and Digital DNA–DNA hybridization (dDDH) were computed by considering the complete collection of publicly available Azohydromonas genome assemblies accessible through NCBI Refseq (https://www.ncbi.nlm.nih.gov/assembly/?term=Azohydromonas accessed on 18 December 2023) (Table S1). The ANI values were computed using OrthoAniU [31]. The dDDH values were determined using the Genome-to-Genome Distance Calculator (GGDC-3.0) with the recommended settings [32].

2.3. PHB Genes Detection and Class Designation of PhaCs

PHB genes were annotated using blastp sequence similarity searchers with PHB genes from C. necator H16 (GeneBank AM260479.1) [21]. Only blastp matches showing an e-value ≤ 10−50 and identity ≥ 40% were considered. Candidate PhaC protein sequences from A. lata H1 were assigned to one of the five classes of PhaC enzymes based on similarity, as determined by blastp searches (with default parameters), with respect to an arbitrarily selected collection of representative sequence for every class (Table S2). Only matches with an e-value ≤ 10−50 were considered, and the class was assigned based on the best blastp match. Candidate PhaC protein sequences were aligned by using the online version of Clustal Omega [33], and the alignment was visualized with JalViewer version 2.11.4.1 [34].

3. Results

3.1. Genome Assembly of A. lata H1

The genome assembly of A. lata strain H1 is accessible at GenBank under the accession number GCA_034427735.1. The draft genome is over 7.7 Mb in size and includes a circular megaplasmid of approximately 456 Kbp (Figure 1 and GenBank: JAXOJX010000001.1).
The genome assembly consists of 302 scaffolds and the N50 value is 89,247 bp. The descriptive statistics are reported in Table 1.
The G + C content is 65.6% for the megaplasmid and 68.7% for the remaining scaffolds. A total of 1 rRNA 5S, 3 rRNA 16S, 2 rRNA 23S, and 56 tRNA genes were identified; none of these are localized in the megaplasmid. The PGAP annotation predicted 6945 protein coding genes, of which 408 were on the megaplasmid; a putative function was assigned to 5933 proteins (megaplasmid 300), while 14.5% of the proteins (1012) were annotated as “hypothetical proteins”. A total of 49 genes encoding putative transposases were annotated by PGAP; 16 transposases were localized on the megaplasmid and 10 formed a potential cluster spanning approximately 100 Kb in size (Figure 1 and Figure 2). Based on the PGAP annotation, 35 transposases were assigned to eight different families while 14 were not assigned to a family (Table 2 and Table S3).
TA systems play a role in maintaining plasmids in bacteria cells [35]. They usually consist of two proteins (antitoxin and toxin) encoded by two juxtaposed genes, organized in an operon with the antitoxin gene more frequently upstream than the toxin gene [36]. TA operons characterized by the toxin gene upstream of the antitoxin have been recently reported [37]. Based on the nature (protein or RNA) and mode of action of antitoxins, TA systems have been classified into different classes [36], with type II systems being the most abundant and extensively studied. Candidate TA systems were manually searched in the DSM1123 megaplasmid inspecting candidate toxin and antitoxin genes, according to the PGAP annotation. Two distinct putative type II TAs were identified in the A. lata megaplasmid (Table 3).
The first system (system II-A hereafter) belongs to the RelE/ParE family and is composed of two protein coding genes: the toxin (locus tag SM757_01580) and the HigA antitoxin (locus tag SM757_01585). The second system (system II-B hereafter) has a similar configuration, being formed by the RelE/ParE toxin (locus tag SM757_01815) and HigA antitoxin (locus tag SM757_01820). System II-B includes an additional gene (locus tag SM757_01810) encoding for the VapB antitoxin. Whereas three components of type II TA systems have been previously described ([36], Toxin-Antitoxin Database. http://bioinfo-mml.sjtu.edu.cn/TADB/, accessed on 19 April 2024), to the best of our knowledge, this is the first reported instance of a potential VapB/RelE/HigA TA system. Interestingly, 10 Kbp upstream of system II-B, the presence of a predicted antitoxin AbiEi domain protein (locus tag SM757_01845), which could represent a partial abortive type IV system (AbiEi/AbiEii) [38], was also noticed. All the candidate TAs co-localize in the same plasmid region adjacent to the cluster of the 10 predicted transposase genes described above (Figure 1).

3.2. Nucleotide Identity Levels in the Genus Azohydromonas

The current taxonomic classification of A. lata collocates the species in the family Alcaligenaceae, order Burkholderiales. Recently, Mogro and colleagues have published a phylogeny of the genus supporting the classification of Azohydromonas in the family Comamonadaceae [39]. The phenetic clustering of nucleotide identity levels among Azohydromonas genome assemblies, as available in December 2023 (Table S1), indicates the reference strain A. lata NBRC102462 as the most similar sequence to A. lata H1 (Figure 3), with an ANI of 98.7%, which is well within the range observed between isolates of the same species [40]. At the species level, A. aeria (84.5), A. australica (85.7), A. caseinilytica (84.6) and an uncultured Azohydromonas specimen (84.8) had the highest level of sequence identity with A. lata. Additionally, nearly identical patterns of genome identity levels were recovered when similarity metrics based on dDDH [41] were considered (Figure 4).
Further, our ANI and dDDH analyses suggest high levels of sequence identity between A. sediminis (strains YIM 73032 and SYSU G00088) and Calidifontimicrobium sp. strain SYSU G02091, but a relatively low (ANI~76%) level of sequence identity between these species and the other Azohydromonas species. In consideration of the fact that genome sequence identity levels ranging between 72 and 75% are normally used to delineate a bacterial genus [40], these patterns of genome identity levels—along with the observation that A. sediminis strains present considerably smaller genomes compared with other Azohydromonas (average size 3.6 Mb with respect to 7.2 Mb, Table S4)—might advocate for the reclassification of Calidifontimicrobium sp. strain SYSU G02091 under the genus Azohydromonas, or eventually suggest the classification of the three strains (YIM 73032, SYSU G00088 and SYSU G02091) under a genus different from Azohydromonas.

3.3. CRISPR-Cas Systems

Soil was the environment from which A. lata H1 has been isolated. In this complex environment, exogenous genetic elements, such as plasmids and phages, may represent a life threat (e.g., phages) or a metabolic burden (e.g., plasmids). The invasion of such elements is counteracted by the adaptive immunity defense mechanism CRISPR–Cas system. Studying the presence/absence of CRISPR–Cas systems in the genome allows us to better delineate the strain adaptation in its natural habitat based on the balance between the protection provided by CRISPR systems and their possible deleterious effects (e.g., self-targeting spacers), the role played by exogenous genetic elements (e.g., plasmids, phages, etc.) in strain evolution and the horizontal transfer of the CRISPR system. A CRISPR array was identified in the draft assembly of the A. lata H1 genome (contig JAXOJX000000044 25075-26262) by CRISPRCasFinder [29]. However, no cas genes were annotated by PGAP. The identified CRISPR array contained 20 direct repeats (DRs) with the consensus DR sequence GTATTTCCCGCGCGAGCGGGGATAAACCG showing the highest level of similarity with putative subtype I-E DRs in the genome assembly of Cronobacter sakazakii (GenBank accession number GCA_009648895.1). Sequence similarity searches throughout the genome of A. lata H1 did not indicate any potential self-targeting spacer. The candidate spacer sequences did not show any similar detectable protospacers with publicly available plasmids and/or phage sequences, suggesting that the spacers’ protospacers might not have been sequenced. Although we cannot exclude that the lack of a set of cas genes in the genome might result from incomplete assembly or inaccurate annotation, the observations reported above might be compatible with an exogenous origin of the identified CRISPR array. Alternatively, a CRISPR array not associated with known cas genes might indicate a possible role of the array beyond the adaptive immunity (e.g., regulatory function) [42] or association with Cas proteins yet to be identified.

3.4. Resistance Proteins

As stated in the previous section, A. lata H1 was purified from soil samples collected in Berkeley University (California) before September 1977. Soil bacteria might have been exposed to a variety of environmental stimuli, including competition with other microbial populations and/or the exposure to chemical pollutants. Hence, the identification of candidate resistance genes might be an indication of the adaptation of the A. lata H1 to competitive habitats. A total of 11 ORFs possibly associated with resistance proteins were annotated by PGAP (Table 4).
None of these are localized on the megaplasmid. These candidate resistance genes can be broadly categorized into six different classes: heavy metals resistance (arsenical-cadmium (SM757_03940), cobalt–zinc–cadmium (SM757_03785), toxic metal(loid) resistances (four genes tellurite TerB: SM757_05525, SM757_19280, SM757_24300, SM757_24860), toxic compounds resistance (chromate resistance, three genes: SM757_03450, SM757_03465, SM757_05070), glyoxalase/bleomycin/dioxygenase resistance (SM757_12920), and organic hydroperoxide resistance (SM757_22515). Although, in the absence of an experimental validation, predicted patterns of resistance cannot be confirmed, we speculate that the presence of genomic regions encoding for six different families/superfamilies of resistance genes suggests a possible wide resilience of A. lata H1 to different environments. This is consistent with the environmental origin of the strain.

3.5. Annotation of PHB Related Genes

The ability of the A. lata strain H1 to produce PHB is an attractive feature for biotechnological applications. The cloning and molecular analysis of the strain’s operon phaCAB has been previously reported by Choi et al. [23]. Here, we report a detailed description of the phaCAB operon and auxiliary genes related to polyhydroxybutyrate production in the genome of A. lata H1. The model organism C. necator H16 was used as a query to identify candidate orthologous genes in the proteome of A. lata H1. A total of 27 PHB-related genes were identified (Table 5 and Table S5). Of these, four were annotated as phaC, one as phaB and six as phaA. An arrangement of genes compatible with a phaCAB operon was identified at genomic coordinates JAXOJX010000042 5833-9548 as follows: SM757_22330, poly(R)-hydroxyalkanoic acid synthase (phaC) (1611 pb); SM757_22335, acetyl-CoA acetyltransferase (phaA) (1179 bp); and SM757_22340 acetoacetyl-CoA reductase (phaB) (738 bp); three extra phaCs (named phaC1 and phaC2 in coherence with C. necator H16 annotation) and five extra phaA (SM757_00745 on the megaplasmid) were predicted. These extra PHA genes did not show an operon architecture (e.g., phaCA), as previously described in other species [18,43]. The PHA synthase encoded by the phaC1 gene in the phaCAB operon reported for C. necator H16 and A. lata H1 was already classified as class I [15]. To establish the class of the predicted extra PhaCs, the protein sequence similarity, with respect to a selection of representative protein from class I to V PhaCs [16,44], was used (Table S2). Based on this analysis, the A. lata PhaC1s (SM757_22330 and SM757_05625) are putatively assigned to class I while the PhaC2s (SM757_29010 and SM757_26710) were assigned to class V (Figure 5, Table S6).
Rehm and colleagues [15] identified eight key amino acid residues (S260, C319, G322, D351, W425, D480, G507 and H508) by referring to C. necator H16 PhaC1 that are universally conserved in all PHA synthases, suggesting an important role of those residues in protein function. The conservation of these amino acids was more recently confirmed by Tan and colleagues in Class V PhaCs as well [16]. We performed an equivalent analysis for both the C. necator H16 PhaC2 and the extra candidate PhaCs annotated in A. lata H1. All the eight key residues, including the putative catalytic triad (C319, D480 and H508 based on C. necator H16 PhaC1), were conserved (Figure 6 and Figure S1). The isologs of PhaA (beta-ketothiolases) and PhaB (reductases) with different substrate specificity have been previously reported in C. necator H16 [21,22]. Based on the PGAP annotation, seven candidate PhaA isologs (thiolases) were identified in A. lata H1, and among these, one (SM757_01140) is encoded on the megaplasmid (Table 5 and Table S5). Based on the same criteria, three candidate PhaB isologs (reductase) have been predicted (ORFs SM757_08215, SM757_31855 and SM757_23050). Interestingly, our sequence similarity analyses identified, in the genome of A. lata H1, at least one candidate homolog for all of the auxiliary PHA genes described in the model C. necator H16, including the following: two phaY hydrolases (locus tags SM757_26695 and SM757_23895); two polyhydroxyalkanoate depolymerase phaZ (locus tags SM757_08600 and SM757_15980); one phaP phasin family protein (locus tag SM757_26850) and a phaR transcriptional regulator (locus tag SM757_25825).

3.6. PhaCAB and Auxiliary Genes in the Azohydromonas Genus

The same procedure used for the annotation of candidate PHA genes in Azohydromas lata H1, was applied to the complete collection of publicly available Azohydromonas spp. genome assemblies (Table S1). Candidate phaA, phaB and phaC genes, as well as auxiliary PHA genes and putative isologs, were recovered in all the genomes considered. Potentially intact phaCAB operons were observed in the following: A. lata NBRC 102462, Calidifontimicrobium sp. SYSU G02091, A. sediminis (SYSU G00088 and YIM 73032), A. caseinilytica G-1-1-1-4, whereas in Azohydromonas aeria, Azohydromonas australica and the uncultured Azohydromoas sp., a partial phaCA operon was identified. In these last three cases, however, both genes were consistently localized at one of the extremities of a contig in all the genome assemblies, potentially suggesting possible issues in the assembly due to multiple copies of the operon. In line with this hypothesis, a complete candidate phaB gene was annotated in A. aeria and A. australica in a non-adjacent region with respect to the phaCA incomplete operon. Further, we observed that A. aeria and A. australica were also associated with an increased number of candidate PHB genes, auxiliary genes and isologs (Table S4). Conversely, and probably due to their reduced genome size, Calidifontimicrobium sp. SYSU G02091 and A. sediminis strains SYSU G00088 and YIM 73032 displayed a more limited repertoire of candidate PHB related genes and isologs. The sequence of the phaC, phaA and phaB from the phaCAB operon, both annotated by our analyses in the genome of A. lata H1 and reported by Choi et al. [23], were independently compared with candidate phaCAB genes from other Azohydromonas spp. As expected, high levels of similarity were observed between the A. lata H1 and the A. lata type strain NBRC102462 genes (range 99.1–99.8%) while the sequences reconstructed by Choi had the highest levels of similarity (range 94.3–100%) with Azohydromonas australica DSM 1124 phaCAB genes (Table 6, Table 7 and Table 8). These results indicate that the phaCAB operon described by Choi et al. was probably isolated from A. australica. It might be explained in the light of the recent reclassification/split about the two Alcaligenes latus isolates IAM 12599T and IAM 12664 into two distinct species: A. lata and A. australica [45].

4. Discussion

The increasing usage of plastic in many anthropic activities has caused a global environmental crisis of plastic pollution, with serious risks for animal and human health. PHB is a bio-based biologically degradable polymer suitable for producing biodegradable plastic, representing an eco-friendly alternative to synthetic plastic [46]. Being nontoxic, it also has a promising role in designating strategies related to regenerative medicine and tissue engineering [9]. The improved understanding of both PHB metabolism (e.g., synthesis and degradation) and the genetic repertoire in native and recombinant bacteria producers, might contribute to a widespread industrial application of PHB-based materials to meet the growing global demand of green bioplastics from renewable sources [46]. Here, we report the first draft genome assembly of the bacterium Azohydromonas lata H1, a PHB producing strain with potential biotechnological applications.
The taxonomic assignment of A. lata H1 within the genus Azohydromonas, was confirmed by a sequence similarity matrix based on ANI and dDDH. However, patterns of genome sequence identity, coupled with the observation of substantial differences in the size of the genome, might advocate for a partial revision of the genus Azohydromonas itself. More specifically, A. sediminis (YIM 73032, SYSU G00088) and Calidifontimicrobium sp. (SYSU G02091) presented levels of ANI of around 76% with all the other Azohydromonas species, a value that is considered borderline for the delineation of a bacterial genus; moreover, the size of the genome was significantly reduced in these species (~3.8 Mb compared to ~7.4 Mb of other Azohydromonas species, Table S4). Further, since there is a high level of identities between the sequences of A. sediminis (YIM 73032, SYSU G00088) and Calidifontimicrobium sp. (SYSU G02091), they should be reclassified under the same species.
An analysis of the genome sequencing also revealed the presence of a 456 Kbp megaplasmid, not reported in the genome assembly of the reference strain A. lata NBRC 102462. The megaplasmid harbors two distinct type II TA systems (here named II-A and II-B). The II-B system is, to the best of our knowledge, the first report of a VapB/RelE/HigA three component system.
By focusing on genes implicated in PHB production, in addition to the identification of the phaCAB operon, different auxiliary genes associated with PHB utilization and granule formation were detected. These included phaR, phaP, phaY, as well as extra copies of phaA and phaC and a number of potential phaA and phaB isologs. Based on sequence similarity, four distinct PhaC functions (two PhaC1 and two PhaC2 based on C. necator H16 annotation) were found, of which the two PhaC1 were putatively assigned to class I while the two PhaC2 were assigned to class V. This finding is consistent with the possibility of a broad substrate utilization for PHB production, although experimental investigations are required to validate such a hypothesis. Our comparative genome analyses indicate the presence of PHB and its related genes in all the Azohydromonas genome assemblies considered, suggesting that all the considered species of the genus Azohydromonas are endowed with the molecular machinery for PHB production. According to the observed patterns of PHB gene distribution, A. australica is the species with the largest repertoire of PHB genes within the genus Azohydromonas, and speculations purely based on gene dosage/gene number would suggest high levels of PHB production in this species. Consistent with this hypothesis and in consideration of our sequence similarity analyses, we suggest that the phaCAB described by Choi et al. in 1998 [23]—which was isolated from a specimen with “high concentration with high productivity” of PHB—is assigned to A. australica and not A. lata H1.
By using modern approaches based on genome sequence and identity/similarity metrics, we derive a more precise and unequivocal identification of the species of origin of the phaCAB operon originally described by Choi et al. in 1998 [23], and we speculate that—at least in A. australica—increased PHB production might depend on PHB gene number/gene dosage, rather than on the optimization of the catalytic activity of a specific enzyme. This observation, coupled with the widespread distribution of PHB-related genes across the genus Azohydromonas, as evidenced by our analyses, prompts for further functional studies for a more accurate characterization of the levels of PHB production, underlying molecular pathways and potential biotechnological applications of Azohydromonas.

5. Conclusions

Since the elevated production cost of PHB, compared to petroleum-based plastics, is still a significant barrier to the wide use of this biopolymer in industrial settings, it might be crucial to use an omics approach (genomics, proteomics and transcriptomics) in studies focusing on bacteria PHB accumulation by utilizing organic low-cost wastes as metabolic substrates at different growth conditions [10]. The results of our study, in addition to the first draft genome sequence of A. lata strain H1, supplies a comprehensive delineation of the genetic repertoire of PHB genes in the genus Azohydromonas and underlines the importance of comparative genomics for informing the design of biotechnological applications based on microbial species. The genome sequencing of PHB producers, such as A. lata, helps to increase knowledge of the genetic network involved in PHB biosynthesis. Our study suggests that the PHB pathway is a common evolutionary feature of the genus Azohydromonas and provides data for further analysis on the ecological and genomic issues of PHB production. This knowledge can be exploited from a biotechnological point of view and for studies (with an omics approach) on PHB production, evolutionary dynamics of PHA operons and auxiliary genes and their possible horizontal gene transfer.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms13010137/s1, Figure S1: MSA of candidate PhaC proteins aligned by using the online version of Clustal Omega and visualized with JalViewer; Table S1: Azohydromonas assemblies used for nucleotide identity level analysis (ANI and dDDH); Table S2: PhaCs protein sequences considered to assign class to the PhaCs of Azohydromonas lata H1; Table S3: Predicted transposases; Table S4: Genomic features among available assemblies of Azohydromonas genus; Table S5: PHB genes in A. lata H1; Table S6: Results from the blastp similarity search for the assignment of PhaC class based on identity values.

Author Contributions

Conceptualization, M.S.; investigation, D.T., C.P. and P.D.; methodology, D.T., L.T., G.C. and C.M. (Caterina Manzari); writing—original draft, D.T., P.D. and M.S.; writing—review and editing, C.P., M.C., G.P. and M.S.; supervision, C.P., M.C. and M.S.; software, D.T. and P.D.; formal analysis, L.T., M.O., C.C., G.C. and C.M. (Camilla Mandorino); data curation, A.M., C.M. (Camilla Mandorino), C.C. and M.O.; visualization, A.M. and C.M. (Camilla Mandorino). All authors have read and agreed to the published version of the manuscript.

Funding

This work was partly supported by: ELIXIR-IT through the empowering project ELIXIRNextGenIT (Grant Code IR0000010 to G.P.); Ministero della Transizione Ecologica-Direzione Generale Economia Circolare through the project GreenChemBioDEP (Grant Code H93C22000380001).

Data Availability Statement

All sequence data are publicly available at NCBI under the GenBank accession number GCA_034427735.1. All data generated or analyzed during this study are included in Section 3 (Results) or in Supplementary Materials of this paper. Scripts and auxiliary files generated for the current study are available at Zenodo in the repository at https://zenodo.org/records/13152277 (accessed date: 1 August 2024).

Acknowledgments

We thank Vito Emanuele Carofiglio (EggPlant s.r.l.), Domenico Centrone (EggPlant s.r.l.) and Luca Sconosciuto (EggPlant s.r.l.) for providing the A. lata strain H1 (DSM1123).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Priyadarshini, R.; Palanisami, T.; Pugazhendi, A.; Gnanamani, A.; Parthiba Karthikeyan, O. Editorial: Plastic to Bioplastic (P2BP): A Green Technology for Circular Bioeconomy. Front. Microbiol. 2022, 13, 851045. [Google Scholar] [CrossRef]
  2. Zaman, A.; Newman, P. Plastics: Are they part of the zero-waste agenda or the toxic-waste agenda? Sustain. Earth 2021, 4, 4. [Google Scholar] [CrossRef]
  3. Bhavsar, P.; Bhave, M.; Webb, H.K. Solving the plastic dilemma: The fungal and bacterial biodegradability of polyurethanes. World J. Microbiol. Biotechnol. 2023, 39, 122. [Google Scholar] [CrossRef]
  4. Pandey, P.; Dhiman, M.; Kansal, A.; Subudhi, S.P. Plastic waste management for sustainable environment: Techniques and approaches. Waste Dispos. Sustain. Energy 2023, 5, 205–222. [Google Scholar] [CrossRef]
  5. Rosenboom, J.G.; Langer, R.; Traverso, G. Bioplastics for a circular economy. Nat. Rev. Mater. 2022, 7, 117–137. [Google Scholar] [CrossRef]
  6. Madison, L.L.; Huisman, G.W. Metabolic engineering of poly(3-hydroxyalkanoates): From DNA to plastic. Microbiol. Mol. Biol. Rev. 1999, 63, 21–53. [Google Scholar] [CrossRef] [PubMed]
  7. Obruca, S.; Dvorak, P.; Sedlacek, P.; Koller, M.; Sedlar, K.; Pernicova, I.; Safranek, D. Polyhydroxyalkanoates synthesis by halophiles and thermophiles: Towards sustainable production of microbial bioplastics. Biotechnol. Adv. 2022, 58, 107906. [Google Scholar] [CrossRef]
  8. Obruca, S.; Sedlacek, P.; Slaninova, E.; Fritz, I.; Daffert, C.; Meixner, K.; Sedrlova, Z.; Koller, M. Novel unexpected functions of PHA granules. Appl. Microbiol. Biotechnol. 2020, 104, 4795–4810. [Google Scholar] [CrossRef] [PubMed]
  9. Zhuikov, V.A.; Akoulina, E.A.; Chesnokova, D.V.; Wenhao, Y.; Makhina, T.K.; Demyanova, I.V.; Zhuikova, Y.V.; Voinova, V.V.; Belishev, N.V.; Surmenev, R.A.; et al. The Growth of 3T3 Fibroblasts on PHB, PLA and PHB/PLA Blend Films at Different Stages of Their Biodegradation In Vitro. Polymers 2020, 13, 108. [Google Scholar] [CrossRef] [PubMed]
  10. Kuang, Z.Y.; Yang, H.; Shen, S.W.; Lin, Y.N.; Sun, S.W.; Neureiter, M.; Yue, H.T.; Ye, J.W. Bio-conversion of organic wastes towards polyhydroxyalkanoates. Biotechnol. Notes 2023, 4, 118–126. [Google Scholar] [CrossRef]
  11. McAdam, B.; Brennan Fournet, M.; McDonald, P.; Mojicevic, M. Production of Polyhydroxybutyrate (PHB) and Factors Impacting Its Chemical and Mechanical Characteristics. Polymers 2020, 12, 2908. [Google Scholar] [CrossRef] [PubMed]
  12. Reinecke, F.; Steinbuchel, A. Ralstonia eutropha strain H16 as model organism for PHA metabolism and for biotechnological production of technically interesting biopolymers. J. Mol. Microbiol. Biotechnol. 2009, 16, 91–108. [Google Scholar] [CrossRef] [PubMed]
  13. Pena, C.; Castillo, T.; Garcia, A.; Millan, M.; Segura, D. Biotechnological strategies to improve production of microbial poly-(3-hydroxybutyrate): A review of recent research work. Microb. Biotechnol. 2014, 7, 278–293. [Google Scholar] [CrossRef]
  14. Wang, B.; Sharma-Shivappa, R.R.; Olson, J.W.; Khan, S.A. Upstream process optimization of polyhydroxybutyrate (PHB) by Alcaligenes latus using two-stage batch and fed-batch fermentation strategies. Bioprocess. Biosyst. Eng. 2012, 35, 1591–1602. [Google Scholar] [CrossRef]
  15. Rehm, B.H. Polyester synthases: Natural catalysts for plastics. Biochem. J. 2003, 376, 15–33. [Google Scholar] [CrossRef]
  16. Tan, I.K.P.; Foong, C.P.; Tan, H.T.; Lim, H.; Zain, N.A.; Tan, Y.C.; Hoh, C.C.; Sudesh, K. Polyhydroxyalkanoate (PHA) synthase genes and PHA-associated gene clusters in Pseudomonas spp. and Janthinobacterium spp. isolated from Antarctica. J. Biotechnol. 2020, 313, 18–28. [Google Scholar] [CrossRef]
  17. Brigham, C.J.; Reimer, E.N.; Rha, C.; Sinskey, A.J. Examination of PHB Depolymerases in Ralstonia eutropha: Further Elucidation of the Roles of Enzymes in PHB Homeostasis. AMB Express 2012, 2, 26. [Google Scholar] [CrossRef] [PubMed]
  18. Kutralam-Muniasamy, G.; Marsch, R.; Perez-Guevara, F. Investigation on the Evolutionary Relation of Diverse Polyhydroxyalkanoate Gene Clusters in Betaproteobacteria. J. Mol. Evol. 2018, 86, 470–483. [Google Scholar] [CrossRef]
  19. Zhao, H.; Wei, H.; Liu, X.; Yao, Z.; Xu, M.; Wei, D.; Wang, J.; Wang, X.; Chen, G.Q. Structural Insights on PHA Binding Protein PhaP from Aeromonas hydrophila. Sci. Rep. 2016, 6, 39424. [Google Scholar] [CrossRef]
  20. Little, G.T.; Ehsaan, M.; Arenas-Lopez, C.; Jawed, K.; Winzer, K.; Kovacs, K.; Minton, N.P. Complete Genome Sequence of Cupriavidus necator H16 (DSM 428). Microbiol. Resour. Announc. 2019, 8. [Google Scholar] [CrossRef] [PubMed]
  21. Pohlmann, A.; Fricke, W.F.; Reinecke, F.; Kusian, B.; Liesegang, H.; Cramm, R.; Eitinger, T.; Ewering, C.; Potter, M.; Schwartz, E.; et al. Genome sequence of the bioplastic-producing “Knallgas” bacterium Ralstonia eutropha H16. Nat. Biotechnol. 2006, 24, 1257–1262. [Google Scholar] [CrossRef]
  22. Slater, S.; Houmiel, K.L.; Tran, M.; Mitsky, T.A.; Taylor, N.B.; Padgette, S.R.; Gruys, K.J. Multiple beta-ketothiolases mediate poly(beta-hydroxyalkanoate) copolymer synthesis in Ralstonia eutropha. J. Bacteriol. 1998, 180, 1979–1987. [Google Scholar] [CrossRef] [PubMed]
  23. Choi, J.I.; Lee, S.Y.; Han, K. Cloning of the Alcaligenes latus polyhydroxyalkanoate biosynthesis genes and use of these genes for enhanced production of Poly(3-hydroxybutyrate) in Escherichia coli. Appl. Environ. Microbiol. 1998, 64, 4897–4903. [Google Scholar] [CrossRef]
  24. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, J.; Kobert, K.; Flouri, T.; Stamatakis, A. PEAR: A fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics 2014, 30, 614–620. [Google Scholar] [CrossRef] [PubMed]
  26. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. A J. Comput. Mol. Cell Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
  27. Tatusova, T.; DiCuccio, M.; Badretdin, A.; Chetvernin, V.; Nawrocki, E.P.; Zaslavsky, L.; Lomsadze, A.; Pruitt, K.D.; Borodovsky, M.; Ostell, J. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res. 2016, 44, 6614–6624. [Google Scholar] [CrossRef]
  28. McGinnis, S.; Madden, T.L. BLAST: At the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 2004, 32, W20–W25. [Google Scholar] [CrossRef]
  29. Couvin, D.; Bernheim, A.; Toffano-Nioche, C.; Touchon, M.; Michalik, J.; Neron, B.; Rocha, E.P.C.; Vergnaud, G.; Gautheret, D.; Pourcel, C. CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins. Nucleic Acids Res. 2018, 46, W246–W251. [Google Scholar] [CrossRef] [PubMed]
  30. Grant, J.R.; Enns, E.; Marinier, E.; Mandal, A.; Herman, E.K.; Chen, C.Y.; Graham, M.; Van Domselaar, G.; Stothard, P. Proksee: In-depth characterization and visualization of bacterial genomes. Nucleic Acids Res. 2023, 51, W484–W492. [Google Scholar] [CrossRef] [PubMed]
  31. Lee, I.; Kim, Y.O.; Park, S.C.; Chun, J. OrthoANI: An improved algorithm and software for calculating average nucleotide identity. Int. J. Syst. Evol. Microbiol. 2016, 66, 1100–1103. [Google Scholar] [CrossRef]
  32. Meier-Kolthoff, J.P.; Carbasse, J.S.; Peinado-Olarte, R.L.; Goker, M. TYGS and LPSN: A database tandem for fast and reliable genome-based classification and nomenclature of prokaryotes. Nucleic Acids Res. 2022, 50, D801–D807. [Google Scholar] [CrossRef]
  33. Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Soding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [PubMed]
  34. Waterhouse, A.M.; Procter, J.B.; Martin, D.M.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef]
  35. Qi, Q.; Kamruzzaman, M.; Iredell, J.R. The higBA-Type Toxin-Antitoxin System in IncC Plasmids Is a Mobilizable Ciprofloxacin-Inducible System. mSphere 2021, 6, e0042421. [Google Scholar] [CrossRef] [PubMed]
  36. Qiu, J.; Zhai, Y.; Wei, M.; Zheng, C.; Jiao, X. Toxin-antitoxin systems: Classification, biological roles, and applications. Microbiol. Res. 2022, 264, 127159. [Google Scholar] [CrossRef] [PubMed]
  37. Boss, L.; Gorniak, M.; Lewanczyk, A.; Morcinek-Orlowska, J.; Baranska, S.; Szalewska-Palasz, A. Identification of Three Type II Toxin-Antitoxin Systems in Model Bacterial Plant Pathogen Dickeya dadantii 3937. Int. J. Mol. Sci. 2021, 22, 5932. [Google Scholar] [CrossRef] [PubMed]
  38. Hampton, H.G.; Jackson, S.A.; Fagerlund, R.D.; Vogel, A.I.M.; Dy, R.L.; Blower, T.R.; Fineran, P.C. AbiEi Binds Cooperatively to the Type IV abiE Toxin-Antitoxin Operator Via a Positively-Charged Surface and Causes DNA Bending and Negative Autoregulation. J. Mol. Biol. 2018, 430, 1141–1156. [Google Scholar] [CrossRef] [PubMed]
  39. Mogro, E.G.; Cafiero, J.H.; Lozano, M.J.; Draghi, W.O. The phylogeny of the genus Azohydromonas supports its transfer to the family Comamonadaceae. Int. J. Syst. Evol. Microbiol. 2022, 72, 005234. [Google Scholar] [CrossRef] [PubMed]
  40. Barco, R.A.; Garrity, G.M.; Scott, J.J.; Amend, J.P.; Nealson, K.H.; Emerson, D. A Genus Definition for Bacteria and Archaea Based on a Standard Genome Relatedness Index. mBio 2020, 11, e02475-19. [Google Scholar] [CrossRef]
  41. Richter, M.; Rossello-Mora, R. Shifting the genomic gold standard for the prokaryotic species definition. Proc. Natl. Acad. Sci. USA 2009, 106, 19126–19131. [Google Scholar] [CrossRef] [PubMed]
  42. Devi, V.; Harjai, K.; Chhibber, S. CRISPR-Cas systems: Role in cellular processes beyond adaptive immunity. Folia Microbiol. 2022, 67, 837–850. [Google Scholar] [CrossRef] [PubMed]
  43. Wan, J.H.; Ng, L.M.; Neoh, S.Z.; Kajitani, R.; Itoh, T.; Kajiwara, S.; Sudesh, K. Complete genome sequence of Aquitalea pelogenes USM4 (JCM19919), a polyhydroxyalkanoate producer. Arch. Microbiol. 2023, 205, 66. [Google Scholar] [CrossRef]
  44. Zain, N.A.; Ng, L.M.; Foong, C.P.; Tai, Y.T.; Nanthini, J.; Sudesh, K. Complete Genome Sequence of a Novel Polyhydroxyalkanoate (PHA) Producer, Jeongeupia sp. USM3 (JCM 19920) and Characterization of Its PHA Synthases. Curr. Microbiol. 2020, 77, 500–508. [Google Scholar] [CrossRef]
  45. Xie, C.H.; Yokota, A. Reclassification of Alcaligenes latus strains IAM 12599T and IAM 12664 and Pseudomonas saccharophila as Azohydromonas lata gen. nov., comb. nov., Azohydromonas australica sp. nov. and Pelomonas saccharophila gen. nov., comb. nov., respectively. Int. J. Syst. Evol. Microbiol. 2005, 55, 2419–2425. [Google Scholar] [CrossRef] [PubMed]
  46. Mandal, M.; Roy, A.; Mitra, D.; Sarkar, A. Possibilities and prospects of bioplastics production from agri-waste using bacterial communities: Finding a silver-lining in waste management. Curr. Res. Microb. Sci. 2024, 7, 100274. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Circular map of the candidate plasmid generated with the web-based implementation of Proksee. Orange: CDS univocally annotated by PGAP; gray: CDS without a predicted function; blue: predicted transposases; green: TA system-inferred proteins.
Figure 1. Circular map of the candidate plasmid generated with the web-based implementation of Proksee. Orange: CDS univocally annotated by PGAP; gray: CDS without a predicted function; blue: predicted transposases; green: TA system-inferred proteins.
Microorganisms 13 00137 g001
Figure 2. Linear representation of the transposes localized on the megaplasmid. The red line corresponds to the plasmid reported in a linearized fashion while the blue bars spanning above are the projections of the predicted transposases on the plasmid. The potential cluster of transposases is visible in the last quarter (from 310 kbp to 410 kbp) of the plasmid from the IS21 family transposase (left side) to the ISL3 family transposase (right side).
Figure 2. Linear representation of the transposes localized on the megaplasmid. The red line corresponds to the plasmid reported in a linearized fashion while the blue bars spanning above are the projections of the predicted transposases on the plasmid. The potential cluster of transposases is visible in the last quarter (from 310 kbp to 410 kbp) of the plasmid from the IS21 family transposase (left side) to the ISL3 family transposase (right side).
Microorganisms 13 00137 g002
Figure 3. Heatmap of the ANI values. The heatmap is calculated by OrthoAniU between each pair of Azohydromonas isolates assemblies, including self-comparison (main diagonal). Darker shades of the color indicate higher ANI values. Accession numbers are listed in Table S1.
Figure 3. Heatmap of the ANI values. The heatmap is calculated by OrthoAniU between each pair of Azohydromonas isolates assemblies, including self-comparison (main diagonal). Darker shades of the color indicate higher ANI values. Accession numbers are listed in Table S1.
Microorganisms 13 00137 g003
Figure 4. Heatmap of the dDDH values. The heatmap has been computed using the Genome-to-Genome Distance Calculator (GGDC-3.0) with recommended settings between each pair of Azohydromonas isolates assemblies. Self-comparison is on the main diagonal and a darker color suggests higher dDDH values. Accession numbers are listed in Table S1.
Figure 4. Heatmap of the dDDH values. The heatmap has been computed using the Genome-to-Genome Distance Calculator (GGDC-3.0) with recommended settings between each pair of Azohydromonas isolates assemblies. Self-comparison is on the main diagonal and a darker color suggests higher dDDH values. Accession numbers are listed in Table S1.
Microorganisms 13 00137 g004
Figure 5. Heatmap of blastp sequence similarity analysis among collection of representative PhaCs classes (I–V). Darker shades of the color mark higher identity values. Self-comparison occupies the main diagonal.
Figure 5. Heatmap of blastp sequence similarity analysis among collection of representative PhaCs classes (I–V). Darker shades of the color mark higher identity values. Self-comparison occupies the main diagonal.
Microorganisms 13 00137 g005
Figure 6. Portion of the MSA of candidate PhaC proteins computed by the online version of Clustal Omega and visualized with JalViewer. Colored columns are the 8 conserved residues. Residues of the catalytic triad are highlighted with red stars on the top of the corresponding column.
Figure 6. Portion of the MSA of candidate PhaC proteins computed by the online version of Clustal Omega and visualized with JalViewer. Colored columns are the 8 conserved residues. Residues of the catalytic triad are highlighted with red stars on the top of the corresponding column.
Microorganisms 13 00137 g006
Table 1. General features of the genome.
Table 1. General features of the genome.
Feature Chromosome(s) Megaplasmid
Size (bp)7,328,099456,680
G + C ratio (%)68.765.6
Percentage coding88.2481.41
tRNA560
rRNA 5S, 16S, 23S1, 3, 20
Transposases3316
Total number of CDSs6537408
No. of CDSs with assigned function5633300
CDSs with unknown function904108
Table 2. Predicted transposases.
Table 2. Predicted transposases.
Transposase Family Chromosome(s) Plasmid
Tn321
IS11014
Transposase113
IS511
IS2113
ISL332
IS311
IS6661
IS63070
Table 3. TA systems predicted to be on the megaplasmid.
Table 3. TA systems predicted to be on the megaplasmid.
Locus Tag Product
SM757_01580 *type II TA system RelE/ParE toxin
SM757_01585 *HigA addiction module antitoxin
SM757_01810 **type II TA system VapB antitoxin
SM757_01815 **type II TA system RelE/ParE toxin
SM757_01820 **HigA addiction module antitoxin
SM757_01845type IV TA system AbiEi antitoxin
* system II-A. ** system II-B.
Table 4. Regions putatively encoding for resistance proteins.
Table 4. Regions putatively encoding for resistance proteins.
Locus TagAccession of ContigProduct
SM757_03450JAXOJX010000003.1chromate resistance protein
SM757_03465JAXOJX010000003.1chromate resistance protein
SM757_03785JAXOJX010000003.1cobalt–zinc–cadmium resistance protein
SM757_03940JAXOJX010000003.1ArsI/CadI family heavy metal resistance metalloenzyme
SM757_05070JAXOJX010000004.1chromate resistance protein
SM757_05525JAXOJX010000005.1TerB tellurite resistance protein
SM757_12920JAXOJX010000019.1glyoxalase/bleomycin resistance/dioxygenase protein
SM757_19280JAXOJX010000033.1TerB tellurite resistance protein
SM757_22515JAXOJX010000042.1organic hydroperoxide resistance protein
SM757_24300JAXOJX010000049.1TerB tellurite resistance protein
SM757_24860JAXOJX010000051.1TerB tellurite resistance protein
Table 5. PHA-related functions predicted in the genome.
Table 5. PHA-related functions predicted in the genome.
ALH1
Locus Tag
ORF LengthCONTIGALH1 Predicted FunctionOrthologous
Locus Tag Gene(s) Function
SM757_223301611JAXOJX010000042 *class I poly(R)-hydroxyalkanoic acid synthaseH16_A1437phaC1Poly(3-hydroxybutyrate) polymerase
SM757_056251752JAXOJX010000005class I poly(R)-hydroxyalkanoic acid synthaseH16_A1437phaC1Poly(3-hydroxybutyrate) polymerase
SM757_290101884JAXOJX010000076poly-beta-hydroxybutyrate polymerase N-terminal domain-containing proteinH16_A2003phaC2Poly(3-hydroxybutyrate) polymerase
SM757_267101767JAXOJX010000060alpha/beta fold hydrolaseH16_A2003phaC2Poly(3-hydroxybutyrate) polymerase
SM757_223351179JAXOJX010000042 *acetyl-CoA C-acetyltransferaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_284851185JAXOJX010000072beta-ketothiolase BktBH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_007451185JAXOJX010000001acetyl-CoA C-acyltransferaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_277651209JAXOJX010000067acetyl-CoA C-acyltransferaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_198201179JAXOJX010000035acetyl-CoA C-acyltransferaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_226101185JAXOJX010000043acetyl-CoA C-acyltransferaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_244351215JAXOJX0100000493-oxoadipyl-CoA thiolaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_070351206JAXOJX0100000073-oxoadipyl-CoA thiolaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_095051206JAXOJX0100000123-oxoadipyl-CoA thiolaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_091551206JAXOJX0100000113-oxoadipyl-CoA thiolaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_011401176JAXOJX010000001thiolaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_316451206JAXOJX0100000983-oxoadipyl-CoA thiolaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_195401203JAXOJX010000034acetyl-CoA C-acyltransferaseH16_A1438phaAAcetyl-CoA acetyltransferase
SM757_22340738JAXOJX010000042 *acetoacetyl-CoA reductaseH16_A1439;
H16_A2002;
H16_A2171
phaB1;
phaB2;
phaB3
Acetoacetyl-CoA reductase
SM757_08215750JAXOJX0100000093-oxoacyl-ACP reductase FabGH16_A1439;
H16_A2002;
H16_A2171
phaB1;
phaB2;
phaB3
Acetoacetyl-CoA reductase
SM757_31855741JAXOJX0100001003-oxoacyl-ACP reductase FabGH16_A1439;
H16_A2002;
H16_A2171
phaB1;
phaB2;
phaB3
Acetoacetyl-CoA reductase
SM757_23050747JAXOJX0100000443-oxoacyl-ACP reductase FabGH16_A2002;
H16_A2171
phaB2;
phaB3
Acetoacetyl-CoA reductase
SM757_086001344JAXOJX010000010polyhydroxyalkanoate depolymeraseH16_A1150;
H16_A2862;
H16_B0339;
H16_B1014
phaZ1;
phaZ2;
phaZ3;
phaZ5
intracellular poly(3-hydroxybutyrate
SM757_159801002JAXOJX010000025PHB depolymerase family esteraseH16_B2401phaZ7Poly(3-hydroxybutyrate) depolymeras
SM757_266952253JAXOJX0100000603-hydroxybutyrate oligomer hydrolase proteinH16_A2251phaY1D-(−)-3-hydroxybutyrate hydrolase
SM757_23895870JAXOJX010000047alpha/beta hydrolaseH16_A1335phaY2D-(−)-3-hydroxybutyrate hydrolase
SM757_26850558JAXOJX010000062phasin family proteinH16_A1381phaP1Phasin (PHA-granule associated protein)
SM757_25825594JAXOJX010000056polyhydroxyalkanoate synthesis repressor PhaRH16_A1440phaRtranscriptional regulator
* phaCAB operon.
Table 6. Nucleotide identity among phaC from Choi et al. and Azohydromonas phaC genes.
Table 6. Nucleotide identity among phaC from Choi et al. and Azohydromonas phaC genes.
Genus or Species (Strain)Identity (%)Alignment LengthMismatchesE-Value
australica (DMS1124)100.000161100.0
Uncultured Azohydromonas sp.94.7271612830.0
aeria (CFCC 13393)91.64616161280.0
lata (NBRC102462)90.62716111510.0
lata (H1)90.50316111530.0
caseinilytica (G-1-1-1-4)90.52616151450.0
sediminis (SYSU G00080)80.45516272800.0
Calidifontimicrobium sp. (SYSU G02091)80.08616272860.0
Table 7. Nucleotide identity among phaA from Choi et al. and Azohydromonas phaA genes.
Table 7. Nucleotide identity among phaA from Choi et al. and Azohydromonas phaA genes.
Genus or Species (Strain)Identity (%)Alignment LengthMismatchesE-Value
australica (DMS1124)100.0033700.0
Uncultured Azohydromonas sp.96.7771179380.0
caseinilytica (G-1-1-1-4)96.4381179420.0
lata (NBRC 102462)92.8811180820.0
lata (H1)92.3731180880.0
sediminis (YIM 73032)84.33811871700.0
sediminis (SYSU G00080)84.23311861730.0
Calidifontimicrobium sp. (SYSU G02091)83.82511871760.0
aeria (CFCC 13393)80.086128160
Table 8. Nucleotide identity among phaB from Choi et al. and Azohydromonas phaB genes.
Table 8. Nucleotide identity among phaB from Choi et al. and Azohydromonas phaB genes.
Genus or Species (Strain; Accession)Identity (%)Alignment LengthMismatchesE-Value
caseinilytica (G-1-1-1-4)94.851738380.0
aeria (CFCC13393; WP_157271469.1_7046)94.580738400.0
australica (DSM 1124)94.309738420.0
aeria (CFCC13393; WP_157272394.1_2294)94.038738440.0
lata (H1)93.496738480.0
lata (NBRC 102462)93.360738490.0
Calidifontimicrobium sp. (SYSU G02091)84.4097441040.0
sediminis (SYSU G00080)84.4307451020.0
sediminis (YIM 73032)84.1617451040.0
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Traversa, D.; Pazzani, C.; D’Addabbo, P.; Trisolini, L.; Chiara, M.; Oliva, M.; Marzella, A.; Mandorino, C.; Calia, C.; Chimienti, G.; et al. De Novo Assembly of the Polyhydroxybutyrate (PHB) Producer Azohydromonas lata Strain H1 Genome and Genomic Analysis of PHB Production Machinery. Microorganisms 2025, 13, 137. https://doi.org/10.3390/microorganisms13010137

AMA Style

Traversa D, Pazzani C, D’Addabbo P, Trisolini L, Chiara M, Oliva M, Marzella A, Mandorino C, Calia C, Chimienti G, et al. De Novo Assembly of the Polyhydroxybutyrate (PHB) Producer Azohydromonas lata Strain H1 Genome and Genomic Analysis of PHB Production Machinery. Microorganisms. 2025; 13(1):137. https://doi.org/10.3390/microorganisms13010137

Chicago/Turabian Style

Traversa, Daniele, Carlo Pazzani, Pietro D’Addabbo, Lucia Trisolini, Matteo Chiara, Marta Oliva, Angelo Marzella, Camilla Mandorino, Carla Calia, Guglielmina Chimienti, and et al. 2025. "De Novo Assembly of the Polyhydroxybutyrate (PHB) Producer Azohydromonas lata Strain H1 Genome and Genomic Analysis of PHB Production Machinery" Microorganisms 13, no. 1: 137. https://doi.org/10.3390/microorganisms13010137

APA Style

Traversa, D., Pazzani, C., D’Addabbo, P., Trisolini, L., Chiara, M., Oliva, M., Marzella, A., Mandorino, C., Calia, C., Chimienti, G., Manzari, C., Pesole, G., & Scrascia, M. (2025). De Novo Assembly of the Polyhydroxybutyrate (PHB) Producer Azohydromonas lata Strain H1 Genome and Genomic Analysis of PHB Production Machinery. Microorganisms, 13(1), 137. https://doi.org/10.3390/microorganisms13010137

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop