Genome-Informed Real-Time PCR Assay for Detection of ‘Candidatus Phytoplasma Prunorum,’ Which Is Associated with European Stone Fruit Yellows
Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL), Science and Technology (S&T), Plant Protection and Quarantine (PPQ), Animal and Plant Health Inspection Service (APHIS), United States Department of Agriculture (USDA), Laurel, MD 20708, USA
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(4), 929; https://doi.org/10.3390/microorganisms13040929
Submission received: 17 March 2025
/
Revised: 7 April 2025
/
Accepted: 8 April 2025
/
Published: 17 April 2025
(This article belongs to the Special Issue Phloem Localized Insect Transmitted Bacteria Associated with Plant Diseases)
Abstract
:‘Candidatus Phytoplasma prunorum’ has been associated with severe disease in Prunus spp., which are commodities of economic importance in the USA. The introduction and establishment of ‘Ca. P. prunorum’ in the USA could result in huge economic losses, thus creating a need for validated diagnostic tools, which are the cornerstone of successful surveillance, quarantine, and eradication measures. Whole-genome comparisons led to the identification of a diagnostic marker gene specific to ‘Ca. P. prunorum’ (PE639). The PE639 assay was duplexed with an 18S rDNA plant internal control and compared to modified 23S (phytoplasmas) and imp (‘Ca. P. mali’) assays. The PE639 assay produced congruent results to 23S and imp assays for all metrics, demonstrating high linearity, repeatability, intermediate precision, and reproducibility. The limit of detection was comparable for all assays tested, and all demonstrated 100% analytical specificity, selectivity, and diagnostic specificity for their respective target species. Assays metrics were consistent across two platforms, the ABI QuantStudio™ 5 and Bio-Rad CFX96™ OPUS. A synthetic gBlocks™ control was designed and validated to work with all assays, as well as conventional PCR assays targeting 16S rDNA and tuf genes. These validated assays and synthetic control represent beneficial tools that support efforts to protect USA agriculture and facilitate safe trade.
1. Introduction
Phytoplasmas of the apple proliferation group (16SrX) can be associated with severe disease in fruit trees of the Rosaceae family. The 16SrX group contains ‘Candidatus Phytoplasma mali’ (16SrX-A), which is associated with apple proliferation (AP), ‘Ca. P. prunorum’ (16SrX-F), which is associated with European stone fruit yellows (ESFY), and ‘Ca. P. pyri’ (16SrX-C), which is associated with pear decline (PD) [1,2]. The primary hosts for ‘Ca. P. mali’ and ‘Ca. P. pyri’ are Malus spp. and Pyrus spp., respectively. ‘Candidatus P. prunorum’ is also associated with several economically relevant diseases of Prunus spp., which are collectively referred to as ESFY and include diseases of apricots, Japanese plums, and peaches [3].
Apples and stone fruit are important commodities in the United States of America (USA). Between 2019 and 2022, the average production of apples in the USA was ~4.7M metric tons (tonnes), with an estimated value of ~USD 3.8B, while production of stone fruit (apricots, peaches, and plums) was ~1M tonnes, with an estimated value of ~USD 1.6B [4,5]. Both ‘Ca. P. prunorum’ and ‘Ca. P. mali’ have not been detected in the USA [6,7,8,9], while ‘Ca. P. pyri’ is reported to occur throughout North America [10,11]; ‘Ca. P. mali’ has been detected in North America in Nova Scotia, Canada [6,9]. Both ‘Ca. P. prunorum’ and ‘Ca. P. mali’ are considered quarantine pathogens by the USA and Canada, as introduction of these plant pests into the USA could have significant economic consequences.
Phytoplasmas can be spread through propagation practices; therefore, long-distance spread can occur by movement of infected propagative materials, including trade of infected rootstock, scion wood, or budwood. In addition, phytoplasmas have been found infecting alternative host species [2,3,12,13,14,15,16,17,18]. Cryptic infections in asymptomatic plants and/or alternative host species can facilitate unintended introduction of phytoplasmas into new areas. Controlling the disease and spread of these quarantine organisms requires accurate and rapid detection methods. Large-scale surveillance is necessary to identify possible introductions of ‘Ca. P. prunorum’ and ‘Ca. P. mali’ and to deploy management strategies quickly to eradicate the pathogens before they become established.
‘Candidatus Phytoplasma prunorum’ and ‘Ca. P. mali’ are USDA Animal and Plant Health Inspection Service (APHIS) Plant Protection and Quarantine (PPQ) Cooperative Agricultural Pest Survey (CAPS) Program priority pests. The CAPS Program Approved Method for Pest Surveillance for ‘Ca. P. prunorum’ and ‘Ca. P. mali’ involves collecting symptomatic plant tissue by visual survey (3031-General Visual Observation) and then sending samples to screening labs for molecular testing. The approved molecular screening assay was validated by the USDA APHIS PPQ Science and Technology Plant Pathogen Confirmatory Diagnostic Laboratory (S&T PPCDL) and is a real-time PCR assay designed to detect all phytoplasmas; it targets the 23S rDNA genes [19] and was modified to include a host plant 18S rDNA internal control [13].
As a result of host overlap with native phytoplasmas, species-specific detection is necessary to specifically identify these regulated pathogens. Real-time PCR is often preferred over conventional PCR (cPCR) for use as a screening tool due to its increased throughput, reduced and simplified steps, reduced time, and relatively straightforward data analysis. Real-time PCR assays for specific detection of ‘Ca. P. prunorum’ [20,21,22,23,24,25,26,27] and ‘Ca. P. mali’ [22,23,28,29,30,31,32,33,34] have been described previously in the literature. TaqMan-based real-time PCR is preferential to SYBR-based assays due to increased specificity and the ability to multiplex assays, particularly with a host internal control that can provide well-to-well assessment of sample extraction quality and reagent functionality. Many of the published assays are SYBR-based, and the majority of their targets are taxonomic markers (16S rRNA, internal transcribed spacer (ITS), ribosomal proteins (rpl22), and immunodominant membrane protein (imp)) that exist in all phytoplasmas and can be similar among the 16SrX group; an imp assay was validated and shown to be specific to ‘Ca. P. mali’ [34,35].
Recently, PPCDL sequenced and assembled draft genomes for two ‘Ca. P. prunorum’ strains (ESFY1 and LNS1), which are now available in the GenBank public database [36]. Given the availability of this new resource, the aim of this project was to develop and validate a screening tool by identifying a genome-informed diagnostic marker that can specifically detect ‘Ca. P. prunorum,’ to aid in surveillance and detection efforts to safeguard USA agriculture and facilitate safe trade. The imp assay for specific detection of ‘Ca. P. mali’ [34,35] and 23S rRNA assay [19] for general detection of phytoplasmas were also included in the validation testing performed in this study.
2. Materials and Methods
2.1. Strains, Plant Hosts, and DNA Extraction
DNA extracts for 32 phytoplasma strains, including 11 ‘Ca. P. prunorum’ and eight ‘Ca. P. mali’ strains, were acquired from various sources (Table 1); most were purchased from the EPPO-Q-bank Phytoplasma Collection at the University of Bologna, Italy. Additionally, 33 ‘Ca. Phytoplasma’-positive diagnostic samples from a variety of hosts were included in this study (Table 1). DNA was extracted using 200 mg of tissue and the DNeasy Plant Mini Kit (Qiagen, Germantown, MD, USA), with a modified protocol to include CTAB (cetyltrimethylammonium bromide) extraction buffer (Promega, Madison, WI, USA) and 2-mercaptoethanol instead of the kit-provided AP1 extraction buffer, or the DNeasy Plant Pro Kit (Qiagen). DNA from 60 additional organisms, comprising a few biocontrols and many pathogens affecting apples, pears, and stone fruit, were acquired from various providers and included in this study for exclusivity testing (Table 1).
Healthy leaf tissue from Asian pear (Pyrus pyrifoliae), apple (Malus domestica), European pear (Pyrus communis), apricot (Prunus armeniaca), cherry (Prunus avium), and Japanese plum (Prunus salicina) trees were provided by the USDA APHIS PPQ Plant Germplasm Quarantine Program (PGQP). Fresh strawberries (Fragaria × ananassa) (Driscoll’s, Watsonville, CA, USA) and freeze-dried strawberry fruit (Brothers All Natural, Rochester, NY, USA) were purchased from a local grocer. DNA was extracted from healthy plant tissue using the DNeasy Plant Mini Kit. DNA from peaches (Prunus persica) and plums (Prunus sp.) were provided by Y.K. Jo at Texas A&M University, and DNA for Asian pears (Pyrus pyrifoliae; var. Kosui, Kumoi, Hayatama and Tama) and Chinese pears (Pyrus ussuriensis; var. China and Mien Suan Li) were provided by N. Bassil and R. King at USDA ARS (Agricultural Research Service) National Clonal Germplasm Repository (NCGR) in Corvallis, Oregon.
2.2. Target Identification and Primer Design
Whole-genome sequences for ‘Ca. P. prunorum’ strain ESFY1 (JAZHCZ000000000.2) [36], ‘Ca. P. prunorum’ strain LNS1 (JAZHCY000000000.2) [36], aster yellows witches-broom phytoplasma strain AYWB (GenBank accession number CP000061.1) [38], ‘Ca. P. australiense’ (GenBank accession number AM422018.1) [39], ‘Ca. P. mali’ strain AT (CU469464.1) [40], ‘Ca. P. solani’ strain 284/09 (FO393427.1) [41], onion yellows phytoplasma strain OY-M (GenBank accession number AP006628.2) [42], and strawberry lethal yellows phytoplasma (CPA) strain NZSb11 (GenBank accession number CP002548.1) [43] were acquired from the National Center for Biotechnology Information (NCBI) GenBank. Genomes were annotated and compared to identify orthologous genes using the MicroScope Microbial Genome Annotation and Analysis Platform version 3.16.1 [44,45,46,47,48,49] under stringent parameters (80% amino-acid identity and 80% amino-acid alignment coverage).
Primers and probes were designed to the PE639 sequence using the PrimerQuest™ tool from Integrated DNA Technologies (IDT, Coralville, IA, USA) (https://www.idtdna.com/SciTools) [50] (accessed on 29 September 2023) and evaluated using NCBI Primer BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) [51] (accessed on 29 September 2023) to assess matches with non-targets, with default parameters. Primer and probe binding sites were mapped to the target sequence in Geneious Prime® 2023.0.4 [52], and the target amplicon was extracted and rescreened using NCBI BLASTn [51] (megablast and blastn with default parameters) to assess matches to non-targets; whole-genome shotgun contigs (wgs), core nucleotide (core_nt), Refseq Genome (refseq_genomes), and Refseq Reference Genome (refseq_reference_genomes) databases were queried. The PE639 primer and probe sequences are shown in Table 2.
A modified real-time PCR specific to ‘Ca. P. mali’ (a closely related 16SrX group phytoplasma) targeting the imp gene [34,35] was also included in this study, along with a modified real-time PCR assay targeting 23S rDNA for genus-level phytoplasma detection [19] (Table 2). Assay modifications included the use of different primer/probe concentrations, different fluorophore-quencher pairing, different master mix and reaction conditions, and inclusion of an internal control; each primer set was duplexed with an internal control (IC) primer set targeting 18S rDNA of plants [13] (Table 2). All assays are hereinafter referred to by their gene target names (PE639, imp, 23S, 18S, and 16S).
2.3. PCR Reaction Conditions
Duplex real-time PCR reactions contained 1X PerfeCTa® qPCR ToughMix® Low ROX™ (Quantabio, Beverly, MA, USA), a target and 18S IC primer/probe set (final concentrations presented in Table 2), and 2 µL of DNA template in a final reaction volume of 25 µL. Reactions were run in the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) according to the following cycling conditions: initial denaturation at 95°C for 2 min, followed by 40 cycles of 95°C for 5 s and 58°C for 40 s. A ramp rate of 1.60°C/s was used, and manual thresholds were set at 0.23 and 0.09 for the targets and 18S IC, respectively. Assays for ‘Ca. P. prunorum’ and ‘Ca. P. mali’ were also run in a CFX Opus Real-Time PCR System (Bio-Rad, Hercules, CA, USA) using the reaction conditions stated above. The 18S (ABY-QSY) fluorophore/quencher pair was changed to VIC-QSY (Applied Biosystems) and Cy3-IAbRQSp (Iowa Black® RQ; IDT) when duplexed with PE639 (‘Ca. P. prunorum’) and imp (‘Ca. P. mali’), respectively, to ensure compatibility with the CFX96 OPUS. The ‘Ca. P. mali’ assay was also run in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad) under the same parameters. Manual thresholds for the CFX96 instruments were set at 400 for FAM targets, and 350 and 50 for 18S ICs with VIC and Cy3, respectively. Modified 23S and imp assays showed equivalent or better performance to the original assays.
Semi-nested cPCR reactions for detection and identification of phytoplasmas contained 1X AccuStart II PCR SuperMix (Quantabio), 400 nM of each primer (P1/16S-SR for the 1st round; P1A 16S-SR for the 2nd round) (Table 2) [53,54], and 2 µL of DNA template in a final reaction volume of 50 µL. Reactions were run in the ProFlex PCR System (Applied Biosystems), or equivalent thermocycler, according to the following cycling conditions: initial denaturation at 95°C for 5 min, followed by 38 cycles of denaturing at 95°C for 15 s, annealing at 55°C for 30 s, and elongation at 72 °C for 90 s, and a final extension at 72°C for 4 min; maximum ramping was used. Amplicons from the 1st round were diluted 1:30 for use as a template for the 2nd round of the semi-nested cPCR.
Nested cPCR reactions for amplification of the tuf DNA barcode were carried out as published previously [55]. Alternatively, AccuStart II PCR SuperMix was used to replace the individual reagent components of the master mix. Reactions were 25 µL in volume and contained 1 µL of sample. Two sets of primer cocktails were used for each round of nested cPCR: Tuf340/Tuf890 for the 1st round and Tuf400/Tuf835 for the 2nd round (Supplementary Table S1). Reactions were run in the ProFlex PCR System, or equivalent thermocycler, according to the following cycling conditions: initial denaturation at 94°C for 3 min, followed by 35 cycles of denaturing at 94°C for 15 s, annealing at 54°C for 30 s, and elongation at 72°C for 1 min, and a final extension at 72°C for 7 min. Amplicons from the 1st round were diluted 1:30 for use as a template for the 2nd round of the nested cPCR.
2.4. Gel Electrophoresis and Sequencing
16S PCR products were analyzed using the 4200 TapeStation System, D5000 ScreenTape, D5000 DNA Ladder, D5000 Sample Buffer, and 4200 TapeStation Controller Software (version 5.1) (Agilent Technologies, Inc., Santa Clara, CA, USA), while tuf amplicons were analyzed using the D1000 ScreenTape, DNA Ladder, and Sample Buffer, according to manufacturer’s instructions. Amplicons were cleaned using ExoSAP-IT™ Express PCR Product Cleanup Reagent (Applied Biosystems), according to manufacturer’s instructions. Cleaned PCR products were sequenced using a SeqStudio™ Genetic Analyzer (Applied Biosystems), BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and BigDye XTerminator™ Purification Kit (Applied Biosystems), according to the manufacturer’s recommendations.
2.5. Synthetic Positive Control
A synthetic gBlocks™ (IDT) positive control was designed for use with all described PCR assays. As shown in Supplementary Figure S1, the synthetic positive control has a base sequence comprising 1793 bp of 16S from strawberry lethal yellows phytoplasma (CPA) str. NZSb11 (GenBank accession number CP002548) and contains all primer binding sites for the 16S semi-nested cPCR. The base sequence was modified to include phytoplasma 23S (149 bp) and plant 18S (68 bp) amplicons for real-time PCR by replacing the existing sequence; inclusion of 18S sequences as an internal control to simulate a plant host obviated the need to spike the control into plant host material/DNA. PE639 (139 bp) and imp (88 bp) amplicons for ‘Ca. P. prunorum’ and ‘Ca. P. mali,’ respectively, were also inserted by replacing existing base sequence. Additionally, tuf gene primer binding sites were inserted by replacing existing base sequence, allowing use of the synthetic control for tuf gene sequencing when trying to increase discrimination between closely related taxa. Two unique identifiers were incorporated into the synthetic gBlocks: (1) a 16S target region was intentionally replaced by the 23S target so that this control would test negative when using the assay described by Christensen et al. [13]; (2) base sequence was modified so that the translated amino acid sequence will read “APHIS*SCIENCE” when viewing the first frame. The complete 1793 bp sequence of synthetic gBlocks™ positive control is shown in Supplementary Table S2. The synthetic control was used at a concentration of 4 fg/µL; working stocks were made in TE buffer with 0.5 mg/mL polyadenylic acid (poly(A)) (Roche Diagnostics Deutschland, Mannheim, Germany).
2.6. Assay Validation Testing
Validation testing evaluated the analytical specificity and sensitivity, diagnostic specificity, repeatability, and reproducibility of the optimized diagnostic assays. DNA from ‘Ca. P. prunorum’ strains was used to determine analytical specificity, more specifically, inclusivity (Table 1). DNA extracted from healthy plant species, non-16SrX-F group phytoplasmas, and other pathogens of apples, pears, and stone fruit were used to assess exclusivity (selectivity) (Table 1). Diagnostic specificity was assessed using archived DNA extracted from diagnostic samples collected in the USA previously and determined positive for non-16SrX-F group phytoplasmas (Table 1); samples did not contain ‘Ca. P. prunorum’ DNA and were expected to produce negative results (FAM Ct = 0/Undetermined).
DNA extracted from ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 were diluted in healthy peach (Prunus persica) DNA initially to produce 23S-FAM Ct ~25; this was designated Dilution 0 (100). Ten-fold serial dilutions were then made to determine assay analytical sensitivity; dilutions were made in healthy peach (Prunus persica) DNA to achieve a constant 18S-ABY Ct ~20. The determined limit of detection (LoD) was further tested in different host backgrounds. Mock samples were produced by spiking DNA extracted from healthy apricots (Prunus armeniaca), cherries (Prunus avium), and Japanese plums (Prunus salicina) with DNA extracted from ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 at the LoD concentration.
Repeatability was assessed across the dilution series using data from a single operator (N = 3). Intermediate precision (N = 9) and reproducibility (N = 12) were evaluated using data from two additional operators from a different laboratory team at USDA APHIS PPQ S&T PPCDL. Pre-tested primers, probes, and positive controls were provided to participants, along with a copy of the testing protocol. Each participant tested serial dilutions of DNA extracted from ‘Ca. P. prunorum’ strain ESFY1 in healthy peach (Prunus persica) DNA; samples were tested in triplicate. A set of serial dilutions of ‘Ca. P. prunorum’ strain ESFY1 in healthy peach (Prunus persica) DNA and ‘Ca. P. mali’ strain C71 in healthy apple (Malus domestica) tested in the QuantStudio™ 5 instrument previously were used to validate the assays in the CFX96 OPUS (PE639 and imp assays) and CFX Touch (imp assay only).
3. Results
3.1. Target Identification
Based on the analysis described above, 115 genes were identified as being present in the two ‘Ca. P. prunorum’ strains and absent in the other ‘Ca. Phytoplasma’ species. Identified genes were checked for specificity in silico using NCBI BLASTn [51] (megablast and blastn with default parameters) to assess matches to non-targets; whole-genome shotgun contigs (wgs), core nucleotide (core_nt), Refseq Genome (refseq_genomes), and Refseq Reference Genome (refseq_reference_genomes) databases were queried. A 639 nt putative effector protein (MICFAM_ID 18335 [44,45,46,47,48,49], designated as PE639) was identified from these 115 genes as useful diagnostic marker, matching only to ‘Ca. P. prunorum’ sequences (locus tags V9D73_RS02055 and V9D86_RS01530 for ESFY1 and LNS1, respectively). Genome sequences for ‘Ca. P. prunorum’ strains ESFY1 and LNS1 were input into Geneious Prime® 2023.0.4 [52], and PE639 sequences were extracted, aligned, and showed 100% identity among strains.
3.2. Assay Sensitivity
The LoD was determined using serial dilutions of ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 in healthy peach (Prunus persica) DNA, including aggregate data from three operators and two instruments for ESFY1; PE639 assay data were compared to 23S assay data. On the QuantStudio™ 5, the LoD (lowest dilution with 100% positivity) was determined to be Dilution 3 (10−3) for ESFY1 and LNp, which corresponded to Ct values between 35 and 36 (Supplementary Table S3); the LoDs for PE639 and 23S were congruent. Based on previous results from testing serial dilutions of plasmids containing the 23S rRNA amplicon with the 23S assay, the LoD was calculated to be ~2–20 genome equivalent copies (data not presented). For LNS1, Ct values for corresponding dilutions were approximately 10-fold lower for PE639 when compared to 23S; the LoD for PE639 was Dilution 4 (10−4), while the LoD for 23S was Dilution 3 (10−3), both corresponding to Ct values between 34 and 36 (Supplementary Table S3). On the CFX96 OPUS, data for dilutions of ‘Ca. P. prunorum’ strain ESFY1 DNA revealed the same LoD as the QuantStudio™ 5 (Supplementary Table S4). Additional tests were performed to assess assay performance at the LoD using DNA from ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 spiked into DNA extracted from different hosts (Supplementary Table S5); the 23S assay was evaluated using LNS1 only. Data showed that PE639 can detect ‘Ca. P. prunorum’ DNA with 100% positivity at the LoD in a background of multiple other hosts (apricot, Japanese plum, and cherry). The IC produced Ct values within the expected Ct range for the 18S target for all tests.
Diagnostic samples may require sequence-based identification in addition to detection by real-time PCR. Therefore, cPCR for 16S and sequencing were performed on ESFY1 and LNS1 DNA at the LoD, as well as a 10-fold higher dilution (LoD−1), to determine if samples near the LoD (low-titer samples) can be confirmed by downstream methods. Control reactions included the synthetic gBlocks™ positive control and a no-template control (NTC). The results showed that appropriate bands (~1500 bp) were produced for all samples tested, including the synthetic positive control (Figure 1); no bands produced for the NTC. Amplicons for ESFY1 at LoD−1 were subjected to Sanger sequencing and high-quality sequence data were obtained. BLAST analysis revealed matches to ‘Ca. P. prunorum’ sequences with >99% identity and 100% query coverage, including a 99.44% identity match to the reference sequence from ‘Candidatus P. prunorum’ strain ESFY-G1 (GenBank accession number AJ542544). BLAST analysis also revealed matches to matches to ‘Ca. P. mali’ and ‘Ca. P. pyri’ sequences with less than 99% but greater than 98% identity and 100% query coverage; ‘Ca. P. mali’ and ‘Ca. P. pyri’ are closely related and represent subclades of the 16SrX group. The results demonstrate that low-titer samples around the LoD of the real-time assay can be confirmed with the semi-nested 16S cPCR and sequencing.
3.3. Assay Specificity
Specificity and selectivity were tested using DNA isolated from known ‘Ca. P. prunorum’ strains, as well as other non-16SrX-F group phytoplasmas, other pathogens commonly found on the same hosts, and healthy hosts. Validation of PE639 and imp targets revealed 100% analytical specificity for ‘Ca. P. prunorum’ and ‘Ca. P. mali,’ respectively, as all ‘Ca. P. prunorum’ and ‘Ca. P. mali’ strains produced positive results with their respective assays (Supplementary Tables S6 and S7). The 23S target also demonstrated 100% analytical specificity for ‘Ca. Phytoplasma,’ as all phytoplasma strains produced positive results (Supplementary Tables S6 and S7). The PE639, imp and 23S assays only amplified DNA from ‘Ca. P. prunorum,’ ‘Ca. P. mali,’ and ‘Ca. Phytoplasma,’ respectively (100% diagnostic specificity); no cross-reactions were observed for PE639 and imp with other phytoplasmas. Additionally, these three assays did not amplify DNA from 60 non-phytoplasmas, nor with 16 plant host DNA (100% selectivity). Tests performed to assess assay performance at the LoD in different host DNA backgrounds suggest host matrices do not have a negative impact on assay performance. A small-scale specificity test was performed using the CFX96 OPUS, and data corroborated assay specificity across two instruments.
3.4. Precision and Reproducibility
Repeatability was assessed using serial dilutions of DNA from ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 in healthy peach (Prunus persica) DNA (N = 3 per data point). The PE639 assay resulted in 100% repeatability (100% positive samples at ≥LoD) and a low coefficient of variation (<2% CV) (Supplementary Table S8). Intermediate precision was assessed using serial dilutions of ‘Ca. P. prunorum’ strain ESFY1 in healthy peach (Prunus persica) DNA. Dilutions were tested by three independent operators in different QuantStudio™ 5s (N = 9 per data point). The results demonstrated high intermediate precision, with a low average variance of 1.1% across multiple operators and QuantStudio™ 5s (Supplementary Table S9); calculations included only data from dilutions with 100% positivity. Reproducibility was assessed by accounting for data produced from three operators and two instruments (QuantStudio™ 5 and CFX OPUS) (N = 12 per data point) (Supplementary Table S10). The average variance across four 10-fold serial dilutions having 100% positivity was <1.2%. The IC produced Ct values within the expected Ct range for the 18S target for all dilutions and for all tests performed.
Reproducibility data for ‘Ca. P. prunorum’ strain ESFY1 and ‘Ca. P. mali’ strain C71, as well as repeatability data for ‘Ca. P. prunorum’ strains LNp and LNS1 and ‘Ca. P. mali’ strains P4 and P6, were used to generate linearity plots (Figure 2 and Supplementary Figure S2) and calculate reaction metrics (Supplementary Table S11). Data revealed high R2 values (>0.99) and amplifications efficiencies ≥~90% for all assays and for all strains tested (Supplementary Table S11); amplification efficiency varied depending on the strain tested. Linearity metrics were not determined for the 18S IC, as it targets host DNA, which was held constant in the diluent; all dilutions produced expected 18S IC Ct values. A linearity plot generated from data produced using only CFX96 OPUS data is shown in Supplementary Figure S3.
3.5. Synthetic Control
Serial dilutions of synthetic gBlocks™ positive control, from 4 pg/µL to 400 ag/µL, were tested using all assays in both the QuantStudio™ 5 and CFX96 OPUS. The data revealed the synthetic positive control tested positive with all assay targets (PE639, imp, 23S, and 18S) and for all dilutions. Based on the obtained data, 4 fg/µL was selected as the working dilution. The working dilution was subjected to multiple rounds of freeze–thaw and tested by three operators in the QuantStudio™ 5 using PE639 and 18S targets. The average variance among successive rounds of testing, following intervals of freeze–thaw, was <1% for individual operators (Supplementary Table S12). Additionally, variance (“total”) was calculated to account for all data per operator (N = 15), as well as all test data (N = 45); “total” variance was also <1%, suggesting good stability and high reproducibility. The working dilution after five rounds of freeze–thaw was able to produce a bright band by cPCR (Figure 1) and produce high-quality sequences. The “APHIS*SCIENCE” unique identifier was apparent during sequence analysis. The consensus sequence was also subjected to BLAST analysis. Due to the inclusion of additional targets and unique markers within the 16S base sequence, BLAST analysis revealed highest matches to strawberry lethal yellows phytoplasma (CPA) str. NZSb11, complete genome (GenBank accession number CP002548), and ‘Candidatus Phytoplasma australiense’ complete genome (GenBank accession number AM422018), both with 90.50% identity and 78% query coverage. The synthetic control working dilution was also subjected to nested tuf cPCR and produced bands of appropriate size for each and across both rounds of PCR (Supplementary Figure S4). Nested tuf amplicon sequences matched strawberry lethal yellows phytoplasma (CPA) str. NZSb11 and related phytoplasma 16S sequences (e.g., strawberry virescence phytoplasma isolate 3101 16S ribosomal RNA gene, partial sequence; GenBank accession number AY377868), as opposed to Elongation Factor Tu (tuf) sequence.
4. Discussion
‘Candidatus P. prunorum’ and ‘Ca. P. mali’ are associated with disease of several economically important USA crops. The movement of infected plant material is the most probable means of entry, and multiple open pathways of entry exist. These pathogens are part of USA surveillance programs, and given cryptic host species, asymptomatic carriers, and overlapping hosts, there is a critical need for a validated diagnostic tool able to detect and discriminate ‘Ca. P. prunorum’ and ‘Ca. P. mali’ from domestic phytoplasmas. In this study, PPCDL addressed this need by providing validated screening tools specific to ‘Ca. P. prunorum’ and ‘Ca. P. mali.’ A literature search was performed initially to find real-time PCR assays designed for specific detection of both pathogens that could be assed at PPCDL for regulatory screening.
Several real-time PCR assays were identified for specific detection of ‘Ca. P. mali’ [22,23,28,29,30,31,32,33,34]. All assays were TaqMan-based and selected for evaluation. During an initial small-scale specificity test containing three ‘Ca. P. mali’ strains (C71, P4 and P6), two ‘Ca. P. prunorum’ strains (ESFY1 and P1), and one ‘Ca. P. pyri’ strain (P3), 16S-based assays [28,29,30,31,32,33] produced positive amplification from ‘Ca. P. prunorum’ strains ESFY1 and P1, while the ITS-based assay [22,23] produced positive amplification from ‘Ca. P. prunorum’ strain ESFY1. The Ct values produced by the cross-reactions were congruent with those produced by the 23S assay [19] for corresponding samples, as well as those produced by true ‘Ca. P. mali,’ suggesting that the observed phenomenon was a true cross-reaction and not contamination. The 16S assay relied on only two and three SNPs (single-nucleotide polymorphisms) in the probe sequence to discriminate ‘Ca. P. mali’ from ‘Ca. P. prunorum’ and ‘Ca. P. pyri,’ respectively. The ITS assay relied on only three SNPs in the probe sequence to discriminate ‘Ca. P. mali’ from ‘Ca. P. prunorum.’ Protocols were followed as published, so it is unknown why these cross-reactions were observed. As a result, these assays were not investigated further, but the imp assay was validated fully [35].
Several real-time PCR assays were identified for specific detection of ‘Ca. P. prunorum’ [20,21,22,23,24,26,27,56,57]. The majority of these assays were SYBR-based, and differentiation among 16SrX phytoplasmas relied on a few SNPs. Attempts were made by PPCDL to design TaqMan probes to these target regions but were unsuccessful. Three assays were TaqMan-based, with two targeting the 16S rRNA gene [24,27] and one targeting ITS [22,23] regions. The ITS assay was the same as the ‘Ca. P. mali’ ITS assay, except that the probe was targeting the ‘Ca. P. prunorum’ sequence instead of the ‘Ca. P. mali’ sequence; discrimination was dependent on the same three SNPs in the probe. Based on cross-reactions observed with ‘Ca. P. prunorum’ when using the probe specific to ‘Ca. P. mali,’ it was assumed that similar cross-reactions would occur with ‘Ca. P. mali’ when using a probe specific to ‘Ca. P. prunorum.’ One 16S assay took the same approach, using the assay from Baric and Dalla-Via [32] and designing a new probe to ‘Ca. P. prunorum’ based on the same two SNPs. As cross-reactions were observed with the 16S assay for ‘Ca. P. mali,’ it was assumed that discrimination by same two SNPs would also produce cross-reactions. The previously published 16S assay [27] was not considered due to the lack of information regarding specificity data for inclusivity and exclusivity tests. Additionally, this described assay is a reverse-transcriptase real-time PCR assay targeting RNA instead of DNA, making it incompatible with the DNA extraction protocol employed currently in the USA for suspected phytoplasma diagnostic samples. Therefore, no published assays were pursued for full validation.
To fulfill the agency need for a validated diagnostic for specific detection of ‘Ca. P. prunorum,’ draft genomes for two ‘Ca. P. prunorum’ strains [36] were mined for diagnostic markers. Whole-genome comparisons between ‘Ca. P. prunorum’ and other ‘Ca. Phytoplasma’ species led to the identification of the PE639 gene as a unique target. A BLAST analysis of the PE639 amplicon revealed matches to only ‘Ca. P. prunorum’, and validation testing demonstrated 100% specificity. Late positive amplification with PE639 was observed with two strains of ‘Ca. P. mali’ (AP-15 and APxN) (Supplementary Tables S6 and S7). Amplicon sequencing was used to determine if the false results were from contamination. The 16S amplicons were sequenced using a MinION Flongle flow cell R10.4.1 (Oxford Nanopore Technologies, Oxford, UK) and live base calling. Quality-filtered reads were clustered against a custom database of phytoplasma genomes. Consensus sequences were built from each cluster and then classified using a BLASTn search against the same phytoplasma database. Analysis revealed the presence of ‘Ca. P. prunorum’ within these samples, suggesting contamination or coinfection. Contigs of ~1450 bp were assembled from these samples that matched Plum leptonecrosis phytoplasma strain LNp (GenBank accession number JQ868450) with 100% identity and 100% query coverage; query coverage was based on 1241 bp accession target length. These strains were used during initial screening of potential specific targets and primer sets. Two additional potentially specific targets were identified in this study, an 864 nt putative effector protein (designated as PE864) and a SAP09-like putative secreted protein (designated as SAP09); however, these were eliminated from further testing due to false cross-reactions with AP-15 and APxN, and only PE639 was pursued after the false contamination was identified. These two genes could be explored in the future as additional diagnostic markers.
The imp assay for specific detection of ‘Ca. P. mali’ was modified from the published version [34] and then validated fully [35]. In this study, the imp assay was validated for use with the CFX OPUS, which produced congruent results to the QuantStudio™ 5 and CFX Touch. Specificity was also checked against additional phytoplasmas, other pathogens commonly found on the same hosts, and healthy hosts. In Italy, ‘Ca. P. mali’ is present in the most important apple-growing areas, including Trentino-Alto Adige and Friuli Venezia Giulia. In the early 2000s, comparative diagnostic studies using survey samples from these regions identified strains of ‘Ca. P. mali’ that did not react with a monoclonal antibody-based ELISA (enzyme-linked immunosorbent assay) [58,59]. Immunoassays tend to target membrane proteins of bacteria and considering that the imp real-time PCR was targeting specific sequences in an outer membrane protein gene, this warranted investigation. Three of these atypical ‘Ca. P. mali’ strains (AP-1, AP-2, and AP-3) testing ELISA-negative were purchased from the EPPO-Q-bank at the University of Bologna for inclusion in this study. The imp assay demonstrated 100% specificity for ‘Ca. P. mali’ strains, including these three “atypical” strains, which produced positive amplification. However, while other strains produce similar imp and 23S Ct values, these atypical strains produced imp Ct values ~4–5 higher than 23S (Table S7). Amplicon sequencing was performed as described previously to determine if the presence of other phytoplasma was responsible for the lower relative 23S Ct values. These samples were found to contain only ‘Ca. P. mali,’ confirming results and demonstrating reduced sensitivity of the imp assay with these atypical strains, likely due to variation in the target sequence.
A synthetic gBlocksTM positive control was developed for use with all phytoplasma assays used in this study. Validation testing determined 4 fg/µL in TE buffer with 0.5 mg/mL poly(A) to be the optimal concentration, as reasonable Ct values were produced using this relatively low concentration, which helps prevent laboratory contamination; FAM Ct values of approximately 26, 32, and 27 for PE639, imp, and 23S, respectively, and ABY Ct values of 28 for all assays were observed. Stability testing over multiple rounds of freeze–thaw by multiple operators revealed extremely low variance. PCR using 16S and tuf primers were performed following the final freeze–thaw, and bands of appropriate size and intensity were produced. 16S amplicons produced sufficient sequence, and translation of the sequence in the appropriate reading frame revealed the unique identifier (APHIS*SCIENCE).
The design of the synthetic control facilitates its discrimination from native DNA by sequence analysis. Due to the inclusion of multiple target sequences into the control base sequence, BLAST analysis with the core nucleotide (core_nt) database returns highest matches to strawberry lethal yellows phytoplasma (CPA) str. NZSb11, complete genome (GenBank accession number CP002548), which was used for the base 16S sequence, and ‘Candidatus Phytoplasma australiense’ complete genome (GenBank accession number AM422018); both matched with 85.71% identity and 97% query coverage. BLAST analysis against the RefSeq Genome Database (refseq_genomes) and RefSeq Reference genomes (refseq_reference_genomes) revealed the highest matches to strain NZSb11 (GenBank accession number CP002548) with 85.71% identity and 97% query coverage and 90.5% identity and 82% query coverage, respectively. BLAST analysis against the whole-genome shotgun contigs (wgs) database returns the highest matches to various phytoplasmas with only 90% query coverage and <85% identity. When looking at graphic summary results in BLAST, alignments show gaps where target sequences were inserted and matched to the 23S sequence (usually pink in color) (Supplementary Figure S5), making identifying contamination by the internal control possible by simple BLAST analysis. BLAST analysis of tuf nested amplicons reveal matches to the 16S sequence, which was used as the base sequence for the control; this allows quick identification of the synthetic control by BLAST analysis of tuf sequence. This synthetic positive control benefits screening diagnostics by reducing the need for infected reference material by testing labs, providing confidence in results through use of appropriate controls, and by allowing a single positive control to be used with all validated PCR-based assays for phytoplasmas included in this study.
5. Conclusions
Overall, the PE639 and imp assays provide 100% specificity for ‘Ca. P. prunorum’ and ‘Ca. P. mali,’ respectively, along with high repeatability, reproducibility, and precision, comparable linearity and sensitivity to each other and the 23S assay, and reasonable price points. The cost per reaction for the PE639 and imp assays was calculated to be ~USD 0.98 and ~USD 0.92, respectively, based on the reagents and oligonucleotides used per reaction, plus a 20% increase to account for disposable supplies like tips, tubes, and gloves; this does not reflect operational costs. The cost of using the synthetic gBlocksTM positive control was also calculated. Based on rehydration and dilution to 4 fg/µL in 0.5 mg/mL poly(A) in TE buffer, the cost for every 1000 reactions was calculated to be ~USD 3.52; the largest contributing factor to cost was poly(A) (Table S13). The modified imp assay improves upon the published version [34] by including a plant internal control primer set, allowing quality control assessment of individual reactions [35]. The PE639, imp, and 23S assays can be run in parallel, as all assays were optimized for reactions to run under the exact same parameters, allowing for general detection of phytoplasmas and discrimination for ‘Ca. P. mali’ and ‘Ca. P. prunorum’ to happen during the same run, if needed. Additionally, the LoDs of all assays were congruent, and real-time results were confirmed by cPCR and sequencing. As with all assays, performance should be continuously monitored, especially regarding specificity, as new strains are known to arise over time.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms13040929/s1. Figure S1: Phytoplasma synthetic gBlocks™ positive control sequence with primer binding site annotations. Figure S2: Linear amplification plots for 10-fold serial dilutions of DNA from ‘Candidatus Phytoplasma prunorum’ strains LNp and LNS1 and ‘Ca. P. mali’ strains P4 and P5. Figure S3: Linear amplification plots for 10-fold serial dilutions from ‘Candidatus Phytoplasma prunorum’ strain ESFY1 and ‘Ca. P. mali’ strain C71 tested in the CFX OPUS. Figure S4: Gel image showing amplicons resulting from nested cPCR targeting the elongation factor Tu (tuf) gene of phytoplasmas using tuf primer cocktails. Figure S5: Examples of graphical summaries from BLAST analysis of the phytoplasma synthetic gBlocks™ positive control. Table S1: Elongation factor Tu (tuf) DNA barcode primers used in this study. Table S2: Nucleotide sequence of the synthetic gBlocks™ positive control for general phytoplasma detection and detection of ‘Candidatus Phytoplasma mali’ and ‘Ca. Phytoplasma prunorum’. Table S3: Limit of detection (LoD) for the PE639 and 23S assays based on testing 10-fold serial dilutions of ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 in healthy peach (Prunus persica) DNA on the QuantStudio™ 5 Real-Time PCR System. Table S4: Limit of detection (LoD) for the PE639 and 23S assays based on testing 10-fold serial dilutions of ‘Ca. P. prunorum’ strain ESFY1 in healthy peach (Prunus persica) DNA on the CFX96 OPUS Real-Time PCR Detection System. Table S5: Limit of detection (LoD) for the PE639 and 23S assays based on testing 10-fold serial dilutions of ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 in different host backgrounds on the QuantStudio™ 5 Real-Time PCR System. Table S6: Real-time PCR results for an inclusivity/exclusivity screen to determine assay specificity and selectivity (positive/negative). Table S7: Real-time PCR results for an inclusivity/exclusivity screen to determine assay specificity and selectivity (Ct value). Table S8: Repeatability data reflecting real-time PCR results for serial dilutions of DNA from ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 in healthy peach (Prunus persica) DNA tested by a single operator in a QuantStudio™ 5. Table S9: Intermediate precision data reflecting real-time PCR results for 10-fold serial dilutions serial dilutions of DNA from ‘Ca. P. prunorum’ strain ESFY1 in healthy peach (Prunus persica) DNA tested by three independent operators in different QuantStudio™ 5 instruments. Table S10: Reproducibility data reflecting real-time PCR results for 10-fold serial dilutions of DNA from ‘Ca. P. prunorum’ strain ESFY1 in healthy peach (Prunus persica) DNA tested by three independent operators and two different instruments (QuantStudio™ 5 and CFX OPUS). Table S11: Reaction metrics determined by testing serial dilutions of DNA from ‘Ca. P. prunorum’ strains ESFY1, LNp, and LNS1 with the PE639 and 23S assays, and ‘Ca. P. mali’ strains C71, P4, and P6 with the imp and 23S assays. Table S12: Data from stability testing of the synthetic gBlocks™ positive control working dilution (4 fg/µL) in TE buffer with 0.5 mg/mL polyadenylic acid (poly(A) using PE639 and 23S assays. Table S13: Cost calculation for the synthetic gBlocks control, not reflective of operational costs.
Author Contributions
Conceptualization, methodology, validation, formal analysis, and writing—original draft preparation, J.Y.-B.; writing—review and editing, J.Y.-B. and Y.R.; supervision, Y.R. All authors have read and agreed to the published version of the manuscript.
Funding
This work was made possible by intramural funding from the USDA APHIS Pest Detection Program.
Institutional Review Board Statement
Not Applicable.
Informed Consent Statement
Not Applicable.
Data Availability Statement
All relevant data are provided in the main document and Supplementary Materials.
Acknowledgments
The authors thank all those who provided DNA and samples for this study.
Conflicts of Interest
The authors declare no conflicts of interest.
General Disclaimer
The findings and conclusions in this publication are those of the author(s) and should not be construed to represent any official USDA or U.S. Government determination or policy.
Commercial Endorsement Disclaimer
Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.
References
- Marcone, C.; Jarausch, B.; Jarausch, W. Candidatus Phytoplasma prunorum, the causal agent of European stone fruit yellows: An overview. J. Plant Pathol. 2010, 92, 19–34. [Google Scholar]
- Seemüller, E.; Schneider, B. ‘Candidatus Phytoplasma mali’, ‘Candidatus Phytoplasma pyri’ and ‘Candidatus Phytoplasma prunorum’, the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively. Int. J. Syst. Evol. Microbiol. 2004, 54, 1217–1226. [Google Scholar] [CrossRef]
- Carraro, L.; Osler, R. European stone fruit yellows: A destructive disease in the mediterranean basin. In Virus and Virus-Like Diseases of Stone Fruits, with Particular Reference to the Mediterranean Region; Myrta, A., Di, T.B., Savino, V., Eds.; Options Méditerranéennes Série B; CIHEAM-IAMB: Valenzano, Italy, 2003; Volume 45, pp. 113–117. [Google Scholar]
- FAOSTAT. Value of Agricultural Production. Available online: https://www.fao.org/faostat/en/#data/QV (accessed on 16 December 2024).
- FAOSTAT. Crops and Livestock Products. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 16 December 2024).
- EPPO. ‘Candidatus Phytoplasma mali’ (PHYPMA). Available online: https://gd.eppo.int/taxon/PHYPMA (accessed on 5 February 2025).
- EPPO. ‘Candidatus Phytoplasma prunorum’ (PHYPPR). Available online: https://gd.eppo.int/taxon/PHYPPR (accessed on 5 February 2025).
- CABI. Phytoplasma Prunorum (Apricot Chlorotic Leafroll). Available online: https://www.cabidigitallibrary.org/doi/full/10.1079/cabicompendium.34065 (accessed on 5 February 2025).
- CABI. Phytoplasma Mali (Apple Proliferation). Available online: https://www.cabidigitallibrary.org/doi/10.1079/cabicompendium.6502 (accessed on 5 February 2025).
- CABI. Phytoplasma Pyri (Pear Decline). Available online: https://www.cabidigitallibrary.org/doi/10.1079/cabicompendium.44021 (accessed on 5 February 2025).
- EPPO. ‘Candidatus Phytoplasma pyri’ (PHYPPY). Available online: https://gd.eppo.int/taxon/PHYPPY (accessed on 5 February 2025).
- Carraro, L.; Loi, N.; Ermacora, P.; Osler, R. High tolerance of European plum varieties to plum leptonecrosis. Eur. J. Plant Pathol. 1998, 104, 141–145. [Google Scholar] [CrossRef]
- Christensen, N.M.; Nicolaisen, M.; Hansen, M.; Schulz, A. Distribution of phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Mol. Plant-Microbe Interact. 2004, 17, 1175–1184. [Google Scholar] [CrossRef]
- Del Serrone, P.; La Starza, S.; Krystai, L.; Kolber, M.; Barba, M. Occurrence of apple proliferation and pear decline phytoplasmas in diseased pear trees in Hungary. J. Plant Pathol. 1998, 80, 53–58. [Google Scholar]
- Lee, I.-M.; Bertaccini, A.; Vibio, M.; Gundersen, D.E. Detection of multiple phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopathology 1995, 85, 728–735. [Google Scholar] [CrossRef]
- Mall, S.; Kirdat, K.; Singh, A.; Tiwarekar, B.; Sathe, S.; Marcone, C.; Yadav, A. Updates on phytoplasma diseases associated with weeds acting as alternate hosts in Asian countries. In Phytoplasma Diseases of Major Crops, Trees, and Weeds; Tiwari, A.K., Caglayan, K., Hoat, T.X., Al Subhi, A., Nejat, N., Reddy, G., Eds.; Academic Press: Cambridge, MA, USA, 2023; Volume 2, pp. 347–365. [Google Scholar]
- Mall, S.; Rao, G.P.; Marcone, C. Phytoplasma diseases of weeds: Detection, taxonomy and diversity. In Recent Trends in Biotechnology and Microbiology; Gaur, R.K., Ed.; Nova Science Publishers, Inc.: Hauppauge, NY, USA, 2010; pp. 87–108. [Google Scholar]
- Mehle, N.; Brzin, J.; Boben, J.; Hren, M.; Frank, J.; Petrovič, N.; Gruden, K.; Dreo, T.; Žežlina, I.; Seljak, G.; et al. First report of ‘Candidatus Phytoplasma mali’ in Prunus avium, P. armeniaca and P. domestica. Plant Pathol. 2007, 56, 721. [Google Scholar] [CrossRef]
- Hodgetts, J.; Boonham, N.; Mumford, R.; Dickinson, M. Panel of 23S rRNA gene-based real-time PCR assays for improved universal and group-specific detection of phytoplasmas. Appl. Environ. Microbiol. 2009, 75, 2945–2950. [Google Scholar] [CrossRef]
- Jarausch, W.; Fuchs, A.; Jarausch, B. Establishment of a quantitative real-time PCR assay for the specific quantification of Ca. Phytoplasma prunorum in plants and insects. Jul.-Kühn-Arch. 2010, 427, 392. [Google Scholar]
- Martini, M.; Loi, N.; Ermacora, P.; Carraro, L.; Pastore, M. A real-time PCR method for detection and quantification of ‘Candidatus Phytoplasma prunorum’ in its natural hosts. Bull. Insectol. 2007, 60, 251. [Google Scholar]
- Mehle, N.; Nikolić, P.; Gruden, K.; Ravnikar, M.; Dermastia, M. Real-time PCR for specific detection of three phytoplasmas from the apple proliferation group. In Phytoplasma: Methods and Protocols; Dickinson, M., Hodgetts, J., Eds.; Springer: New York, NY, USA, 2013; pp. 269–281. [Google Scholar]
- Nikolić, P.; Mehle, N.; Gruden, K.; Ravnikar, M.; Dermastia, M. A panel of real-time PCR assays for specific detection of three phytoplasmas from the apple proliferation group. Mol. Cell. Probes 2010, 24, 303–309. [Google Scholar] [CrossRef]
- Pignatta, D.; Pollini, C.P.; Giunchedi, L.; Ratti, C.; Reggiani, N.; Forno, F.; Mattedi, L.; Gobber, M.; Miorelli, P.; Ropelato, E. A real-time PCR assay for the detection of European Stone Fruit Yellows Phytoplasma (ESFYP) in plant propagation material. Acta Hortic. 2008, 781, 499–503. [Google Scholar] [CrossRef]
- Torres, E.; Bertolini, E.; Cambra, M.; Montón, C.; Martín, M.P. Real-time PCR for simultaneous and quantitative detection of quarantine phytoplasmas from apple proliferation (16SrX) group. Mol. Cell. Probes 2005, 19, 334–340. [Google Scholar] [CrossRef] [PubMed]
- Yvon, M.; Thébaud, G.; Alary, R.; Labonne, G. Specific detection and quantification of the phytopathogenic agent ‘Candidatus Phytoplasma prunorum’. Mol. Cell. Probes 2009, 23, 227–234. [Google Scholar] [CrossRef]
- Minguzzi, S.; Terlizzi, F.; Lanzoni, C.; Poggi Pollini, C.; Ratti, C. A rapid protocol of crude RNA/DNA extraction for RT-qPCR detection and quantification of ‘Candidatus phytoplasma prunorum’. PLoS ONE 2016, 11, e0146515. [Google Scholar] [CrossRef]
- Aldaghi, M.; Massart, S.; Dutrecq, O.; Bertaccini, A.; Jijakli, M.H.; Lepoivre, P. A simple and rapid protocol of crude DNA extraction from apple trees for PCR and real-time PCR detection of ‘Candidatus Phytoplasma mali’. J. Virol. Methods 2009, 156, 96–101. [Google Scholar] [CrossRef] [PubMed]
- Aldaghi, M.; Massart, S.; Roussel, S.; Jijakli, M.H. Development of a new probe for specific and sensitive detection of ‘Candidatus Phytoplasma mali’ in inoculated apple trees. Ann. Appl. Biol. 2007, 15, 251–258. [Google Scholar] [CrossRef]
- Baric, S. Quantitative real-time PCR analysis of ‘Candidatus Phytoplasma mali’ without external standard curves. Erwerbs-Obstbau 2012, 54, 147–153. [Google Scholar] [CrossRef]
- Baric, S.; Berger, J.; Cainelli, C.; Kerschbamer, C.; Letschka, T.; Dalla Via, J. Seasonal colonisation of apple trees by ‘Candidatus Phytoplasma mali’ revealed by a new quantitative TaqMan real-time PCR approach. Eur. J. Plant Pathol. 2011, 129, 455–467. [Google Scholar] [CrossRef]
- Baric, S.; Dalla-Via, J. A new approach to apple proliferation detection: A highly sensitive real-time PCR assay. J. Microbiol. Methods 2004, 57, 135–145. [Google Scholar] [CrossRef]
- Baric, S.; Kerschbamer, C.; Dalla Via, J. TaqMan real-time PCR versus four conventional PCR assays for detection of apple proliferation phytoplasma. Plant Mol. Biol. Rep. 2006, 24, 169–184. [Google Scholar] [CrossRef]
- Valasevich, N.; Schneider, B. Rapid detection of “Candidatus Phytoplasma mali” by recombinase polymerase amplification assays. J. Phytopathol. 2017, 165, 762–770. [Google Scholar] [CrossRef]
- Yasuhara-Bell, J.; Costanzo, S.; Mavrodieva, V. Validation of a modified quantitative PCR and synthetic DNA gBlocks control for detection of ‘Candidatus Phytoplasma mali.’. Phytopath. Mollicutes 2023, 13, 143–144. [Google Scholar] [CrossRef]
- Fonesco, J.P.; Nunziata, S.; Yasuhara-Bell, J.; Bertaccini, A.; Rivera, Y.; Newberry, E. A draft genome resource for ‘Candidatus Phytoplasma prunorum’, the agent associated with European Stone Fruit Yellows disease. PhytoFrontiers 2024. [Google Scholar] [CrossRef]
- Zhao, Y.; Wei, W.; Lee, I.M.; Shao, J.; Suo, X.; Davis, R.E. The iPhyClassifier, an interactive online tool for phytoplasma classification and taxonomic assignment. In Phytoplasma. Methods in Molecular Biology; Dickinson, M., Hodgetts, J., Eds.; Humana Press: Totowa, NJ, USA, 2013; Volume 938, pp. 329–338. [Google Scholar]
- Bai, X.; Zhang, J.; Ewing, A.; Miller, S.A.; Jancso Radek, A.; Shevchenko, D.V.; Tsukerman, K.; Walunas, T.; Lapidus, A.; Campbell, J.W.; et al. Living with genome instability: The adaptation of phytoplasmas to diverse environments of their insect and plant hosts. J. Bacteriol. 2006, 188, 3682–3696. [Google Scholar] [CrossRef]
- Tran-Nguyen, L.T.T.; Kube, M.; Schneider, B.; Reinhardt, R.; Gibb, K.S. Comparative genome analysis of “Candidatus Phytoplasma australiense” (subgroup tuf-Australia I; rp-A) and “Ca. Phytoplasma asteris” strains OY-M and AY-WB. J. Bacteriol. 2008, 190, 3979–3991. [Google Scholar] [CrossRef] [PubMed]
- Kube, M.; Schneider, B.; Kuhl, H.; Dandekar, T.; Heitmann, K.; Migdoll, A.M.; Reinhardt, R.; Seemüller, E. The linear chromosome of the plant-pathogenic mycoplasma ‘Candidatus Phytoplasma mali’. BMC Genom. 2008, 9, 306. [Google Scholar] [CrossRef]
- Mitrović, J.; Siewert, C.; Duduk, B.; Hecht, J.; Mölling, K.; Broecker, F.; Beyerlein, P.; Büttner, C.; Bertaccini, A.; Kube, M. Generation and analysis of draft sequences of ‘Stolbur’ phytoplasma from multiple displacement amplification templates. J. Mol. Microbiol. Biotechnol. 2014, 24, 1–11. [Google Scholar] [CrossRef]
- Oshima, K.; Kakizawa, S.; Nishigawa, H.; Jung, H.Y.; Wei, W.; Suzuki, S.; Arashida, R.; Nakata, D.; Miyata, S.I.; Ugaki, M.; et al. Reductive evolution suggested from the complete genome sequence of a plant-pathogenic phytoplasma. Nat. Genet. 2004, 36, 27–29. [Google Scholar] [CrossRef]
- Andersen, M.T.; Liefting, L.W.; Havukkala, I.; Beever, R.E. Comparison of the complete genome sequence of two closely related isolates of ‘Candidatus Phytoplasma australiense’ reveals genome plasticity. BMC Genom. 2014, 14, 529. [Google Scholar] [CrossRef]
- Médigue, C.; Calteau, A.; Cruveiller, S.; Gachet, M.; Gautreau, G.; Josso, A.; Lajus, A.; Langlois, J.; Pereira, H.; Planel, R.; et al. MicroScope—An integrated resource for community expertise of gene functions and comparative analysis of microbial genomic and metabolic data. Brief. Bioinform. 2019, 20, 1071–1084. [Google Scholar] [CrossRef] [PubMed]
- Vallenet, D.; Belda, E.; Calteau, A.; Cruveiller, S.; Engelen, S.; Lajus, A.; Le Fèvre, F.; Longin, C.; Mornico, D.; Roche, D.; et al. MicroScope—An integrated microbial resource for the curation and comparative analysis of genomic and metabolic data. Nucleic Acids Res. 2013, 41, D636–D647. [Google Scholar] [CrossRef] [PubMed]
- Vallenet, D.; Calteau, A.; Cruveiller, S.; Gachet, M.; Lajus, A.; Josso, A.; Mercier, J.; Renaux, A.; Rollin, J.; Rouy, Z.; et al. MicroScope in 2017: An expanding and evolving integrated resource for community expertise of microbial genomes. Nucleic Acids Res. 2017, 45, D517–D528. [Google Scholar] [CrossRef]
- Vallenet, D.; Calteau, A.; Dubois, M.; Amours, P.; Bazin, A.; Beuvin, M.; Burlot, L.; Bussell, X.; Fouteau, S.; Gautreau, G.; et al. MicroScope: An integrated platform for the annotation and exploration of microbial gene functions through genomic, pangenomic and metabolic comparative analysis. Nucleic Acids Res. 2020, 48, D579–D589. [Google Scholar] [CrossRef]
- Vallenet, D.; Engelen, S.; Mornico, D.; Cruveiller, S.; Fleury, L.; Lajus, A.; Rouy, Z.; Roche, D.; Salvignol, G.; Scarpelli, C.; et al. MicroScope: A platform for microbial genome annotation and comparative genomics. Database 2009, 2009, bap021. [Google Scholar] [CrossRef] [PubMed]
- Vallenet, D.; Labarre, L.; Rouy, Z.; Barbe, V.; Bocs, S.; Cruveiller, S.; Lajus, A.; Pascal, G.; Scarpelli, C.; Medigue, C. MaGe: A microbial genome annotation system supported by synteny results. Nucleic Acids Res. 2006, 34, 53–65. [Google Scholar] [CrossRef]
- Owczarzy, R.; Tataurov, A.V.; Wu, Y.; Manthey, J.A.; McQuisten, K.A.; Almabrazi, H.G.; Pedersen, K.F.; Lin, Y.; Garretson, J.; McEntaggart, N.O.; et al. IDT SciTools: A suite for analysis and design of nucleic acid oligomers. Nucleic Acids Res. 2008, 36, W163–W169. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Ew, M.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
- Deng, S.; Hiruki, C. Amplification of 16S rRNA genes from culturable and nonculturable mollicutes. J. Microbiol. Methods 1991, 14, 53–61. [Google Scholar] [CrossRef]
- Lee, I.-M.; Martini, M.; Marcone, C.; Zhu, S.F. Classification of phytoplasma strains in the elm yellows group (16SrV) and proposal of ‘Candidatus Phytoplasma ulmi’ for the phytoplasma associated with elm yellows. Int. J. Syst. Evol. Microbiol. 2004, 52, 337–347. [Google Scholar] [CrossRef] [PubMed]
- Makarova, O.; Contaldo, N.; Paltrinieri, S.; Kawube, G.; Bertaccini, A.; Nicolaisen, M. DNA barcoding for identification of ‘Candidatus Phytoplasmas’ using a fragment of the elongation factor Tu gene. PLoS ONE 2012, 7, e52092. [Google Scholar] [CrossRef] [PubMed]
- Jarausch, W.; Lansac, M.; Saillard, C.; Broquaire, J.M.; Dosba, F. PCR assay for specific detection of European stone fruit yellows phytoplasmas and its use for epidemiological studies in France. Eur. J. Plant Pathol. 1998, 104, 17–27. [Google Scholar] [CrossRef]
- Jarausch, W.; Peccerella, T.; Schwind, N.; Jarausch, B.; Krczal, G. Establishment of a quantitative real-time PCR assay for the quantification of apple proliferation phytoplasmas in plants and insects. Acta Hortic. 2003, 657, 415–420. [Google Scholar] [CrossRef]
- Martini, M.; Ermacora, P.; Falginella, L.; Loi, N.; Carraro, L. Molecular differentiation of ‘Candidatus Phytoplasma mali’ and its spreading in Friuli Venezia Giulia Region (north-east Italy). Acta Hortic. 2008, 781, 395–402. [Google Scholar] [CrossRef]
- Paltrinieri, S.; Martini, M.; Ermacora, P.; Bertaccini, A. Comparison of different detection systems for apple proliferation phytoplasmas in Trentino (North Italy). Acta Hortic. 2008, 781, 453–457. [Google Scholar]
Figure 1.
Electronic gel image showing amplicons resulting from a semi-nested PCR using 16S primers for phytoplasmas. Two dilutions (limit of detection (LoD) and LoD−1) of DNA from ‘Candidatus Phytoplasma prunorum’ strains ESFY1 and LNS1 in healthy peach (Prunus persica) DNA and synthetic gBlocks™ positive control (4 fg/µL) were subjected to semi-nested 16S PCR amplification; + Ctrl: 4 fg/µL synthetic control; NTC: no-template control. Amplicons were analyzed using the 4200 TapeStation System, D5000 ScreenTape, D5000 DNA Ladder (L), and D5000 Sample Buffer according to the manufacturer’s instructions. The data show bands of appropriate size (~1500 bp) were produced for all samples tested, as well as the synthetic control; no bands were produced for the NTC.
Figure 1.
Electronic gel image showing amplicons resulting from a semi-nested PCR using 16S primers for phytoplasmas. Two dilutions (limit of detection (LoD) and LoD−1) of DNA from ‘Candidatus Phytoplasma prunorum’ strains ESFY1 and LNS1 in healthy peach (Prunus persica) DNA and synthetic gBlocks™ positive control (4 fg/µL) were subjected to semi-nested 16S PCR amplification; + Ctrl: 4 fg/µL synthetic control; NTC: no-template control. Amplicons were analyzed using the 4200 TapeStation System, D5000 ScreenTape, D5000 DNA Ladder (L), and D5000 Sample Buffer according to the manufacturer’s instructions. The data show bands of appropriate size (~1500 bp) were produced for all samples tested, as well as the synthetic control; no bands were produced for the NTC.
Figure 2.
Linear amplification plots for 10-fold serial dilutions of DNA from ‘Candidatus Phytoplasma prunorum’ strain ESFY1 and ‘Ca. P. mali’ strain C71. Strains EFSY1 and C71 were each tested with two assays: PE639 and 23S for ESFY1, and imp and 23S for C71. Data points represent mean Ct values from three independent operators and two instruments (QuantStudio™ 5 Real-Time PCR System and CFX96 OPUS Real-Time PCR System) (N = 12 per data point). Linear regression equations are displayed.
Figure 2.
Linear amplification plots for 10-fold serial dilutions of DNA from ‘Candidatus Phytoplasma prunorum’ strain ESFY1 and ‘Ca. P. mali’ strain C71. Strains EFSY1 and C71 were each tested with two assays: PE639 and 23S for ESFY1, and imp and 23S for C71. Data points represent mean Ct values from three independent operators and two instruments (QuantStudio™ 5 Real-Time PCR System and CFX96 OPUS Real-Time PCR System) (N = 12 per data point). Linear regression equations are displayed.
Table 1.
Target and non-target organisms tested in this study.
| Organism | RFLP Group | Sample ID | Host a | Host (Common) | Origin | Source b,c |
|---|---|---|---|---|---|---|
| Alternaria alternata | N/A | 22033001-01 (B) | Citrus limon | Lemon | USA, TX | PPCDL |
| Aureobasidium pullulans | N/A | DSM 14940 | Malus domestica | Apple | Germany | Westbridge Ag |
| Aureobasidium pullulans | N/A | DSM 14941 | Malus domestica | Apple | Germany | Westbridge Ag |
| ‘Candidatus Phytoplasma’ | 16SrII-C | CoPh | Cocos nucifera | Coconut | Tanzania | EPPO-Q-bank |
| ‘Candidatus Phytoplasma’ | 16SrIII-B | GY-U | Vitis vinifera var. ‘Chardonnay’ | Chardonnay grape | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma’ | 16SrIX-C | PEY | Pichris echioides | Bristly oxtongue | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma’ | 16SrV-C | ALY | Alnus sp. | Alder | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma’ | 16SrXI-C | BVK | Psammotettix cephalotes | Leafhopper | Germany | EPPO-Q-bank |
| ‘Candidatus Phytoplasma asteris’ | 16SrI-A | 23092601-01 | Vitis spp. | Grape | MN, USA | PPCDL |
| ‘Candidatus Phytoplasma asteris’ | 16SrI-A | 23092601-02 | Vitis spp. | Grape | MN, USA | PPCDL |
| ‘Candidatus Phytoplasma asteris’ | 16SrI-A | 23092601-03 | Vitis spp. | Grape | MN, USA | PPCDL |
| ‘Candidatus Phytoplasma asteris’ | 16SrI-F | AY-A | Prunus armeniaca | Apricot | Spain | EPPO-Q-bank |
| ‘Candidatus Phytoplasma aurantifolia’ | 16SrII-B | WBDL | Citrus spp. | Lime | Oman | EPPO-Q-bank |
| ‘Candidatus Phytoplasma brasilliense’ | 16SrXV-A | SuV | Hibiscus spp. | Hibiscus | France | EPPO-Q-bank |
| ‘Candidatus Phytoplasma mali’ | 16SrX-A | AP-1 | Malus domestica | Apple | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma mali’ | 16SrX-A | AP-15 | Malus domestica | Apple | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma mali’ | 16SrX-A | AP-2 | Malus domestica | Apple | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma mali’ | 16SrX-A | AP-3 | Malus domestica | Apple | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma mali’ | 16SrX-A | APxN | Malus domestica | Apple | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma mali’ | 16SrX-A | C71 | Malus domestica | Apple | Italy | K. Zikeli |
| ‘Candidatus Phytoplasma mali’ | 16SrX-A | P4 | Malus domestica | Apple | Slovenia | N. Mehle |
| ‘Candidatus Phytoplasma mali’ | 16SrX-A | P6 | Pooled Malus domestica/Cacopsylla picta | Apple/psyllid (jumping plant lice) | Slovenia | N. Mehle |
| ‘Candidatus Phytoplasma palmae’ | 16SrIV-D | 19101702-01 | Phoenix sylvestris | Wild date palm | MS, USA | PPCDL |
| ‘Candidatus Phytoplasma palmae’ | 16SrIV-D | 19110501-02 | Phoenix sylvestris | Wild date palm | MS, USA | PPCDL |
| ‘Candidatus Phytoplasma pini’-related | 16SrXXI-B | MDPP | Pinus pungens | Mountain pine | MD, USA | S. Costanzo |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 19122001-22 | Prunus spp. | - | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 19122001-41 | Prunus spp. | - | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 20012301-04 | Prunus spp. | Cherry | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 20012301-05 | Prunus spp. | Cherry | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 20012301-06 | Prunus spp. | Cherry | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 20012301-07 | Prunus spp. | Cherry | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 20012301-08 | Prunus spp. | Cherry | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 20012301-09 | Prunus spp. | Cherry | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 20012301-10 | Prunus spp. | Cherry | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 20012301-11 | Prunus spp. | Cherry | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 21021201-02 | Prunus spp. | - | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pruni’ rrnA | 16SrIII-A rrn | 21021201-03 | Prunus spp. | - | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | ESFY1 | Prunus salicina | Japanese/Chinese plum | Italy | K. Zikeli |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | ESFY-1A | Prunus armeniaca | Apricot | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | ESFY-1P | Prunus salicina | Japanese plum | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | ESFY-1PE | Prunus persica | Peach | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | ESFY-2A | Prunus armeniaca | Apricot | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | ESFY-2P | Prunus salicina | Japanese plum | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | ESFY-2PE | Prunus persica | Peach | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | LNp | Prunus salicina | Japanese plum | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | LNS1 | Prunus salicina | Japanese plum | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | LNS2 | Prunus salicina | Japanese plum | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma prunorum’ | 16SrX-F | P1 | Prunus americana and P. persica | American plum and peach | Slovenia | N. Mehle |
| ‘Candidatus Phytoplasma pyri’ | 16SrX-C | 20012301-03 | Pyrus spp. | Pear | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pyri’ | 16SrX-C | 21021201-01 | Pyrus spp. | Pear | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pyri’ | 16SrX-C | 23111702-01 | Pyrus spp. | Pear | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma pyri’ | 16SrX-C | P3 | Pyrus communis | European/common pear | Slovenia | N. Mehle |
| ‘Candidatus Phytoplasma pyri’ | 16SrX-C | PD | Pyrus communis | European/common pear | Germany | EPPO-Q-bank |
| ‘Candidatus Phytoplasma rubi’ | 16SrV-E | RuS | Rubus spp. | Brambles | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma solani’ | 16SrXII-A | CH-1 | Vitis vinifera var. ’Chardonnay’ | Chardonnay grape | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma solani’ | 16SrXII-A | LNIV | Prunus salicina | Japanese plum | Italy | EPPO-Q-bank |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 19041105-01 | Alnus spp. | Alder | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 19081401-01 | Alnus spp. | Alder | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 19122001-01 | Alnus spp. | Alder | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 19122001-26 | Alnus spp. | Alder | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 19122001-32 | Alnus spp. | Alder | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 19122001-40 | Prunus spp. | - | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 19122001-42 | Alnus spp. | Alder | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 21012601-01 | Alnus spp. | Alder | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 21012601-02 | Alnus spp. | Alder | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 21031201-01 | Malus spp. | Apple | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 21031201-02 | Malus spp. | Apple | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 21042602-01 | Malus spp. | Apple | WA, USA | PPCDL |
| ‘Candidatus Phytoplasma vitis’-related | 16SrV-C | 21042602-02 | Malus spp. | Apple | WA, USA | PPCDL |
| Colletotrichum gloeospiriodes | N/A | 22033001-01 (C) | Citrus limon | Lemon | USA, TX | PPCDL |
| Colletotrichum gloeospiriodes | N/A | 22033001-01 (D1) | Citrus limon | Lemon | USA, TX | PPCDL |
| Colletotrichum queenslandicum | N/A | 17030501 (C-11) | Citrus limon | Lemon | USA, TX | PPCDL |
| Colletotrichum queenslandicum | N/A | 17030501 (C-5) | Citrus limon | Lemon | USA, TX | PPCDL |
| Erwinia amylovora | N/A | Ea110 | Malus domestica | Apple | USA, OR | V. Stockwell |
| Erwinia amylovora | N/A | Ea153 | Malus domestica | Apple | USA, OR | V. Stockwell |
| Erwinia amylovora | N/A | Fire blight | Malus domestica | Apple | USA, MD | J. Yasuhara-Bell |
| Erwinia amylovora | N/A | Fire blight | Malus domestica | Apple | USA, MD | PGQP |
| Erwinia amylovora | N/A | Parkdale | Malus domestica | Apple | USA, MI | V. Stockwell |
| Erwinia aphidicola | N/A | 17110702-04 | Cucumis melo var. ’mlada’ | Mlada melon | USA, CA | PPCDL |
| Erwinia billingae | N/A | Eh24 | Pyrus spp. | Pear | Turkey | V. Stockwell |
| Erwinia billingae | N/A | NCPPB 661T | Pyrus communis | European/common pear | UK | NCPPB |
| Erwinia persicina | N/A | 19122706-01 | Cucumis melo | Melon | USA, CA | PPCDL |
| Erwinia persicina | N/A | LA611 | Rubus spp. | Raspberry | USA, WA | V. Stockwell |
| Erwinia persicina | N/A | LA659 | Rubus spp. | Raspberry | USA, WA | V. Stockwell |
| Erwinia piriflorinigrans | N/A | CFBP 5888T | Pyrus communis | European/common pear | Spain | CFPB |
| Erwinia pyrifoliae | N/A | 23-02275 | Fragaria × ananassa | Strawberry | USA, OH | PPCDL |
| Erwinia pyrifoliae | N/A | Ejp 556 | Pyrus pyrifolia | Asian Pear | Japan | A. Svircev |
| Erwinia pyrifoliae | N/A | Ejp 617 | Pyrus pyrifolia | Asian Pear | Japan | A. Svircev |
| Erwinia pyrifoliae | N/A | Ep 28/96 | Pyrus pyrifolia | Asian Pear | Korea | A. Svircev |
| Erwinia pyrifoliae | N/A | Ep 4/97 | Pyrus pyrifolia | Asian Pear | Korea | A. Svircev |
| Erwinia rhapontici | N/A | 19122702-01 | Delphinium spp. | Larkspur | USA, CA | PPCDL |
| Erwinia tasmaniensis | N/A | Et1/99T | Malus domestica | Apple | Australia | V. Stockwell |
| Erwinia uzenensis | N/A | NCPPB 4475T | Pyrus communis | European/common pear | Japan | NCPPB |
| Monilinia fructicola | N/A | 19090401-01A | Prunus persica | Peach | USA, WV | K. Zeller |
| Monilinia fructicola | N/A | 19090401-02A | Malus domestica | Apple | USA, MN | PPCDL |
| Monilinia fructicola | N/A | Mf35 | Malus domestica | Apple | USA, MN | PPCDL |
| Monilinia fructigena | N/A | Mfg2-GE-A E | Malus domestica | Apple | Hungary | K. Zeller |
| Monilinia laxa | N/A | PSG1 | Prunus persica | Peach | Italy | K. Zeller |
| Monilinia polystroma | N/A | SP61 | Prunus spp. | Plum | Poland | K. Zeller |
| Neofabraea alba | N/A | PD-1696 | Malus domestica | Apple | USA, WA | T. Wilson |
| Neofabraea sp. | N/A | PD-1597 | Malus domestica | Apple | USA, WA | T. Wilson |
| Neofabraea sp. | N/A | PD-1617 | Malus domestica | Apple | USA, WA | T. Wilson |
| Neofabraea sp. | N/A | PD-1655B | Malus domestica | Apple | USA, WA | T. Wilson |
| Pantoea agglomerans | N/A | 23091801-01 | Triticum aestivum | Wheat | USA, CO | PPCDL |
| Pantoea agglomerans | N/A | 23091801-03 | Triticum aestivum | Wheat | USA, CO | PPCDL |
| Pantoea agglomerans | N/A | 23091801-04 | Triticum aestivum | Wheat | USA, CO | PPCDL |
| Pantoea agglomerans | N/A | E325 | Malus domestica | Apple | USA, WA | V. Stockwell |
| Pantoea allii | N/A | 23091801-02 | Triticum aestivum | Wheat | USA, CO | PPCDL |
| Pantoea ananatis | N/A | CES-14 (SM-272) | - | - | Philippines | S. Miller |
| Pantoea ananatis | N/A | CES-5 (JM-55) | - | Soil | Philippines | S. Miller |
| Pantoea ananatis | N/A | E | Oryza sativa | Rice | USA, AR | J. Leach; E. Peachey |
| Pantoea stewartii | N/A | DCop3-07 | Zea mays | Corn | - | S. Miller; D. Coplin |
| Pantoea stewartii | N/A | PP685 | - | - | S. Miller | |
| Pantoea vagans | N/A | C9-1 | Malus domestica | Apple | USA, MI | V. Stockwell |
| Phacidiopycnis wasingtonensis | N/A | PD-1597 | Malus domestica | Apple | USA, WA | T. Wilson |
| Phacidiopycnis wasingtonensis | N/A | PD-1655B | Malus domestica | Apple | USA, WA | T. Wilson |
| Pseudomonas fluorescens | N/A | A506 | Pyrus spp. | Pear | USA, CA | V. Stockwell |
| Pseudomonas syringae | N/A | JL2583 | Vaccinium spp. | Blueberry | USA, OR | V. Stockwell |
| Sphaeropsis pyriputrescens | N/A | PD-1655B | Malus domestica | Apple | USA, WA | T. Wilson |
| Venturia inaequalis | N/A | Apple Scab | Malus domestica | Apple | USA, MD | PGQP |
| Xanthomonas arboricola pv. corylina | N/A | JL2611 | Corylus avellana | Hazelnut | USA, OR | V. Stockwell |
| Xyllela fastidiosa | N/A | XFS 253 | Salix spp. | Willow | USA, WA | T. Wilson |
| Xyllela fastidiosa | N/A | XFS 254 | Lonicera spp. | Honeysuckle | USA, WA | T. Wilson |
| Xyllela fastidiosa | N/A | XFS 946 | Rosa spp. | Rose | USA, WA | T. Wilson |
| Xyllela fastidiosa subsp. multiplex | N/A | Peach Leaves Georgia | Prunus persica | Peach | USA, GA | Y.K. Jo |
| Xyllela fastidiosa subsp. multiplex | N/A | Peach Texas A&M (1) | Prunus persica | Peach | USA, TX | Y.K. Jo |
a Host designations for phytoplasmas represent the original infected host plant. All phytoplasmas were propagated in Catharanthus roseus (Madagascar periwinkle) prior to DNA extraction, except for diagnostic samples, three ‘Ca. P. mali’ (AP-1, AP-2, and AP-3) and six ‘Ca. P. prunorum’ (ESFY-1A, ESFY-2A, ESFY-1P, ESFY-2P, ESFY-1PE, and ESFY-2PE) strains, which were from their original hosts. b A. Svircev—Agriculture and Agri-Food Canada; CFBP—French Collection for Plant-Associated Bacteria; D. Coplin—The Ohio State University Department of Plant Pathology; E. Peachey (Luna)—Colorado State University Department of Agricultural Biology; EPPO-Q-bank—European and Mediterranean Plant Protection Organization Q-bank; J. Leach—Colorado State University Department of Agricultural Biology; J. Yasuhara-Bell—USDA APHIS PPQ S&T PPCDL; K. Zeller—USDA APHIS PPQ S&T PPCDL; K. Zikeli—Julius Kühn-Institut Federal Research Institute for Cultivated Plants, Institute for Plant Protection in Fruit Crops and Viticulture, Dossenheim, Germany; N. Mehle—National Institute of Biology, Department of Biotechnology and Systems Biology, Ljubljana, Slovenia; NCPPB—National Collection of Plant Pathogenic Bacteria, Fera, UK; PGQP—USDA APHIS Plant Germplasm Quarantine Program; PPCDL—original sample was received for diagnostic testing by the USDA APHIS PPQ S&T PPCDL; S. Costanzo—USDA APHIS PPQ S&T PPCDL; S. Miller—The Ohio State University Department of Plant Pathology; T. Wilson—Washington State Department of Agriculture; V. Stockwell—USDA ARS Corvallis, OR; Westbridge Ag—Westbridge Agricultural Products; Y.K. Jo—Texas A&M University, Department of Plant Pathology and Microbiology. c Phytoplasma strains from PPCDL represent domestic samples collected within the United States that tested positive for ‘Candidatus Phytoplasma’ by the 23S rRNA assay [19]. Species and 16Sr group identification resulted from 16S rRNA sequencing and analysis using iPhyClassifier [37].
Table 2.
Oligonucleotide primers and probes used in this study.
| Target Organism | Primer | Primer Sequence (5′->3′) | Final Concentration (nM) | Gene Target | Amplicon (bp) | Ref. |
|---|---|---|---|---|---|---|
| ‘Candidatus Phytoplasma prunorum’ | ESFY-PE639-F | ACAGGCCGCGAATTTATTACT | 200 | Putative effector (639 nt) | 139 | This study |
| ESFY-PE639-R | GGACCGATGCTTTCACTGTT | 200 | ||||
| ESFY-PE639-P | FAM-AGATCAACGCGTACAAGCAACAGA-QSY | 100 | ||||
| ‘Candidatus Phytoplasma mali’ | fimpAP | GGTTCAGTTGTTGGTGCTT | 100 | imp | 88 | [34,35] |
| rimpAP | TTTSTTGTTTACTTTKTGATGAAA | 500 | ||||
| qimpAP | FAM-AGGCCAGAAACTAATAGACCAAGCT-QSY | 100 | ||||
| ‘Candidatus Phytoplasma’ | JH-F 1 | GGTCTCCGAATGGGAAAACC | 240 | 23S | 142–149 | [19] |
| JH-F all | ATTTCCGAATGGGGCAACC | 240 | ||||
| JH-R | CTCGTCACTACTACCRGAATCGTTATTAC | 240 | ||||
| JH-P uni | FAM-AACTGAAATATCTAAGTAAC-MGB-NFQ | 120 | ||||
| Plant host | F | GACTACGTCCCTGCCCTTTG | 48 | 18S | 68 | [13] |
| R-mod a | AACAYTTCACCGGAYCATTCA | 48 | ||||
| Probe b | ABY-ACACACCGCCCGTCGCTCC-QSY | 24 | ||||
| ‘Candidatus Phytoplasma’ | P1 | AAGAGTTTGATCCTGGCTCAGGATT | 400 | 16S | 1538 c | [53,54] |
| P1A | AACGCTGGCGGCGCGCCTAATAC | 400 | ||||
| 16S-SR | GGTCTGTCAAAACTGAAGATG | 400 |
a Primer modified from original sequence to include degenerate bases. b For use with a Bio-Rad CFX96 OPUS, the 18S (ABY-QSY) fluorophore/quencher pair was changed to VIC-QSY and Cy3-IAbRQSp when duplexed with PE639 (‘Ca. P. prunorum’) and imp (‘Ca. P. mali’), respectively. c Amplicon size following 2nd round of semi-nested PCR.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Yasuhara-Bell, J.; Rivera, Y. Genome-Informed Real-Time PCR Assay for Detection of ‘Candidatus Phytoplasma Prunorum,’ Which Is Associated with European Stone Fruit Yellows. Microorganisms 2025, 13, 929. https://doi.org/10.3390/microorganisms13040929
AMA Style
Yasuhara-Bell J, Rivera Y. Genome-Informed Real-Time PCR Assay for Detection of ‘Candidatus Phytoplasma Prunorum,’ Which Is Associated with European Stone Fruit Yellows. Microorganisms. 2025; 13(4):929. https://doi.org/10.3390/microorganisms13040929
Chicago/Turabian StyleYasuhara-Bell, Jarred, and Yazmín Rivera. 2025. "Genome-Informed Real-Time PCR Assay for Detection of ‘Candidatus Phytoplasma Prunorum,’ Which Is Associated with European Stone Fruit Yellows" Microorganisms 13, no. 4: 929. https://doi.org/10.3390/microorganisms13040929
APA StyleYasuhara-Bell, J., & Rivera, Y. (2025). Genome-Informed Real-Time PCR Assay for Detection of ‘Candidatus Phytoplasma Prunorum,’ Which Is Associated with European Stone Fruit Yellows. Microorganisms, 13(4), 929. https://doi.org/10.3390/microorganisms13040929
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
