A Powerful LAMP Weapon against the Threat of the Quarantine Plant Pathogen Curtobacterium flaccumfaciens pv. flaccumfaciens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
2.2. Bacterial DNA Extraction and Thermal Lysis
2.3. Primer Design
2.4. LAMP Reaction
2.5. Detection of Cff in Artificially and Naturally Infected Bean Plant Materials
3. Results
3.1. Design and Selection of LAMP Primers
3.2. Optimization of LAMP Assay for Cff Detection
3.3. Specificity and Sensitivity of the LAMP Assay for Cff Detection
3.4. LAMP Detection of Cff on Artificially and Naturally Infected Bean Samples
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- EPPO. Curtobacterium flaccumfaciens pv. flaccumfaciens. Bull. OEPP 2011, 41, 320–328. [Google Scholar]
- EFSA Panel on Plant Health (EFSA PLH Panel); Jeger, M.; Bragard, C.; Caffier, D.; Candresse, T.; Chatzivassiliou, E.; Dehnen-Schmutz, K.; Gilioli, G.; Grégoire, J.-C.; Miret, J.A.J.; et al. Pest categorisation of Curtobacterium flaccumfaciens pv. flaccumfaciens. EFSA J. 2018, 16, 5299. [Google Scholar]
- Hedges, F. A bacterial wilt of the bean caused by Bacterium flaccumfaciens nov. Science 1922, 55, 433–434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osdaghi, E.; Young, A.J.; Harveson, R.M. Bacterial wilt of dry beans caused by Curtobacterium flaccumfaciens pv. flaccumfaciens: A new threat from an old enemy. Mol. Plant Pathol. 2020, 21, 605–621. [Google Scholar] [PubMed] [Green Version]
- EPPO Global Database. Curtobacterium flaccumfaciens pv. flaccumfaciens (CORBFL). Categorization. 2020. Available online: https://gd.eppo.int/taxon/CORBFL/categorization (accessed on 28 October 2020).
- EPPO. EPPO Standard PM 1/2(28). EPPO A1 and A2 Lists of Pests Recommended for Regulation as Quarantine Pests. 2019. Available online: https://gd.eppo.int/taxon/CORBFL/documents (accessed on 28 October 2020).
- European Commission. Implementing Regulation (EU) 2019/2072. Official Journal of the European Union. 2019. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/PDF/?uri=CELEX:32019R2072&from=EN (accessed on 28 October 2020).
- Bastas, K.K.; Sahin, F. Evaluation of seedborne bacterial pathogens on common bean cultivars grown in central Anatolia region, Turkey. Eur. J. Plant Pathol. 2016, 147, 239–253. [Google Scholar] [CrossRef]
- González, A.J.; Tello, J.C.; Rodicio, M.R. Bacterial Wilt of Beans (Phaseolus vulgaris) Caused by Curtobacterium flaccumfaciens in Southeastern Spain. Plant Dis. 2005, 89, 1361. [Google Scholar] [CrossRef]
- Sammer, U.F.; Reither, K. Curtobacterium flaccumfaciens pv. flaccumfaciens on soybean in Germany—A threat for farming. J. Phytopathol. 2012, 160, 314–316. [Google Scholar]
- Eurostat. The Future of Food and Farming for a Flexible, Fair and Sustainable Common Agricultural Policy. European Commission Press Release Database 2017. Available online: https://ec.europa.eu/eurostat (accessed on 28 October 2020).
- Hedges, F. Bacterial wilt of beans (Bacterium flaccumfaciens Hedges) including comparison with Bacterium phaseoli. Phytopathology 1926, 16, 1–22. [Google Scholar]
- Hsieh, T.F.; Huang, H.C.; Erickson, R.S. Bacterial wilt of common bean: Effect of seedborne inoculum on disease incidence and seedling vigour. Seed Sci. Technol. 2006, 34, 57–67. [Google Scholar] [CrossRef]
- Camara, R.C.; Vigo, S.C.; Maringoni, A.C. Plant to seed transmission of Curtobacterium flaccumfaciens pv. flaccumfaciens in a dry bean cultivar. J. Plant Pathol. 2009, 91, 549–554. [Google Scholar]
- Guimaraes, P.M.; Palmano, S.; Smith, J.J.; Grossi, M.F.S.; Saddler, G.S. Development of a PCR test for the detection of Curtobacterium flaccumfaciens pv. flaccumfaciens. Antonie Van Leeuwenhoek 2001, 80, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Tegli, S.; Sereni, A.; Surico, G. PCR-based assay for the detection of Curtobacterium flaccumfaciens pv. flaccumfaciens in bean seeds. Lett. Appl. Microbiol. 2002, 35, 331–337. [Google Scholar] [CrossRef]
- Tegli, S.; Cerboneschi, M.; Vidaver, A.K. Detection of Curtobacterium flaccumfaciens pv. flaccumfaciens in bean seeds and in seeds of other Leguminosae crops. In Detection of Plant-Pathogenic Bacteria in Seed and Other Planting Material, 2nd ed.; Fatmi, M., Walcott, R.R., Schaad, N.W., Eds.; APS Press: St Paul, MN, USA, 2017; pp. 77–83. [Google Scholar]
- Deuner, C.C.; Magela, R.S.; Zacaroni, A.B.; Figueira, A.R.; Camera, J.N. Sensitivity of the method of obtaining bacterial cells and PCR for detection of Curtobacterium flaccumfaciens pv. flaccumfaciens in bean seeds. Summa Phytopathol. 2012, 38, 48–53. [Google Scholar] [CrossRef]
- Gonçalves, R.M.; Schipanski, C.A.; Koguishi, L.; Soman, J.M.; Sakate, R.K.; Silva Júnior, T.A.F.; Maringoni, A.C. Alternative hosts of Curtobacterium flaccumfaciens pv. flaccumfaciens, causal agent of bean bacterial wilt. Eur. J. Plant Pathol. 2017, 148, 357–365. [Google Scholar]
- Osdaghi, E.; Taghavi, S.M.; Hamzehzarghani, H.; Fazliarab, A.; Harveson, R.M.; Tegli, S.; Lamichhane, J.R. Epiphytic Curtobacterium flaccumfaciens strains isolated from symptomless solanaceous vegetables are pathogenic on leguminous but not on solanaceous plants. Plant Pathol. 2018, 67, 388–398. [Google Scholar] [CrossRef]
- Osdaghi, E.; Taghavi, S.M.; Calamai, S.; Biancalani, C.; Cerboneschi, M.; Tegli, S.; Harveson, R.M. Phenotypic and molecular-phylogenetic analysis provide novel insights into the diversity of Curtobacterium flaccumfaciens. Phytopathology 2018, 108, 1154–1164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nascimento, D.M.; Oliveira, L.R.; Melo, L.L.; Silva, J.C.; Soman, J.M.; Girotto, K.T.; Eburneo, R.P.; Ribeiro-Junior, M.R.; Sartori, M.M.P.; Silva Júnior, T.A.F.; et al. Survival of Curtobacterium flaccumfaciens pv. flaccumfaciens in weeds. Plant Pathol 2020, 69, 1357–1367. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z.D.; Kang, H.J.; Chai, A.L.; Shi, Y.X.; Xie, X.W.; Li, L.; Li, B.J. Development of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Pseudomonas syringae pv. tomato in planta. Eur. J. Plant Pathol. 2020, 156, 739–750. [Google Scholar] [CrossRef]
- Ocenar, J.; Arizala, D.; Boluk, G.; Dhakal, U.; Gunarathne, S.; Paudel, S.; Dobhal, S.; Arif, M. Development of a robust, field-deployable loop-mediated isothermal amplification (LAMP) assay for specific detection of potato pathogen Dickeya dianthicola targeting a unique genomic region. PLoS ONE 2019, 14, e0218868. [Google Scholar] [CrossRef] [Green Version]
- Sagcan, H.; Turgut Kara, N. Detection of Potato ring rot pathogen Clavibacter michiganensis subsp. sepedonicus by Loop-mediated isothermal amplification (LAMP) assay. Sci. Rep. 2019, 9, 20393. [Google Scholar] [PubMed] [Green Version]
- Sun, M.; Liu, H.; Huang, J.; Peng, J.; Fei, F.; Zhang, Y.; Hsiang, T.; Zheng, L. A Loop-Mediated Isothermal Amplification Assay for rapid detection of Pectobacterium aroidearum that causes soft rot in Konjac. Int. J. Mol. Sci. 2019, 20, 1937. [Google Scholar] [CrossRef] [Green Version]
- Elbeaino, T.; Incerti, O.; Dakroub, H.; Valentini, F.; Huang, Q. Development of an FTP-LAMP assay based on TaqMan real-time PCR and LAMP for the specific detection of Xylella fastidiosa De Donno and mulberry strains in both plants and insect vectors. J. Microbiol. Methods 2020, 175, 105992. [Google Scholar] [CrossRef] [PubMed]
- Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 1951, 62, 293–300. [Google Scholar] [CrossRef] [Green Version]
- Vidaver, A.K. Synthetic and complex media for the rapid detection of fluorescence of phytopathogenic pseudomonads: Effect of the carbon source. Appl. Microbiol. 1967, 15, 1523–1524. [Google Scholar] [CrossRef] [Green Version]
- Green, M.; Sambrook, J. Molecular Cloning: A Laboratory Manual, 4th ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2012. [Google Scholar]
- Hsieh, T.F.; Huang, H.C.; Műndel, H.H.; Scott, E. A rapid technique for screening common bean (Phaseolus vulgaris L.) for resistance to bacterial wilt [Curtobacterium flaccumfaciens pv. flaccumfaciens (Hedges) Collins and Jones]. Rev. Mex. Fitopatol. 2003, 21, 370–374. [Google Scholar]
- Zhang, S.Y.; Dai, D.J.; Wang, H.D.; Zhang, C.Q. One-step loop-mediated isothermal amplification (LAMP) for the rapid and sensitive detection of Fusarium fujikuroi in bakanae disease through NRPS31, an important gene in the gibberellic acid bio-synthesis. Sci. Rep. 2019, 9, 3726. [Google Scholar] [CrossRef] [Green Version]
- Chen, Q.; Li, B.; Liu, P.; Lan, C.; Zhan, Z.; Weng, Q. Development and evaluation of specific PCR and LAMP assays for the rapid detection of Phytophthora melonis. Eur. J. Plant Pathol. 2013, 137, 597–607. [Google Scholar] [CrossRef]
- Edwards, T.; Burke, P.; Smalley, H.B.; Gillies, L.; Longhurst, D.; Vipond, B.; Hobbs, G. Loop-mediated isothermal amplification (LAMP) for the rapid detection of Mycoplasma genitalium. Diagn. Microbiol. Infect. Dis. 2015, 83, 13–17. [Google Scholar] [CrossRef]
- Yu, L.; Song, S.; Yu, C.; Qi, L.; Yu, Z.; Jiao, B.; Yang, J. A loop mediated isothermal amplification (LAMP) assay for rapid and reliable detection of Anguina wevelli, a grass parasitic nematode. Eur. J. Plant Pathol. 2018, 150, 725–734. [Google Scholar] [CrossRef]
- Tanner, N.A.; Zhang, Y.; Evans, T.C., Jr. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. Biotechniques 2015, 58, 59–68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harveson, R.M.; Schwartz, H.F.; Urrea, C.A.; Yonts, C.D. Bacterial wilt of dry-edible beans in the Central High Plains of the U.S.: Past, Present, and Future. Plant Dis. 2015, 99, 1665–1677. [Google Scholar] [CrossRef] [Green Version]
- Maringoni, A.C.; Ishizuka, M.S.; Silva, A.P.; Soman, J.M.; Moura, M.F.; Silva Júnior, T.A.F.; Chiorato, A.F.; Morais Carbonell, S.A.; Da Silva Fonseca Júnior, N. Reaction and colonization of common bean genotypes by Curtobacterium flaccumfasciens pv. flaccumfasciens. Crop Breed. Appl. Biotechnol. 2015, 15, 87–93. [Google Scholar] [CrossRef] [Green Version]
- Velásquez, A.C.; Castroverde, C.D.M.; He, S.Y. Plant-Pathogen warfare under changing climate conditions. Curr. Biol. 2018, 28, R619–R634. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferguson, B.J.; Mens, C.; Hastwell, A.H.; Zhang, M.; Su, H.; Jones, C.H.; Chu, X.; Gresshoff, P.M. Legume nodulation: The host controls the party. Plant Cell Environ. 2019, 42, 41–51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pillai, D.; Bonami, J.R.; Sri Widada, J. Rapid detection of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV), the pathogenic agents of white tail disease of Macrobrachium rosenbergii (De Man), by loop-mediated isothermal amplification. J. Fish Dis. 2006, 29, 275–283. [Google Scholar] [CrossRef]
- Teng, P.H.; Chen, C.L.; Sung, P.F.; Lee, F.C.; Ou, B.R.; Lee, P.Y. Specific detection of reverse transcription-loop-mediated isothermal amplification amplicons for Taura syndrome virus by colorimetric dot-blot hybridization. J. Virol. Methods 2007, 146, 317–326. [Google Scholar] [CrossRef]
- Fischbach, J.; Xander, N.C.; Frohme, M.; Glokler, J.F. Shining a light on LAMP assays—A comparison of LAMP visualization methods including the novel use of berberine. Biotechniques 2015, 58, 189–194. [Google Scholar] [CrossRef] [Green Version]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef] [Green Version]
- Yao, X.; Li, P.; Xu, J.; Zhang, M.; Ren, R.; Liu, G.; Yang, X. Rapid and sensitive detection of Didymella bryoniae by visual loop-mediated isothermal amplification assay. Front. Microbiol. 2016, 7, 1372. [Google Scholar] [CrossRef]
Bacteria | Strain | Source a | Host of Isolation | Pathogenicity b | LAMP c | PCR c |
---|---|---|---|---|---|---|
Curtobacterium flaccumfaciens pv. flaccumfaciens (Cff) | Type | ICMP 2584 | Common bean | + | + | + |
50R | ICMP 22071 | Common bean | + | + | + | |
80O | ICMP 22069 | Common bean | + | + | + | |
Cb222 | ICMP 21399 | Common bean | + | + | + | |
Cb302 | − | Common bean | + | + | + | |
Cb926 | − | Common bean | + | + | + | |
Cff110 | − | Common bean | + | + | + | |
Cff137 | ICMP 22066 | Common bean | + | + | + | |
Cff151 | − | Common bean | + | + | + | |
Cff153 | − | Common bean | + | + | + | |
Cff155 | − | Common bean | + | + | + | |
Cff156 | − | Common bean | + | + | + | |
Cff178 | NCPPB 178 | Common bean | + | + | + | |
Cff558 | NCPPB 558 | Common bean | + | + | + | |
Cff567 | NCCPB 567 | Common bean | + | + | + | |
Cff1412 | NCPPB 1412 | Common bean | + | + | + | |
Cff1751 | NCPPB 1751 | Common bean | + | + | + | |
10eg | ICMP 22079 | Eggplant | + | + | + | |
Cw101 | − | Cowpea | + | + | + | |
Cw110 | − | Cowpea | + | + | + | |
Eg502 | ICMP 22055 | Eggplant | + | + | + | |
Eg505 | ICMP 22054 | Eggplant | + | + | + | |
P701 | ICMP 22078 | Bell pepper | + | + | + | |
P99O | ICMP 22053 | Bell pepper | + | + | + | |
Tom50 | ICMP 22062 | Tomato | + | + | + | |
Tom803 | ICMP 22083 | Tomato | + | + | + | |
Tom806 | ICMP 22059 | Tomato | + | + | + | |
Tom930 | ICMP 22057 | Tomato | + | + | + | |
Tom999 | ICMP 22082 | Tomato | + | + | + | |
CFgs5 | − | Soybean | + | + | + | |
CFgs6 | − | Soybean | + | + | + | |
CFgs12 | − | Soybean | + | + | + | |
CFgs14 | − | Soybean | + | + | + | |
CFgs15 | − | Soybean | + | + | + | |
CFgs18 | − | Soybean | + | + | + | |
Curtobacterium flaccumfaciens | Tom827 | ICMP 22084 | Tomato | − | − | − |
Xeu15 | ICMP 21400 | Chilli pepper | − | − | − | |
Cmmeg20 | ICMP 22056 | Eggplant | − | − | − | |
CFha4 | − | Sunflower | − | − | − | |
CFha5 | − | Sunflower | − | − | − | |
CFha8 | − | Sunflower | − | − | − | |
Curtobacterium flaccumfaciens pv. betae (Cfb) | Type | ICMP 2594 | Red beet | − | − | − |
Curtobacterium flaccumfaciens pv. ilicis (Cfi) | Type | ICMP 2608 | American holly | − | − | − |
Curtobacterium flaccumfaciens pv. oortii (Cfo) | Type | ICMP 2632 | Tulip | − | − | − |
Curtobacterium flaccumfaciens pv. poinsettiae (Cfp) | Type | ICMP 2566 | Poinsettia | − | − | − |
Clavibacter michiganensis subsp. michiganensis (Cmm) | Type | ICMP 2550 | Tomato | − | − | − |
Pseudomonas savastanoi pv. phaseolicola (Pph) | Type | NCPPB 1449 | Lablab purpureus | − | − | − |
Xanthomonas axonopodis bbpv. phaseoli (Xap) | Type | NCPPB 3035 | Common bean | − | − | − |
Primers Name | Type | Primer Sequence 5′-3′ | Length (bp) | Tm (°C) | GC (%) | 5’ ΔG (kcal/mol) | 3’ ΔG (kcal/mol) |
---|---|---|---|---|---|---|---|
CffF3 | Forward outer | CGTTAGTGAAGGCTGACGAA | 20 | 59.3 | 50 | −4.51 | −5.26 |
CffB3 | Reverse outer | TTCCCGGTGTTCAGTTGAC | 19 | 59.2 | 53 | −6.14 | −4.67 |
CffFIP (F1c + F2) | Forward inner | GTTTGCATCCGTACGGGGCG-ACTAGCACCGACGGAACC | 38 (20 + 18) | 65.8; 60.6 | 65; 61 | −5.17; −4.18 | −7.97; −5.46 |
CffBIP (B1c + B2) | Reverse inner | TTCGGTCCTGCAGTTAGTCAGC-GAATAGTTCGCGGCGTGG | 40 (22 + 18) | 64.2; 60.2 | 55; 61 | −5.69; −3.08 | −5.75; −7.18 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tegli, S.; Biancalani, C.; Ignatov, A.N.; Osdaghi, E. A Powerful LAMP Weapon against the Threat of the Quarantine Plant Pathogen Curtobacterium flaccumfaciens pv. flaccumfaciens. Microorganisms 2020, 8, 1705. https://doi.org/10.3390/microorganisms8111705
Tegli S, Biancalani C, Ignatov AN, Osdaghi E. A Powerful LAMP Weapon against the Threat of the Quarantine Plant Pathogen Curtobacterium flaccumfaciens pv. flaccumfaciens. Microorganisms. 2020; 8(11):1705. https://doi.org/10.3390/microorganisms8111705
Chicago/Turabian StyleTegli, Stefania, Carola Biancalani, Aleksandr N. Ignatov, and Ebrahim Osdaghi. 2020. "A Powerful LAMP Weapon against the Threat of the Quarantine Plant Pathogen Curtobacterium flaccumfaciens pv. flaccumfaciens" Microorganisms 8, no. 11: 1705. https://doi.org/10.3390/microorganisms8111705