Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
2.2. Construction of New Expression Vectors
2.3. Cloning of pECXT99A and pVWEx1-Based Expression Vectors
2.4. Fluorescence Analysis
2.5. SDS-PAGE
2.6. Enzyme Assay for Xylose Isomerase XylA
2.7. Sarcosine Quantification
3. Results
3.1. Screening of Strong Constitutive Promoters in the pECXT99A-Based Vector System
3.2. Improving Plasmid-Borne Inducible Gene Expression in C. glutamicum by Combination of a Stronger Promoter with Increased Plasmid Copy Number
3.3. Fast Production of Sarcosine from Xylose by Application of the Newly Constructed pECXT_Psyn
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kinoshita, S.; Udaka, S.; Shimono, M. Studies on the amino acid fermentation. Production of L-glutamic acid by various microorganisms. J. Gen. Appl. Microbiol. 1957, 3, 193–205. [Google Scholar] [CrossRef]
- Kirchner, O.; Tauch, A. Tools for genetic engineering in the amino acid-producing bacterium Corynebacterium glutamicum. J. Biotechnol. 2003, 104, 287–299. [Google Scholar] [CrossRef]
- Becker, J.; Rohles, C.M.; Wittmann, C. Metabolically engineered Corynebacterium glutamicum for bio-based production of chemicals, fuels, materials, and healthcare products. Metab. Eng. 2018, 50, 122–141. [Google Scholar] [CrossRef] [PubMed]
- Heider, S.A.; Wendisch, V.F. Engineering microbial cell factories: Metabolic engineering of Corynebacterium glutamicum with a focus on non-natural products. Biotechnol. J. 2015, 10, 1170–1184. [Google Scholar] [CrossRef]
- Wendisch, V.F. Metabolic engineering advances and prospects for amino acid production. Metab. Eng. 2020, 58, 17–34. [Google Scholar] [CrossRef] [PubMed]
- Pérez-García, F.; Peters-Wendisch, P.; Wendisch, V.F. Engineering Corynebacterium glutamicum for fast production of L-lysine and L-pipecolic acid. Appl. Microbiol. Biotechnol. 2016, 100, 8075–8090. [Google Scholar] [CrossRef] [PubMed]
- Zahoor, A.; Otten, A.; Wendisch, V.F. Metabolic engineering of Corynebacterium glutamicum for glycolate production. J. Biotechnol. 2014, 192, 366–375. [Google Scholar] [CrossRef]
- Wieschalka, S.; Blombach, B.; Bott, M.; Eikmanns, B.J. Bio-based production of organic acids with Corynebacterium glutamicum. Microb. Biotechnol. 2013, 6, 87–102. [Google Scholar] [CrossRef] [Green Version]
- Frohwitter, J.; Heider, S.A.; Peters-Wendisch, P.; Beekwilder, J.; Wendisch, V.F. Production of the sesquiterpene (+)-valencene by metabolically engineered Corynebacterium glutamicum. J. Biotechnol. 2014, 191, 205–213. [Google Scholar] [CrossRef]
- Henke, N.A.; Wendisch, V.F. Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein. Mar. Drugs 2019, 17, 621. [Google Scholar] [CrossRef] [Green Version]
- Mindt, M.; Heuser, M.; Wendisch, V.F. Xylose as preferred substrate for sarcosine production by recombinant Corynebacterium glutamicum. Bioresour. Technol. 2019, 281, 135–142. [Google Scholar] [CrossRef]
- Wendisch, V.F.; Brito, L.F.; Gil Lopez, M.; Hennig, G.; Pfeifenschneider, J.; Sgobba, E.; Veldmann, K.H. The flexible feedstock concept in Industrial Biotechnology: Metabolic engineering of Escherichia coli, Corynebacterium glutamicum, Pseudomonas, Bacillus and yeast strains for access to alternative carbon sources. J. Biotechnol. 2016, 234, 139–157. [Google Scholar] [CrossRef] [PubMed]
- Rittmann, D.; Lindner, S.N.; Wendisch, V.F. Engineering of a glycerol utilization pathway for amino acid production by Corynebacterium glutamicum. Appl. Environ. Microbiol. 2008, 74, 6216–6222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meiswinkel, T.M.; Rittmann, D.; Lindner, S.N.; Wendisch, V.F. Crude glycerol-based production of amino acids and putrescine by Corynebacterium glutamicum. Bioresour. Technol. 2013, 145, 254–258. [Google Scholar] [CrossRef] [PubMed]
- Hennig, G.; Haupka, C.; Brito, L.F.; Rückert, C.; Cahoreau, E.; Heux, S.; Wendisch, V.F. Methanol-Essential Growth of Corynebacterium glutamicum: Adaptive Laboratory Evolution Overcomes Limitation due to Methanethiol Assimilation Pathway. Int. J. Mol. Sci. 2020, 21, 3617. [Google Scholar] [CrossRef]
- Seibold, G.; Auchter, M.; Berens, S.; Kalinowski, J.; Eikmanns, B.J. Utilization of soluble starch by a recombinant Corynebacterium glutamicum strain: Growth and lysine production. J. Biotechnol. 2006, 124, 381–391. [Google Scholar] [CrossRef]
- Anusree, M.; Wendisch, V.F.; Nampoothiri, K.M. Co-expression of endoglucanase and β-glucosidase in Corynebacterium glutamicum DM1729 towards direct lysine fermentation from cellulose. Bioresour. Technol. 2016, 213, 239–244. [Google Scholar] [CrossRef]
- Gopinath, V.; Meiswinkel, T.M.; Wendisch, V.F.; Nampoothiri, K.M. Amino acid production from rice straw and wheat bran hydrolysates by recombinant pentose-utilizing Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2011, 92, 985–996. [Google Scholar] [CrossRef]
- Gopinath, V.; Murali, A.; Dhar, K.S.; Nampoothiri, K.M. Corynebacterium glutamicum as a potent biocatalyst for the bioconversion of pentose sugars to value-added products. Appl. Microbiol. Biotechnol. 2012, 93, 95–106. [Google Scholar] [CrossRef]
- Henke, N.A.; Wichmann, J.; Baier, T.; Frohwitter, J.; Lauersen, K.J.; Risse, J.M.; Peters-Wendisch, P.; Kruse, O.; Wendisch, V.F. Patchoulol Production with Metabolically Engineered Corynebacterium glutamicum. Genes (Basel) 2018, 9, 219. [Google Scholar] [CrossRef] [Green Version]
- Henke, N.A.; Heider, S.A.; Peters-Wendisch, P.; Wendisch, V.F. Production of the Marine Carotenoid Astaxanthin by Metabolically Engineered Corynebacterium glutamicum. Mar. Drugs 2016, 14, 124. [Google Scholar] [CrossRef] [PubMed]
- Gauttam, R.; Desiderato, C.; Jung, L.; Shah, A.; Eikmanns, B.J. A step forward: Compatible and dual-inducible expression vectors for gene co-expression in Corynebacterium glutamicum. Plasmid 2019, 101, 20–27. [Google Scholar] [CrossRef] [PubMed]
- Goldbeck, O.; Seibold, G.M. Construction of pOGOduet—An inducible, bicistronic vector for synthesis of recombinant proteins in Corynebacterium glutamicum. Plasmid 2018, 95, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Knoppova, M.; Phensaijai, M.; Vesely, M.; Zemanova, M.; Nesvera, J.; Patek, M. Plasmid vectors for testing in vivo promoter activities in Corynebacterium glutamicum and Rhodococcus erythropolis. Curr. Microbiol. 2007, 55, 234–239. [Google Scholar] [CrossRef]
- Schäfer, A.; Tauch, A.; Jäger, W.; Kalinowski, J.; Thierbach, G.; Puhler, A. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: Selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 1994, 145, 69–73. [Google Scholar] [CrossRef]
- Eggeling, L.; Bott, M. (Eds.) Handbook of Corynebacterium Glutamicum; CRC Press Taylor & Francis Group: Boca Raton, FL, USA, 2005. [Google Scholar]
- Tauch, A.; Kirchner, O.; Loffler, B.; Gotker, S.; Puhler, A.; Kalinowski, J. Efficient electrotransformation of Corynebacterium diphtheriae with a mini-replicon derived from the Corynebacterium glutamicum plasmid pGA1. Curr. Microbiol. 2002, 45, 362–367. [Google Scholar] [CrossRef]
- Peters-Wendisch, P.G.; Schiel, B.; Wendisch, V.F.; Katsoulidis, E.; Mockel, B.; Sahm, H.; Eikmanns, B.J. Pyruvate carboxylase is a major bottleneck for glutamate and lysine production by Corynebacterium glutamicum. J. Mol. Microbiol. Biotechnol. 2001, 3, 295–300. [Google Scholar]
- Oehler, S.; Amouyal, M.; Kolkhof, P.; von Wilcken-Bergmann, B.; Müller-Hill, B. Quality and position of the three lac operators of E. coli define efficiency of repression. EMBO J. 1994, 13, 3348–3355. [Google Scholar] [CrossRef]
- Hashiro, S.; Yasueda, H. Plasmid copy number mutation in repA gene encoding RepA replication initiator of cryptic plasmid pHM1519 in Corynebacterium glutamicum. Biosci. Biotechnol. Biochem. 2018, 82, 2212–2224. [Google Scholar] [CrossRef]
- Patek, M.; Eikmanns, B.J.; Patek, J.; Sahm, H. Promoters from Corynebacterium glutamicum: Cloning, molecular analysis and search for a consensus motif. Microbiology 1996, 142, 1297–1309. [Google Scholar] [CrossRef] [Green Version]
- Dostalova, H.; Holatko, J.; Busche, T.; Rucka, L.; Rapoport, A.; Halada, P.; Nesvera, J.; Kalinowski, J.; Patek, M. Assignment of sigma factors of RNA polymerase to promoters in Corynebacterium glutamicum. AMB Express 2017, 7, 133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taniguchi, H.; Busche, T.; Patschkowski, T.; Niehaus, K.; Patek, M.; Kalinowski, J.; Wendisch, V.F. Physiological roles of sigma factor SigD in Corynebacterium glutamicum. BMC Microbiol. 2017, 17, 158. [Google Scholar] [CrossRef] [PubMed]
- Busche, T.; Silar, R.; Pičmanová, M.; Pátek, M.; Kalinowski, J. Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum. BMC Genom. 2012, 13, 445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patek, M.; Nesvera, J. Sigma factors and promoters in Corynebacterium glutamicum. J. Biotechnol. 2011, 154, 101–113. [Google Scholar] [CrossRef]
- Pátek, M.; Holátko, J.; Busche, T.; Kalinowski, J.; Nešvera, J. Corynebacterium glutamicum promoters: A practical approach. Microb. Biotechnol. 2013, 6, 103–117. [Google Scholar] [CrossRef]
- Yim, S.S.; An, S.J.; Kang, M.; Lee, J.; Jeong, K.J. Isolation of fully synthetic promoters for high-level gene expression in Corynebacterium glutamicum. Biotechnol. Bioeng. 2013, 110, 2959–2969. [Google Scholar] [CrossRef]
- Rytter, J.V.; Helmark, S.; Chen, J.; Lezyk, M.J.; Solem, C.; Jensen, P.R. Synthetic promoter libraries for Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2014, 98, 2617–2623. [Google Scholar] [CrossRef] [Green Version]
- Abe, S.; Takayarna, K.; Kinoshita, S. Taxonomical studies on glutamic acid producing bacteria. J. Gen. Appl. Microbiol. 1967, 13, 279–301. [Google Scholar] [CrossRef]
- Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 1983, 166, 557–580. [Google Scholar] [CrossRef]
- Stansen, C.; Uy, D.; Delaunay, S.; Eggeling, L.; Goergen, J.L.; Wendisch, V.F. Characterization of a Corynebacterium glutamicum lactate utilization operon induced during temperature-triggered glutamate production. Appl. Environ. Microbiol. 2005, 71, 5920–5928. [Google Scholar] [CrossRef] [Green Version]
- Sgobba, E.; Stumpf, A.K.; Vortmann, M.; Jagmann, N.; Krehenbrink, M.; Dirks-Hofmeister, M.E.; Moerschbacher, B.; Philipp, B.; Wendisch, V.F. Synthetic Escherichia coli-Corynebacterium glutamicum consortia for l-lysine production from starch and sucrose. Bioresour. Technol. 2018, 260, 302–310. [Google Scholar] [CrossRef] [PubMed]
- Veldmann, K.H.; Dachwitz, S.; Risse, J.M.; Lee, J.H.; Sewald, N.; Wendisch, V.F. Bromination of L-tryptophan in a Fermentative Process With Corynebacterium glutamicum. Front. Bioeng. Biotechnol. 2019, 7, 219. [Google Scholar] [CrossRef] [PubMed]
- Gibson, D.G.; Young, L.; Chuang, R.Y.; Venter, J.C.; Hutchison, C.A., 3rd; Smith, H.O. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 2009, 6, 343–345. [Google Scholar] [CrossRef] [PubMed]
- Van der Rest, M.E.; Lange, C.; Molenaar, D. A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Biot. 1999, 52, 541–545. [Google Scholar] [CrossRef]
- Mindt, M.; Walter, T.; Risse, J.M.; Wendisch, V.F. Fermentative Production of N-Methylglutamate From Glycerol by Recombinant Pseudomonas putida. Front. Bioeng. Biotechnol. 2018, 6, 159. [Google Scholar] [CrossRef] [Green Version]
- Miwa, K.; Matsui, H.; Terabe, M.; Nakamori, S.; Sano, K.; Momose, H. Cryptic Plasmids in Glutamic Acid-producing Bacteria. Agric. Biol. Chem. 1984, 48, 2901–2903. [Google Scholar] [CrossRef]
- Youn, J.W.; Jolkver, E.; Kramer, R.; Marin, K.; Wendisch, V.F. Characterization of the dicarboxylate transporter DctA in Corynebacterium glutamicum. J. Bacteriol. 2009, 191, 5480–5488. [Google Scholar] [CrossRef] [Green Version]
- Taniguchi, H.; Wendisch, V.F. Exploring the role of sigma factor gene expression on production by Corynebacterium glutamicum: Sigma factor H and FMN as example. Front. Microbiol. 2015, 6, 740. [Google Scholar] [CrossRef] [Green Version]
- Binder, D.; Frohwitter, J.; Mahr, R.; Bier, C.; Grunberger, A.; Loeschcke, A.; Peters-Wendisch, P.; Kohlheyer, D.; Pietruszka, J.; Frunzke, J.; et al. Light-Controlled Cell Factories: Employing Photocaged Isopropyl-beta-d-Thiogalactopyranoside for Light-Mediated Optimization of lac Promoter-Based Gene Expression and (+)-Valencene Biosynthesis in Corynebacterium glutamicum. Appl. Environ. Microbiol. 2016, 82, 6141–6149. [Google Scholar] [CrossRef] [Green Version]
- Wendisch, V.F.; Spies, M.; Reinscheid, D.J.; Schnicke, S.; Sahm, H.; Eikmanns, B.J. Regulation of acetate metabolism in Corynebacterium glutamicum: Transcriptional control of the isocitrate lyase and malate synthase genes. Arch. Microbiol. 1997, 168, 262–269. [Google Scholar] [CrossRef]
- Cramer, A.; Gerstmeir, R.; Schaffer, S.; Bott, M.; Eikmanns, B.J. Identification of RamA, a novel LuxR-type transcriptional regulator of genes involved in acetate metabolism of Corynebacterium glutamicum. J. Bacteriol. 2006, 188, 2554–2567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Auchter, M.; Cramer, A.; Huser, A.; Ruckert, C.; Emer, D.; Schwarz, P.; Arndt, A.; Lange, C.; Kalinowski, J.; Wendisch, V.F.; et al. RamA and RamB are global transcriptional regulators in Corynebacterium glutamicum and control genes for enzymes of the central metabolism. J. Biotechnol. 2011, 154, 126–139. [Google Scholar] [CrossRef] [PubMed]
- Jensen, J.V.; Wendisch, V.F. Ornithine cyclodeaminase-based proline production by Corynebacterium glutamicum. Microb. Cell Fact. 2013, 12, 63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfeifer-Sancar, K.; Mentz, A.; Ruckert, C.; Kalinowski, J. Comprehensive analysis of the Corynebacterium glutamicum transcriptome using an improved RNAseq technique. BMC Genom. 2013, 14, 888. [Google Scholar] [CrossRef] [Green Version]
- Espah Borujeni, A.; Cetnar, D.; Farasat, I.; Smith, A.; Lundgren, N.; Salis, H.M. Precise quantification of translation inhibition by mRNA structures that overlap with the ribosomal footprint in N-terminal coding sequences. Nucleic Acids Res. 2017, 45, 5437–5448. [Google Scholar] [CrossRef]
- Salis, H.M.; Mirsky, E.A.; Voigt, C.A. Automated design of synthetic ribosome binding sites to control protein expression. Nat. Biotechnol. 2009, 27, 946–950. [Google Scholar] [CrossRef] [Green Version]
- Kosobokova, E.N.; Skrypnik, K.A.; Kosorukov, V.S. Overview of Fusion Tags for Recombinant Proteins. Biochemistry (Mosc) 2016, 81, 187–200. [Google Scholar] [CrossRef]
- Widakowich, G.; Zhang, C.; Harris, S.; Mitri, K.; Powers, G.; Troung, K.S.; Hearn, M.T. Effects of IMAC specific peptide tags on the stability of recombinant green fluorescent protein. Biotechnol. Prog. 2011, 27, 1048–1053. [Google Scholar] [CrossRef]
- Cooper, C.D.O.; Marsden, B.D. N- and C-Terminal Truncations to Enhance Protein Solubility and Crystallization: Predicting Protein Domain Boundaries with Bioinformatics Tools. In Heterologous Gene Expression in E.coli: Methods and Protocols; Burgess-Brown, N.A., Ed.; Springer: New York, NY, USA, 2017; pp. 11–31. [Google Scholar] [CrossRef]
- Speck, J.; Hecky, J.; Tam, H.K.; Arndt, K.M.; Einsle, O.; Müller, K.M. Exploring the molecular linkage of protein stability traits for enzyme optimization by iterative truncation and evolution. Biochemistry 2012, 51, 4850–4867. [Google Scholar] [CrossRef]
- Sinha, R.; Shukla, P. Current Trends in Protein Engineering: Updates and Progress. Curr. Protein Pept. Sci. 2019, 20, 398–407. [Google Scholar] [CrossRef]
- Han, S.O.; Inui, M.; Yukawa, H. Expression of Corynebacterium glutamicum glycolytic genes varies with carbon source and growth phase. Microbiology 2007, 153, 2190–2202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Liu, J.; Ni, X.; Lei, Y.; Zheng, P.; Diao, A. Screening efficient constitutive promoters in Corynebacterium glutamicum based on time-series transcriptome analysis. Sheng Wu Gong Cheng Xue Bao 2018, 34, 1760–1771. [Google Scholar] [CrossRef] [PubMed]
- Lee, J. Development and characterization of expression vectors for Corynebacterium glutamicum. J. Microbiol. Biotechnol. 2014, 24, 70–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kind, S.; Jeong, W.K.; Schroder, H.; Wittmann, C. Systems-wide metabolic pathway engineering in Corynebacterium glutamicum for bio-based production of diaminopentane. Metab. Eng. 2010. [Google Scholar] [CrossRef] [PubMed]
- Bakkes, P.J.; Ramp, P.; Bida, A.; Dohmen-Olma, D.; Bott, M.; Freudl, R. Improved pEKEx2-derived expression vectors for tightly controlled production of recombinant proteins in Corynebacterium glutamicum. Plasmid 2020, 112, 102540. [Google Scholar] [CrossRef]
- Mindt, M.; Risse, J.M.; Gruß, H.; Sewald, N.; Eikmanns, B.J.; Wendisch, V.F. One-step process for production of N-methylated amino acids from sugars and methylamine using recombinant Corynebacterium glutamicum as biocatalyst. Sci. Rep. 2018, 8, 12895. [Google Scholar] [CrossRef]
Strain | Characteristics of strains and plasmids | Reference |
---|---|---|
C. glutamicum strains | ||
WT | Wild type, ATCC 13032 | [39] |
SAR3 | WT ΔaceB icdGTG (pVWEx1-dpkA_RBSopt) (pECXT99A-xylAB) | [11] |
SAR3* | WT ΔaceB icdGTG (pVWEx1-dpkA_RBSopt) (pECXT-Psyn-xylAB) | This work |
Other strains | ||
E. coli DH5α | F-thi-1 endA1 hsdr17(r-, m-) supE44 ΔlacU169 (Φ80lacZΔM15) recA1 gyrA96 | [40] |
Plasmids | ||
pEKEx3 | SpecR, PtrclacIq, pBL1 oriVCg, C. glutamicum/E. coli expression shuttle vector | [41] |
pEKEx3-gfpUV | pEKEx3 derivative for inducible expression of gfpUV from Ptac promoter | [42] |
pECXT99A (pECXT) | TetR, PtrclacIq, pGA1 oriVCg, C. glutamicum/E. coli expression shuttle vector | [2] |
pECXT99A-gfpUV | pECXT99A derivative for inducible expression of gfpUV from Ptrc promoter | This work |
pECXT99A-xylAB | pECXT99A derivative for inducible expression of xylA from Xanthomonas campestris and xylB from C. glutamicum from Ptrc promoter | [43] |
pECXT-Ppgk | pECXT99A derivative for constitutive expression from C. glutamicum pgk promoter | This work |
pECXT-PilvC | pECXT99A derivative for constitutive expression from C. glutamicum ilvC promoter | This work |
pECXT-PsodA | pECXT99A derivative for constitutive expression from C. glutamicum sodA promoter | This work |
pECXT-PgapA | pECXT99A derivative for constitutive expression from C. glutamicum gapA promoter | This work |
pECXT-Ptuf | pECXT99A derivative for constitutive expression from C. glutamicum tuf promoter | This work |
pECXT-PH36 | pECXT99A derivative for constitutive expression from synthetic PH36 promoter | This work |
pECXT-P45 | pECXT99A derivative for constitutive expression from synthetic P45 promoter | This work |
pECXT-Psyn | pECXT99A derivative for constitutive expression from synthetic Psyn promoter | This work |
pECXT-Ppgk-gfpUV | pECXT99A derivative for constitutive expression of gfpUV from C. glutamicum pgk promoter | This work |
pECXT-PilvC-gfpUV | pECXT99A derivative for constitutive expression of gfpUV from C. glutamicum ilvC promoter | This work |
pECXT-PsodA-gfpUV | pECXT99A derivative for constitutive expression of gfpUV from C. glutamicum sodA promoter | This work |
pECXT-PgapA-gfpUV | pECXT99A derivative for constitutive expression of gfpUV from C. glutamicum gapA promoter | This work |
pECXT-Ptuf-gfpUV | pECXT99A derivative for constitutive expression of gfpUV from C. glutamicum tuf promoter | This work |
pECXT-PH36-gfpUV | pECXT99A derivative for constitutive expression of gfpUV from synthetic PH36 promoter | This work |
pECXT-P45-gfpUV | pECXT99A derivative for constitutive expression of gfpUV from synthetic P45 promoter | This work |
pECXT-Psyn-gfpUV | pECXT99A derivative for constitutive expression of gfpUV from synthetic Psyn promoter | This work |
pECXT-Psyn-xylAB | pECXT99A derivative for constitutive expression of xylA from Xanthomonas campestris and xylB from C. glutamicum from synthetic Psyn promoter | This work |
pVWEx1 | KmR, PtaclacIq, pHM1519 oriVCg, C. glutamicum/E. coli expression shuttle vector | [28] |
pVWEx4 | pVWEx1 derivative with mutation repA | This work |
pVWEx6 | pVWEx4 derivative with Psyn promoter and lac operator for IPTG inducible expression | This work |
pVWEx1-gfpUV | pVWEx1 derivative for IPTG-inducible expression of gfpUV from Ptac promoter | [42] |
pVWEx1-dpkA_RBSopt | pVWEx1 derivative for IPTG-inducible expression of dpkA from P. putida KT2440 and change of its start codon GTG to ATG and an RBS optimised for C. glutamicum | [11] |
pVWEx4-gfpUV | pVWEx4 derivative for IPTG-inducible expression of gfpUV from Ptac promoter | This work |
pVWEx6-gfpUV | pVWEx6 derivative for IPTG-inducible expression of gfpUV from Psyn promoter | This work |
Oligonucleotide | Target | Sequence (5′ → 3′) |
---|---|---|
HN12 | Ptuf-fw | CTGTGCGGTATTTCACACCGCAGTTTTAGCGTGTCAGTAGGC |
HN13 | Ptuf-rv | CCGGGTACCGAGCTCGAATTCCATGTTACTGAATCCTAAGGGCAACG |
HN14 | PgapA-fw | CTGTGCGGTATTTCACACCGCAGTGTCTGTATGATTTTGCATCTG |
HN15 | PgapA-rv | CCGGGTACCGAGCTCGAATTCCATGCACGCACCAAACCTACTCACA |
HN16 | PilvC-fw | CTGTGCGGTATTTCACACCGCAATCCGGACAGATTGCACTCAAC |
HN17 | PilvC-rv | CCGGGTACCGAGCTCGAATTCCATGCATTATTGTTCTACCACACACATG |
HN30 | PsodA-fw | CTGTGCGGTATTTCACACCGCATACTTAGCTGCCAATTATTCCG |
HN31 | PsodA-rv | CCGGGTACCGAGCTCGAATTCCATGCCGCACCGAGCATATACATCT |
HN97 | Ppgk-fw | CTGTGCGGTATTTCACACCGCATAACGTGGGCGATCGATGC |
HN98 | Ppgk-rv | CCGGGTACCGAGCTCGAATTCCATGGCCGTACTCCTTGGAGATTTG |
HA02 | P45-fw | CTGTGCGGTATTTCACACCGCATTGGTCAGGGATTTTTTCCCG |
HA03 | P45-rv | CCGGGTACCGAGCTCGAATTCCATGGAACTTCTTCGTCACTTACTTTA |
HA04 | PH36-fw | CTGTGCGGTATTTCACACCGCACAAAAGCTGGGTACCTCTATCTG |
HA05 | PH36-rv | CCGGGTACCGAGCTCGAATTCCATGCATGCTACTCCTACCAACCAAG |
HA06 | Psyn-fw | GCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATTGACATTAATTTGAATCTGTGTTAT |
HA07 | Psyn-rv | CTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCCATGGAACCATTATAACACAGATTCAAA |
HA36 | repA-fw | AAAATCGCTTGACCATTGCAGGTTG |
HA37 | repA-rv | CTTTAGCTTTCCTAGCTTGTCGTTGAC |
HA40 | repA-seq | TGCTCGTCAGACAGAGACGCAG |
N101 | pVWEx4-fw | ATGCATGCCGCTTCGCCTTCGATTGACATTAATTTGAATCTGTGTTATAATGGTTC |
N102 | pVWEx4-rv | CGGCCAGTGAATTCGAGCTCGAAATTGTTATCCGCTCACAATTCCAGGAACCATTATAACACAGATTCAA |
N103 | xylAB-fw | ATGGAATTCGAGCTCGGTACCCGGGGAAAGGAGGCCCTTCAGATGAGCAACACCGTTTTCATC |
N104 | xylAB-rv | CTGCAGGTCGACTCTAGAGGATCTTAGTACCAACCCTGCGTTGC |
N105 | Psyn-fw2 | ATGCATGCCGCTTCGCCTTCGTTGACATTAATTTGAATCTGTGTTATAATGGTTC |
N106 | Psyn-rv2 | GGCCAGTGAATTCGAGCTCGCTGCAGGTCGACTCTAGAGGATC |
HN49 | gfpUV-fw | ATGGAATTCGAGCTCGGTACCCGGGGAAAGGAGGCCCTTCAGATGAGTAAAGGAGAAGAACTTTTCA |
HN50 | gfpUV-rv | GCATGCCTGCAGGTCGACTCTAGAGGATCTTATTTGTAGAGCTCATCCATGC |
582 | ATCTTCTCTCATCCTCCA |
Plasmid | pEKEx3 | pVWEx1 | pVWEx4 | pVWEx6 | pECXT99A | pECXT_Psyn |
---|---|---|---|---|---|---|
Expression | Inducible | Inducible | Inducible | Inducible | Inducible | Constitutive |
Repressor gene | lacIq | lacIq | lacIq | lacIq | lacIq | - |
Promoter | Ptac | Ptac | Ptac | Psyn | Ptrc | Psyn |
Induction factor | 6 | 76 | 121 | 51 | 40 | non |
Maximal expression | 64 | 99 | 145 | 410 | 47 | 140 |
Origin for Cg | pBL1 | pHM1519 | pHM1519 * | pHM1519 * | pGA1 mini | pGA1 mini |
Origin for Ec | ColE1 ori | ColE1 ori | ColE1 ori | ColE1 ori | pMB1 | pMB1 |
Resistance | Spec | Kan | Kan | Kan | Tet | Tet |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Henke, N.A.; Krahn, I.; Wendisch, V.F. Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum. Microorganisms 2021, 9, 204. https://doi.org/10.3390/microorganisms9010204
Henke NA, Krahn I, Wendisch VF. Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum. Microorganisms. 2021; 9(1):204. https://doi.org/10.3390/microorganisms9010204
Chicago/Turabian StyleHenke, Nadja A., Irene Krahn, and Volker F. Wendisch. 2021. "Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum" Microorganisms 9, no. 1: 204. https://doi.org/10.3390/microorganisms9010204
APA StyleHenke, N. A., Krahn, I., & Wendisch, V. F. (2021). Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum. Microorganisms, 9(1), 204. https://doi.org/10.3390/microorganisms9010204