Effects of pH on the Properties of Membrane Vesicles Including Glucosyltransferase in Streptococcus mutans
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture Conditions
2.2. Human Saliva Collection
2.3. Extraction of MVs
2.4. Scanning Electron Microscopy (SEM)
2.5. Biofilm Formation Assay
2.6. Observation of Live Cells and Glucan in Biofilm Formation
2.7. SDS-PAGE and Western Blotting
2.8. Zymography
2.9. Peptide Mass Fingerprinting (PMF) Analyses of MVs
2.10. Total RNA Extraction and Real-Time PCR
2.11. Statistical Analysis
3. Results
3.1. Effects of Initial pH on the Formation of MVs in Growth Condition
3.2. Biofilm Formation Induced by the Addition of MVs Samples from S. mutans Grown under Various Initial Conditions
3.3. Role of Gtfs in Biofilm Formation Induced by the Addition of MVs
3.4. Search for Other Factors in Biofilm Development Induced by the Addition of MVs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hamada, S.; Slade, H.D. Biology, immunology, and cariogenicity of Streptococcus mutans. Microbiol. Rev. 1980, 44, 331–384. [Google Scholar] [CrossRef]
- Nyvad, B.; Kilian, M. Comparison of the initial streptococcal microflora on dental enamel in caries-active and in caries-inactive individuals. Caries Res. 1009, 24, 267–272. [Google Scholar] [CrossRef]
- Loesche, W.J. Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 1986, 50, 353–380. [Google Scholar] [CrossRef]
- Koo, H.; Xiao, J.; Klein, M.I.; Jeon, J.G. Exopolysaccharides produced by Streptococcus mutans glucosyltransferases modulate the establishment of microcolonies within multispecies biofilms. J. Bacteriol. 2010, 192, 3024–3032. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bowen, W.H.; Koo, H. Biology of Streptococcus mutans-Derived Glucosyltransferases: Role in extracellular matrix formation of cariogenic biofilms. Caries Res. 2011, 45, 69–86. [Google Scholar] [CrossRef] [PubMed]
- Biller, S.J.; Schubotz, F.; Roggensack, S.E.; Thompson, S.W.; Summons, R.E.; Chisholm, S.W. Bacterial vesicles in marine ecosystems. Science 2014, 343, 183–186. [Google Scholar] [CrossRef] [PubMed]
- Berleman, J.; Auer, M. The role of bacterial outer membrane vesicles for intra- and interspecies delivery. Environ. Microbiol. 2013, 15, 347–354. [Google Scholar] [CrossRef]
- Tashiro, Y.; Uchiyama, H.; Nomura, N. Multifunctional membrane vesicles in Pseudomonas aeruginosa. Environ. Microbiol. 2012, 14, 1349–1362. [Google Scholar] [CrossRef] [PubMed]
- Brown, L.; Wolf, J.M.; Prados-Rosales, R.; Casadevall, A. Through the wall: Extracellular vesicles in Gram-positive bacteria, mycobacteria and fungi. Nat. Rev. Microbiol. 2015, 13, 620–630. [Google Scholar] [CrossRef] [Green Version]
- Liao, S.; Klein, M.I.; Heim, K.P.; Fan, Y.; Bitoun, J.P.; Ahn, S.J.; Burne, R.A.; Koo, H.; Brady, L.J.; Wen, Z.T. Streptococcus mutans extracellular DNA is upregulated during growth in biofilms, actively released via membrane vesicles, and influenced by components of the protein secretion machinery. J. Bacteriol. 2014. 196, 2355–2366. [CrossRef] [Green Version]
- Senpuku, H.; Nakamura, T.; Iwabuchi, Y.; Hirayama, S.; Nakao, R.; Ohnishi, M. Effects of complex DNA and MVs with GTF extracted from Streptococcus mutans on the olal biofilm. Molecules 2019, 24, 3131. [Google Scholar] [CrossRef] [Green Version]
- Bonnington, K.E.; Kuehn, M.J. Protein selection and export via outer membrane vesicles, Biochim. Biophys. Acta—Mol. Cell Res. 2014, 1843, 1612–1619. [Google Scholar]
- Ellis, T.N.; Kuehn, M.J. Virulence and immunomodulatory roles of bacterial outer membrane vesicles. Microbiol. Mol. Biol. Rev. 2010, 74, 81–94. [Google Scholar] [CrossRef] [Green Version]
- Bai, D.; Nakao, R.; Ito, A.; Uematsu, H.; Senpuku, H. Immunoreactive antigens recognized in serum samples from mice intranasally immunized with Porphyromonas gingivalis outer membrane vesicles. Pathog. Dis. 2015, 73, ftu006. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.; Chanda, W.; Zhong, M. The relationship between biofilm and outer membrane vesicles: A novel therapy overview. FEMS Microbiol. Lett. 2015, 362, fnv117. [Google Scholar] [CrossRef]
- Yonezawa, H.; Osaki, T.; Woo, T.; Kurata, S.; Zaman, C.; Hojo, F.; Hanawa, T.; Kato, S.; Kamiya, S. Analysis of outer membrane vesicle protein involved in biofilm formation of Helicobacter pylori. Anaerobe 2011, 17, 388–390. [Google Scholar] [CrossRef] [PubMed]
- Van Hoek, M.L. Biofilms: An advancement in our understanding of Francisella species. Virulence 2013, 4, 833–846. [Google Scholar] [CrossRef] [Green Version]
- Murphy, K.; Park, A.J.; Hao, Y.; Brewer, D.; Lam, J.S.; Khursigara, C.M. Influence of O polysaccharides on biofilm development and outer membrane vesicle biogenesis in Pseudomonas aeruginosa PAO1. J. Bacteriol. 2014, 196, 1306–1317. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakamura, T.; Iwabuchi, Y.; Hirayama, S.; Narisawa, N.; Takenaga, F.; Nakao, R.; Senpuku, H. Roles of membrane vesicles from Streptococcus mutans for the induction of antibodies to glucosyltransferase in mucosal immunity. Microb. Pathog. 2020, 149, 104260. [Google Scholar] [CrossRef] [PubMed]
- Demuth, D.R.; Lammey, M.S.; Huck, M.; Lally, E.T.; Malamud, D. Comparison of Streptococcus mutans and Streptococcus sanguis receptors for human salivary agglutinin. Microb. Pathog. 1990, 9, 199–211. [Google Scholar] [CrossRef]
- Russell, M.W.; Mansson-Rahemtulla, B. Interaction between surface protein antigens of Streptococcus mutans and human salivary components. Oral Microbiol. Immunol. 1989, 4, 106–111. [Google Scholar] [CrossRef] [PubMed]
- Okahashi, N.; Sasakawa, C.; Yoshikawa, M.; Hamada, S.; Koga, T. Cloning of a surface protein antigen gene from serotype c Streptococcus mutans. Mol. Microbiol. 1989, 3, 221–228. [Google Scholar] [CrossRef]
- Suzuki, I.; Shimizu, T.; Senpuku, H. Role of SCFAs for fimbrillin-dependent biofilm formation of Actinomyces oris. Microorganisms 2018, 6, 114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Margolis, H.C.; Duckworth, J.H.; Moreno, E.C. Composition and buffer capacity of pooled starved plaque fluid from caries-free and caries-susceptible individuals. J. Dent. Res. 1988, 67, 1476–1482. [Google Scholar] [CrossRef]
- Bowen, W.H. The stephan curve revisited. Odontology 2013, 101, 2–8. [Google Scholar] [CrossRef]
- Feng, Y.; Licandro, H.; Martin, C.; Septier, C.; Zhao, M.; Neyraud, E.; Morzel, M. The associations between biochemical and microbiological variables and taste differ in whole saliva and in the film lining the tongue. BioMed Res. Int. 2018, 2018, 2838052. [Google Scholar] [CrossRef]
- Jin, J.; Liu, S.; Zhao, L.; Ge, K.; Mao, X.; Ren, F. Changes in ffh, uvrA, groES and dnaK mRNA abundance as a function of acid-adaptation and growth phase in Bifidobacterium longum BBMN68 isolated from healthy centenarians. Curr. Microbiol. 2011, 62, 612–617. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.; Groisman, E.A. Acidic pH sensing in the bacterial cytoplasm is required for Salmonella virulence. Mol. Microbiol. 2016, 101, 1024–1038. [Google Scholar] [CrossRef] [Green Version]
- Prost, L.R.; Daley, M.E.; Le Sage, V.; Bader, M.W.; Le Moual, H.; Klevit, R.E.; Miller, S.I. Activation of the bacterial sensor kinase PhoQ by acidic pH. Mol. Cell 2007, 26, 165–174. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; He, F.; Sun, P.; Chen, Q. Identification of unknown acid-resistant genes of oral microbiotas in patients with dental caries using metagenomics analysis. AMB Express 2021, 11, 1–10. [Google Scholar] [CrossRef]
- Cao, Y.; Zhou, Y.; Chen, D.; Wu, R.; Guo, L.; Lin, H. Proteomic and metabolic characterization of membrane vesicles derived from Streptococcus mutans at different pH values. Appl. Microbiol. Biotechnol. 2020, 104, 9733–9748. [Google Scholar] [CrossRef] [PubMed]
- De Vuyst, L.; Callewaert, R.; Crabbé, K. Primary metabolite kinetics of bacteriocin biosynthesis by Lactobacillus amylovorus and evidence for stimulation of bacteriocin production under unfavourable growth conditions. Microbiology 1996, 142, 817–827. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lemos, J.A.C.; Brown, T.A.; Burne, R.A. Effects of RelA on key virulence properties of planktonic and biofilm populations of Streptococcus mutans. Infect. Immun. 2004, 72, 1431–1440. [Google Scholar] [CrossRef] [Green Version]
- Bender, G.R.; Sutton, S.V.W.; Marquis, R.E. Acid tolerance, proton permeabilities, and membrane ATPases of oral streptococci. Infect. Immun. 1986, 53, 331–338. [Google Scholar] [CrossRef] [Green Version]
- Kuhnert, W.L.; Quivey, R.G. Genetic and biochemical characterization of the F-ATPase operon from Streptococcus sanguis 10904. J. Bacteriol. 2003, 185, 1525–1533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qiqiang, L.; Huanxin, M.; Xuejun, G. Longitudinal study of volatile fatty acids in the gingival crevicular fluid of patients with periodontitis before and after nonsurgical therapy. J. Periodontal Res. 2012, 47, 740–749. [Google Scholar] [CrossRef] [PubMed]
- Kawarai, T.; Narisawa, N.; Suzuki, Y.; Nagasawa, R.; Senpuku, H. Streptococcus mutans biofilm formation is dependent on extracellular DNA in primary low pH conditions. J. Oral Biosci. 2016, 58, 55–61. [Google Scholar] [CrossRef]
- Ajdić, D.; McShan, W.M.; McLaughlin, R.E.; Savić, G.; Chang, J.; Carson, M.B.; Primeaux, C.; Tian, R.; Kenton, S.; Jia, H.; et al. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc. Natl. Acad. Sci. USA 2002, 99, 14434–14439. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, Y.; Nagasawa, R.; Senpuku, H. Inhibiting effects of fructanase on competence-stimulating peptide-dependent quorum sensing system in Streptococcus mutans. J. Infect. Chemother. 2017, 23, 634–641. [Google Scholar] [CrossRef]
- Nagasawa, R.; Sato, T.; Nomura, N.; Nakamura, T.; Senpuku, H. Potential risk of spreading resistance genes within extracellular-DNA-dependent biofilms of Streptococcus mutans in response to cell envelope stress induced by sub-MICs of bacitracin. Appl. Environ. Microbiol. 2020, 86, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Nagasawa, R.; Sato, T.; Senpuku, H. Raffinose induces biofilm formation by Streptococcus mutans in low concentrations of sucrose by increasing production of extracellular DNA and fructan. Appl. Environ. Microbiol. 2017, 83, e00869-17. [Google Scholar] [CrossRef] [Green Version]
- Motegi, M.; Takagi, Y.; Yonezawa, H.; Kanada, N.; Terajima, J.; Watanabe, H.; Senpuku, H. Assessment of genes associated with Streptococcus mutans biofilm morphology. Appl. Environ. Microbiol. 2006, 72, 6277–6287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mattos-Graner, R.O.; Napimoga, M.H.; Fukushima, K.; Duncan, M.J.; Smith, D.J. Comparative analysis of Gtf isozyme production and diversity in isolates of Streptococcus mutans with different biofilm growth phenotypes. J. Clin. Microbiol. 2004, 42, 4586–4592. [Google Scholar] [CrossRef] [Green Version]
- Rainey, K.; Michalek, S.M.; Wen, Z.T.; Wu, H. Glycosyltransferase-mediated biofilm matrix dynamics and virulence of Streptococcus mutans. Appl. Environ. Microbiol. 2018, 85, e02247-18. [Google Scholar] [CrossRef] [Green Version]
- Murase, K.; Aikawa, C.; Nozawa, T.; Nakatake, A.; Sakamoto, K.; Kikuchi, T.; Nakagawa, I. Biological effect of Streptococcus pyogenes-released extracellular vesicles on human monocytic cells, induction of cytotoxicity, and inflammatory response. Front. Cell. Infect. Microbiol. 2021, 11, 711144. [Google Scholar] [CrossRef]
- Mohammad, M.; Nguyen, M.T.; Engdahl, C.; Na, M.; Jarneborn, A.; Hu, Z.; Karlsson, A.; Pullerits, R.; Ali, A.; Götz, F.; et al. The YIN and YANG of lipoproteins in developing and preventing infectious arthritis by Staphylococcus aureus. PLoS Pathog. 2019, 15, e1007877. [Google Scholar] [CrossRef] [PubMed]
- Olaya-Abril, A.; Prados-Rosales, R.; McConnell, M.J.; Martín-Peña, R.; González-Reyes, J.A.; Jiménez-Munguía, I.; Gómez-Gascón, L.; Fernández, J.; Luque-García, J.L.; García-Lidón, C.; et al. Characterization of protective extracellular membrane-derived vesicles produced by Streptococcus pneumoniae. J. Proteomics 2014, 106, 46–60. [Google Scholar] [CrossRef]
- Resch, U.; Tsatsaronis, J.A.; Le Rhun, A.; Stübiger, G.; Rohde, M.; Kasvandik, S.; Holzmeister, S.; Tinnefeld, P.; Nyunt Wai, S.; Charpentier, E. A two-component regulatory system impacts extracellular membrane-derived vesicle production in group a Streptococcus. MBio 2016, 7, e00207-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grande, R.; Celia, C.; Mincione, G.; Stringaro, A.; Di Marzio, J.; Colone, M.; Di Marcantonio, M.C.; Savino, L.; Puca, V.; Santoliquido, R.; et al. Detection and physicochemical characterization of membrane vesicles (MVs) of Lactobacillus reuteri DSM 17938. Front. Microbiol. 2017, 8, 1040. [Google Scholar] [CrossRef]
- Toyofuku, M.; Cárcamo-Oyarce, G.; Yamamoto, T.; Eisenstein, F.; Hsiao, C.C.; Kurosawa, M.; Gademann, K.; Pilhofer, M.; Nomura, N.; Eberl, L. Prophage-triggered membrane vesicle formation through peptidoglycan damage in Bacillus subtilis. Nat. Commun. 2017, 8, 481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rainey, M.M.; Korostyshevsky, D.; Lee, S.; Perlstein, E.O. The antidepressant sertraline targets intracellular vesiculogenic membranes in yeast. Genetics 2010, 185, 1221–1233. [Google Scholar] [CrossRef] [Green Version]
- Salmond, C.V.; Kroll, R.G.; Booth, I.R. The effect of food preservatives on pH homeostasis in Escherichia coli. J. Gen. Microbiol. 1984, 130, 2845–2850. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suzuki, I.; Shimizu, T.; Senpuku, H. Short chain fatty acids induced the type 1 and type 2 fimbrillin-dependent and fimbrillin-independent initial attachment and colonization of Actinomyces oris monoculture but not coculture with streptococci. BMC Microbiol. 2020, 20, 329. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.L.; Ross, T.; McMeekin, T.A.; Nichols, P.D. Acid habituation of Escherichia coli and the potential role of cyclopropane fatty acids in low pH tolerance. Int. J. Food Microbiol. 1997, 37, 163–173. [Google Scholar] [CrossRef]
- Griswold, A.R.; Jameson-Lee, M.; Burne, R.A. Regulation and physiologic significance of the agmatine deiminase system of Streptococcus mutans UA159. J. Bacteriol. 2006, 188, 834–841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lemos, J.A.; Burne, R.A. A model of efficiency: Stress tolerance by Streptococcus mutans. Microbiology 2008, 154, 3247–3255. [Google Scholar] [CrossRef] [Green Version]
- Fozo, E.M.; Quivey, R.G., Jr. Shifts in the membrane fatty acid profile of Streptococcus mutans enhance survival in acidic environments. Appl. Environ. Microbiol. 2004, 70, 929–936. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsuda, H.; Yamashita, Y.; Shibata, Y.; Nakano, Y.; Koga, T. Genes involved in bacitracin resistance in Streptococcus mutans. Antimicrob. Agents Chemother. 2002, 46, 3756–3764. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kovacs, C.J.; Faustoferri, R.C.; Quivey, R.G. RgpF is required for maintenance of stress tolerance and virulence in Streptococcus mutans. J. Bacteriol. 2017, 199, e00497-17. [Google Scholar] [CrossRef] [Green Version]
- Shields, R.C.; Burne, R.A. Growth of Streptococcus mutans in biofilms alters peptide signaling at the sub-population level. Front. Microbiol. 2016, 7, 1075. [Google Scholar] [CrossRef] [Green Version]
- Moye, Z.D.; Son, M.; Rosa-Alberty, A.E.; Zeng, L.; Ahn, S.J.; Hagen, S.J.; Burne, R.A. Effects of carbohydrate source on genetic competence in Streptococcus mutans. Appl. Environ. Microbiol. 2016, 82, 4821–4834. [Google Scholar] [CrossRef] [Green Version]
- Petersen, F.C.; Tao, L.; Scheie, A.A. DNA binding-uptake system: A link between cell-to-cell communication and biofilm formation. J. Bacteriol. 2005, 187, 4392–4400. [Google Scholar] [CrossRef] [Green Version]
- Das, T.; Manefield, M. Pyocyanin promotes extracellular DNA release in Pseudomonas aeruginosa. PLoS ONE 2012, 7, e46718. [Google Scholar] [CrossRef] [Green Version]
- Qin, Z.; Ou, Y.; Yang, L.; Zhu, Y.; Tolker-Nielsen, T.; Molin, S.; Qu, D. Role of autolysin-mediated DNA release in biofilm formation of Staphylococcus epidermidis. Microbiology 2007, 153, 2083–2092. [Google Scholar] [CrossRef] [Green Version]
- Barnes, A.M.T.; Ballering, K.S.; Leibman, R.S.; Wells, C.L.; Dunnya, G.M. Enterococcus faecalis produces abundant extracellular structures containing DNA in the absence of cell lysis during early biofilm formation. MBio 2012, 3, e00193-12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Steichen, C.T.; Cho, C.; Shao, J.Q.; Apicella, M.A. The Neisseria gonorrhoeae biofilm matrix contains DNA, and an endogenous nuclease controls its incorporation. Infect. Immun. 2011, 79, 1504–1511. [Google Scholar] [CrossRef] [Green Version]
- Das, T.; Sharma, P.K.; Busscher, H.J.; Van Der Mei, H.C.; Krom, B.P. Role of extracellular DNA in initial bacterial adhesion and surface aggregation. Appl. Environ. Microbiol. 2010, 76, 3405–3408. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Benigar, E.; Zupančič Valant, A.; Dogsa, I.; Sretenovic, S.; Stopar, D.; Jamnik, A.; Tomšič, M. Structure and dynamics of a model polymer mixture mimicking a levan-based bacterial biofilm of Bacillus subtilis. Langmuir 2016, 32, 8182–8194. [Google Scholar] [CrossRef]
- Schroeder, V.A.; Michalek, S.M.; Macrina, F.L. Biochemical characterization and evaluation of virulence of a fructosyltransferase-deficient mutant of Streptococcus mutans V403. Infect. Immun. 1989, 57, 3560–3569. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primers | Sequences |
---|---|
Ldh-Fw | TTGGCGACGCTCTTGATCTTAG |
Ldh-Rv | GTCAGCATCCGCACAGTCTTC |
GTF-BF | CGAAATCCCAAATTTCTAATGA |
GTF-BR | TGTTTCCCCAACAGTATAAGGA |
GTF-CF | ACCAACCGCCACTGTTACT |
GTF-CR | AACGGTTTACCGCTTTTGAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iwabuchi, Y.; Nakamura, T.; Kusumoto, Y.; Nakao, R.; Iwamoto, T.; Shinozuka, O.; Senpuku, H. Effects of pH on the Properties of Membrane Vesicles Including Glucosyltransferase in Streptococcus mutans. Microorganisms 2021, 9, 2308. https://doi.org/10.3390/microorganisms9112308
Iwabuchi Y, Nakamura T, Kusumoto Y, Nakao R, Iwamoto T, Shinozuka O, Senpuku H. Effects of pH on the Properties of Membrane Vesicles Including Glucosyltransferase in Streptococcus mutans. Microorganisms. 2021; 9(11):2308. https://doi.org/10.3390/microorganisms9112308
Chicago/Turabian StyleIwabuchi, Yusuke, Tomoyo Nakamura, Yasuka Kusumoto, Ryoma Nakao, Tsutomu Iwamoto, Osamu Shinozuka, and Hidenobu Senpuku. 2021. "Effects of pH on the Properties of Membrane Vesicles Including Glucosyltransferase in Streptococcus mutans" Microorganisms 9, no. 11: 2308. https://doi.org/10.3390/microorganisms9112308