Probiotics Improve Eating Disorders in Mandarin Fish (Siniperca chuatsi) Induced by a Pellet Feed Diet via Stimulating Immunity and Regulating Gut Microbiota
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacteria Strains
2.2. Animal Treatments
2.3. Proportion of Pellet Feed Recipients and Survival Analysis
2.4. Sample Collection
2.5. Serum Parameter Analysis
2.5.1. Serum Lysozyme Content
2.5.2. Measurement of IgM and CRP
2.6. Antioxidant and Oxidative Stress Parameters
2.7. Gene Expression Analysis
2.7.1. Extraction of total RNA and Reverse Transcription
2.7.2. Real-Time Quantitative PCR (RT-qPCR)
2.8. Gut Microbiota Analysis
2.9. Intestinal Histological Assessment
2.10. Statistical Analysis
3. Results
3.1. Proportion of Pellet Feed Recipients
3.2. Survival Analysis
3.3. Serum Parameter Analysis
3.3.1. Serum Lysozyme Content
3.3.2. Measurement of IgM and CRP
3.4. Antioxidant and Oxidative Stress Parameters
3.5. Expression of Appetite-Related Genes
3.6. Gut Microbiota Analysis
3.6.1. Richness and Diversity
3.6.2. Community Composition and Biomarker Analysis
3.6.3. Functional Prediction
3.7. Intestinal Histological Assessment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cooper, Z.; Grave, R.D. Eating Disorders: Transdiagnostic Theory and Treatment. In The Science of Cognitive Behavioral Therapy; Academic Press: Cambridge, MA, USA, 2017; pp. 337–357. [Google Scholar]
- Smink, F.R.E.; Van Hoeken, D.; Hoek, H.W. Epidemiology of Eating Disorders: Incidence, Prevalence and Mortality Rates. Curr. Psychiatry Rep. 2012, 14, 406–414. [Google Scholar] [CrossRef] [Green Version]
- Hoek, H.W.; Van Hoeken, D. Review of the prevalence and incidence of eating disorders. Int. J. Eat. Disord. 2003, 34, 383–396. [Google Scholar] [CrossRef] [PubMed]
- Hay, P. Current approach to eating disorders: A clinical update. Intern. Med. J. 2020, 50, 24–29. [Google Scholar] [CrossRef]
- Johnson, J.G.; Cohen, P.; Kasen, S.; Brook, J.S. Eating Disorders during Adolescence and the Risk for Physical and Mental Disorders During Early Adulthood. Arch. Gen. Psychiatry 2002, 59, 545–552. [Google Scholar] [CrossRef] [PubMed]
- Clouard, C.; Meunier-Salaün, M.; Val-Laillet, D. Food preferences and aversions in human health and nutrition: How can pigs help the biomedical research? Animal 2012, 6, 118–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yanovski, S. Sugar and fat: Cravings and aversions. J. Nutr. 2003, 133, 835S–837S. [Google Scholar] [CrossRef] [Green Version]
- He, S.; You, J.-J.; Liang, X.-F.; Zhang, Z.-L.; Zhang, Y.-P. Transcriptome sequencing and metabolome analysis of food habits domestication from live prey fish to artificial diets in mandarin fish (Siniperca chuatsi). BMC Genom. 2021, 22, 1–12. [Google Scholar] [CrossRef]
- Ventura, A.K.; Worobey, J. Early Influences on the Development of Food Preferences. Curr. Biol. 2013, 23, R401–R408. [Google Scholar] [CrossRef] [Green Version]
- Chen, K.; Zhang, Z.; Li, J.; Xie, S.; Shi, L.-J.; He, Y.-H.; Liang, X.-F.; Zhu, Q.-S.; He, S. Different regulation of branched-chain amino acid on food intake by TOR signaling in Chinese perch (Siniperca chuatsi). Aquaculture 2021, 530, 735792. [Google Scholar] [CrossRef]
- Cota, D.; Yoon, A.; Peng, G.; Brandenburg, Y.; Zollo, O.; Xu, W.; Rego, E.; Ruggero, D. Hypothalamic mTOR Signaling Regulates Food Intake. Science 2006, 312, 927–930. [Google Scholar] [CrossRef] [Green Version]
- Valassi, E.; Scacchi, M.; Cavagnini, F. Neuroendocrine control of food intake. Nutr. Metab. Cardiovasc. Dis. 2008, 18, 158–168. [Google Scholar] [CrossRef]
- Sohn, J.-W. Network of hypothalamic neurons that control appetite. BMB Rep. 2015, 48, 229–233. [Google Scholar] [CrossRef]
- Volkoff, H. The Neuroendocrine Regulation of Food Intake in Fish: A Review of Current Knowledge. Front. Neurosci. 2016, 10, 540. [Google Scholar] [CrossRef] [Green Version]
- Gorissen, M.; Flik, G. Leptin in teleostean fish, towards the origins of leptin physiology. J. Chem. Neuroanat. 2014, 61-62, 200–206. [Google Scholar] [CrossRef]
- Jönsson, E. The role of ghrelin in energy balance regulation in fish. Gen. Comp. Endocrinol. 2013, 187, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Clemente, J.C.; Ursell, L.K.; Parfrey, L.W.; Knight, R. The Impact of the Gut Microbiota on Human Health: An Integrative View. Cell 2012, 148, 1258–1270. [Google Scholar] [CrossRef] [Green Version]
- Subramanian, S.; Blanton, L.V.; Frese, S.A.; Charbonneau, M.; Mills, D.A.; Gordon, J.I. Cultivating Healthy Growth and Nutrition through the Gut Microbiota. Cell 2015, 161, 36–48. [Google Scholar] [CrossRef] [Green Version]
- Vuong, H.E.; Yano, J.M.; Fung, T.C.; Hsiao, E.Y. The Microbiome and Host Behavior. Annu. Rev. Neurosci. 2017, 40, 21–49. [Google Scholar] [CrossRef] [PubMed]
- Cryan, J.F.; O’Riordan, K.J.; Cowan, C.S.M.; Sandhu, K.V.; Bastiaanssen, T.F.S.; Boehme, M.; Codagnone, M.G.; Cussotto, S.; Fulling, C.; Golubeva, A.V.; et al. The Microbiota-Gut-Brain Axis. Physiol. Rev. 2019, 99, 1877–2013. [Google Scholar] [CrossRef] [PubMed]
- Martino, M.E.; Ma, D.; Leulier, F. Microbial influence on Drosophila biology. Curr. Opin. Microbiol. 2017, 38, 165–170. [Google Scholar] [CrossRef] [PubMed]
- Ezra-Nevo, G.; Henriques, S.F.; Ribeiro, C. The diet-microbiome tango: How nutrients lead the gut brain axis. Curr. Opin. Neurobiol. 2020, 62, 122–132. [Google Scholar] [CrossRef] [PubMed]
- Vijay-Kumar, M.; Aitken, J.D.; Carvalho, F.A.; Cullender, T.C.; Mwangi, S.; Srinivasan, S.; Sitaraman, S.V.; Knight, R.; Ley, R.E.; Gewirtz, A.T. Metabolic Syndrome and Altered Gut Microbiota in Mice Lacking Toll-Like Receptor 5. Science 2010, 328, 228–231. [Google Scholar] [CrossRef] [Green Version]
- Breton, J.; Tennoune, N.; Lucas, N.; Francois, M.; Legrand, R.; Jacquemot, J.; Goichon, A.; Guérin, C.; Peltier, J.; Pestel-Caron, M.; et al. Gut Commensal E. coli Proteins Activate Host Satiety Pathways following Nutrient-Induced Bacterial Growth. Cell Metab. 2016, 23, 324–334. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leitão-Gonçalves, R.; Santos, Z.; Francisco, A.P.; Fioreze, G.T.; Anjos, M.; Baltazar, C.; Elias, A.P.; Itskov, P.; Piper, M.; Ribeiro, C. Commensal bacteria and essential amino acids control food choice behavior and reproduction. PLoS Biol. 2017, 15, e2000862. [Google Scholar] [CrossRef]
- Van De Wouw, M.; Schellekens, H.; Dinan, T.G.; Cryan, J.F. Microbiota-Gut-Brain Axis: Modulator of Host Metabolism and Appetite. J. Nutr. 2017, 147, 727–745. [Google Scholar] [CrossRef] [Green Version]
- De Almada, C.N.; Almada, C.N.; Martinez, R.C.; Sant’Ana, A.S. Paraprobiotics: Evidences on their ability to modify biological responses, inactivation methods and perspectives on their application in foods. Trends Food Sci. Technol. 2016, 58, 96–114. [Google Scholar] [CrossRef]
- Echeng, G.; Ehao, H.; Exie, S.; Ewang, X.; Edai, M.; Ehuang, L.; Eyuan, Z.-H. Antibiotic alternatives: The substitution of antibiotics in animal husbandry? Front. Microbiol. 2014, 5, 217. [Google Scholar] [CrossRef] [Green Version]
- Watts, M.; Munday, B.L.; Burke, C.M. Immune responses of teleost fish. Aust. Veter J. 2001, 79, 570–574. [Google Scholar] [CrossRef]
- Gatesoupe, F. The use of probiotics in aquaculture. Aquaculture 1999, 180, 147–165. [Google Scholar] [CrossRef]
- Chauhan, A.; Singh, R. Probiotics in aquaculture: A promising emerging alternative approach. Symbiosis 2019, 77, 99–113. [Google Scholar] [CrossRef]
- Ringø, E. Probiotics in shellfish aquaculture. Aquac. Fish. 2020, 5, 1–27. [Google Scholar] [CrossRef]
- Balcázar, J.L.; de Blas, I.; Ruiz-Zarzuela, I.; Cunningham, D.; Vendrell, D.; Múzquiz, J.L. The role of probiotics in aquaculture. Veter Microbiol. 2006, 114, 173–186. [Google Scholar] [CrossRef]
- Wang, L.; Jian, Y.; Liu, Q.; Li, F.; Chang, L. Electromagnetohydrodynamic flow and heat transfer of third grade fluids between two micro-parallel plates. Colloids Surf. A Physicochem. Eng. Asp. 2016, 494, 87–94. [Google Scholar] [CrossRef]
- Van Nguyen, N.; Onoda, S.; Van Khanh, T.; Hai, P.D.; Trung, N.T.; Hoang, L.; Koshio, S. Evaluation of dietary Heat-killed Lactobacillus plantarum strain L-137 supplementation on growth performance, immunity and stress resistance of Nile tilapia (Oreochromis niloticus). Aquaculture 2019, 498, 371–379. [Google Scholar] [CrossRef]
- Hooshyar, Y.; Kenari, A.A.; Paknejad, H.; Gandomi, H. Effects of Lactobacillus rhamnosus ATCC 7469 on Different Parameters Related to Health Status of Rainbow Trout (Oncorhynchus mykiss) and the Protection Against Yersinia ruckeri. Probiotics Antimicrob. Proteins 2020, 12, 1370–1384. [Google Scholar] [CrossRef]
- Sewaka, M.; Trullas, C.; Chotiko, A.; Rodkhum, C.; Chansue, N.; Boonanuntanasarn, S.; Pirarat, N. Efficacy of synbiotic Jerusalem artichoke and Lactobacillus rhamnosus GG-supplemented diets on growth performance, serum biochemical parameters, intestinal morphology, immune parameters and protection against Aeromonas veronii in juvenile red tilapia (Oreochromis spp.). Fish Shellfish Immunol. 2019, 86, 260–268. [Google Scholar] [CrossRef] [PubMed]
- Giorgia, G.; Elia, C.; Andrea, P.; Cinzia, C.; Stefania, S.; Ana, R.; Daniel, M.L.; Ike, O.; Oliana, C. Effects of Lactogen 13, a New Probiotic Preparation, on Gut Microbiota and Endocrine Signals Controlling Growth and Appetite of Oreochromis niloticus Juveniles. Microb. Ecol. 2018, 76, 1063–1074. [Google Scholar] [CrossRef] [PubMed]
- Poolsawat, L.; Li, X.; He, M.; Ji, D.; Leng, X.J.A.N. Clostridium butyricum as probiotic for promoting growth performance, feed utilization, gut health and microbiota community of tilapia (Oreochromis niloticus × O. aureus). Aquac. Nutr. 2020, 26, 657–670. [Google Scholar] [CrossRef]
- Zhang, M.; Dong, B.; Lai, X.; Chen, Z.; Hou, L.; Shu, R.; Huang, Y.; Shu, H. Effects of Clostridium butyricum on growth, digestive enzyme activity, antioxidant capacity and gut microbiota in farmed tilapia (Oreochromis niloticus). Aquac. Res. 2021, 52, 1573–1584. [Google Scholar] [CrossRef]
- Balcázar, J.L.; Vendrell, D.; de Blas, I.; Ruiz-Zarzuela, I.; Muzquiz, J.L.; Girones, O. Characterization of probiotic properties of lactic acid bacteria isolated from intestinal microbiota of fish. Aquaculture 2008, 278, 188–191. [Google Scholar] [CrossRef]
- Henriques, S.F.; Dhakan, D.B.; Serra, L.; Francisco, A.P.; Carvalho-Santos, Z.; Baltazar, C.; Elias, A.P.; Anjos, M.; Zhang, T.; Maddocks, O.D.K.; et al. Metabolic cross-feeding in imbalanced diets allows gut microbes to improve reproduction and alter host behaviour. Nat. Commun. 2020, 11, 4236. [Google Scholar] [CrossRef] [PubMed]
- Lash, B.W.; Mysliwiec, T.H.; Gourama, H. Detection and partial characterization of a broad-range bacteriocin produced by Lactobacillus plantarum (ATCC 8014). Food Microbiol. 2005, 22, 199–204. [Google Scholar] [CrossRef]
- Giri, S.S.; Sukumaran, V.; Oviya, M. Potential probiotic Lactobacillus plantarum VSG3 improves the growth, immunity, and disease resistance of tropical freshwater fish, Labeo rohita. Fish Shellfish. Immunol. 2013, 34, 660–666. [Google Scholar] [CrossRef] [PubMed]
- Parthasarathy, R.; Ravi, D. Probiotic bacteria as growth promoter and biocontrol agent against Aeromonas hydrophila in Catla catla (Hamilton, 1822). Indian J. Fish. 2011, 58, 87–93. [Google Scholar]
- Son, V.M.; Chang, C.-C.; Wu, M.-C.; Guu, Y.-K.; Chiu, C.-H.; Cheng, W. Dietary administration of the probiotic, Lactobacillus plantarum, enhanced the growth, innate immune responses, and disease resistance of the grouper Epinephelus coioides. Fish Shellfish Immunol. 2009, 26, 691–698. [Google Scholar] [CrossRef]
- Jatobá, A.; Vieira, F.D.N.; Buglione-Neto, C.C.; Mouriño’, J.L.P.; Silva, B.C.; Seiftter, W.Q.; Andreatta, E.R. Diet supplemented with probiotic for Nile tilapia in polyculture system with marine shrimp. Fish Physiol. Biochem. 2011, 37, 725–732. [Google Scholar] [CrossRef]
- Uma, A.; Abraham, T.J.; Sundararaj, V. Effect of a probiotic bacterium, Lactobacillus plantarum on disease resistance of Penaeus indicus larvae. Indian J. Fish. 1999, 46, 367–373. [Google Scholar]
- Kongnum, K.; Hongpattarakere, T. Effect of Lactobacillus plantarum isolated from digestive tract of wild shrimp on growth and survival of white shrimp (Litopenaeus vannamei) challenged with Vibrio harveyi. Fish Shellfish Immunol. 2012, 32, 170–177. [Google Scholar] [CrossRef]
- Chiu, C.-H.; Guu, Y.-K.; Liu, C.-H.; Pan, T.-M.; Cheng, W. Immune responses and gene expression in white shrimp, Litopenaeus vannamei, induced by Lactobacillus plantarum. Fish Shellfish Immunol. 2007, 23, 364–377. [Google Scholar] [CrossRef]
- Vieira, F.N.; Buglione, C.C.; Mouriño, J.P.L.; Jatobá, A.; Martins, M.L.; Schleder, D.D.; Andreatta, E.R.; Barraco, M.A.; Vinatea, L.A. Effect of probiotic supplemented diet on marine shrimp survival after challenge with Vibrio harveyi. Arquivo Brasileiro de Medicina Veterinária e Zootecnia 2010, 62, 631–638. [Google Scholar] [CrossRef] [Green Version]
- Iman, M.K.A.; Wafaa, T.A.; Elham, S.A.; Mohammad, M.N.A.; El-Shafei, K.; Osama, M.S.; Gamal, A.I.; Zeinab, I.S.; El-Sayed, H.S. Evaluation of Lactobacillus plantarum as a probiotic in aquaculture: Emphasis on growth performance and innate immunity. J. Appl. Sci. Res. 2013, 9, 572–582. [Google Scholar]
- Bravo, J.A.; Forsythe, P.; Chew, M.V.; Escaravage, E.; Savignac, H.M.; Dinan, T.G.; Bienenstock, J.; Cryan, J.F. Ingestion of Lactobacillus strain regulates emotional behavior and central GABA receptor expression in a mouse via the vagus nerve. Proc. Natl. Acad. Sci. USA 2011, 108, 16050–16055. [Google Scholar] [CrossRef] [Green Version]
- Liang, S.; Wang, T.; Hu, X.; Luo, J.; Li, W.; Wu, X.; Duan, Y.; Jin, F. Administration of Lactobacillus helveticus NS8 improves behavioral, cognitive, and biochemical aberrations caused by chronic restraint stress. Neuroscience 2015, 310, 561–577. [Google Scholar] [CrossRef]
- Janik, R.; Thomason, L.A.; Stanisz, A.M.; Forsythe, P.; Bienenstock, J.; Stanisz, G.J. Magnetic resonance spectroscopy reveals oral Lactobacillus promotion of increases in brain GABA, N-acetyl aspartate and glutamate. NeuroImage 2016, 125, 988–995. [Google Scholar] [CrossRef] [PubMed]
- Lyte, M. Probiotics function mechanistically as delivery vehicles for neuroactive compounds: Microbial endocrinology in the design and use of probiotics. BioEssays 2011, 33, 574–581. [Google Scholar] [CrossRef] [PubMed]
- Lyte, M. Microbial endocrinology. Gut Microbes 2014, 5, 381–389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kong, Q.; He, G.-Q.; Jia, J.-L.; Zhu, Q.-L.; Ruan, H. Oral Administration of Clostridium butyricum for Modulating Gastrointestinal Microflora in Mice. Curr. Microbiol. 2010, 62, 512–517. [Google Scholar] [CrossRef]
- Yang, C.; Cao, G.; Xiao, Y.; Chen, A.; Liu, T.; Zhou, L.; Zhang, L.; Ferket, P. Effects of Clostridium butyricum on Growth Performance, Nitrogen Metabolism, Intestinal Morphology and Cecal Microflora in Broiler Chickens. J. Anim. Veter Adv. 2012, 11, 2665–2671. [Google Scholar] [CrossRef]
- Juan, Z.; Chun, W.; Zhao-Ling, S.; Ming-Hua, Z.; Hai-Xia, W.; Meng-Yun, L.; Jian-Qiong, H.; Yue-Jie, Z.; Xin, S. Oral administration of Clostridium butyricum CGMCC0313-1 reduces ovalbumin-induced allergic airway inflammation in mice. Respirology 2017, 22, 898–904. [Google Scholar] [CrossRef]
- Yang, C.M.; Cao, G.T.; Ferket, P.; Liu, T.T.; Zhou, L.; Zhang, L.; Xiao, Y.P.; Chen, A.G. Effects of probiotic, Clostridium butyricum, on growth performance, immune function, and cecal microflora in broiler chickens. Poult. Sci. 2012, 91, 2121–2129. [Google Scholar] [CrossRef]
- Chen, L.; Li, S.; Zheng, J.; Li, W.; Jiang, X.; Zhao, X.; Wu, D. Effects of dietary Clostridium butyricum supplementation on growth performance,intestinal development, and immune response of weaned piglets challenged with lipopolysaccharide. J. Anim. Sci. Biotechnol. 2018, 9, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Sisson, G.; Ayis, S.; Sherwood, R.A.; Bjarnason, I. Randomised clinical trial: A liquid multi-strain probiotic vs. placebo in the irritable bowel syndrome—A 12 week double-blind study. Aliment. Pharmacol. Ther. 2014, 40, 51–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, Y.-Y.; Li, M.; Li, Y.-Y.; Li, L.-X.; Zhai, W.-Z.; Wang, P.; Yang, X.-X.; Gu, X.; Song, L.-J.; Li, Z.; et al. The effect of Clostridium butyricum on symptoms and fecal microbiota in diarrhea-dominant irritable bowel syndrome: A randomized, double-blind, placebo-controlled trial. Sci. Rep. 2018, 8, 2964. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hudson, L.E.; Anderson, S.E.; Corbett, A.H.; Lamb, T.J. Gleaning Insights from Fecal Microbiota Transplantation and Probiotic Studies for the Rational Design of Combination Microbial Therapies. Clin. Microbiol. Rev. 2017, 30, 191–231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lv, L.; Liang, X.F.; Huang, K.; He, S. Effect of agmatine on food intake in mandarin fish (Siniperca chuatsi). Fish Physiol. Biochem. 2019, 45, 1709–1716. [Google Scholar] [CrossRef]
- Liang, X.F.; Oku, H.; Ogata, H.Y.; Liu, J.; He, X. Weaning Chinese perch Siniperca chuatsi (Basilewsky) onto artificial diets based upon its specific sensory modality in feeding. Aquac. Res. 2001, 32, 76–82. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Xiang, J.; Yin, M. The influences of temperature on the feeding,growth and development oflarval siniperca chuatsi. J. Fish. China 1999, 1, 91–94. [Google Scholar]
- Dou, Y.; He, S.; Liang, X.-F.; Cai, W.; Wang, J.; Shi, L.; Li, J. Memory Function in Feeding Habit Transformation of Mandarin Fish (Siniperca chuatsi). Int. J. Mol. Sci. 2018, 19, 1254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, L.; Fang, J.; Liang, X.; Alam, M.S.; Liu, L.; Yuan, X. Effect of feeding stimulants on growth performance, feed intake and appetite regulation of mandarin fish,Siniperca chuatsi. Aquac. Res. 2019, 50, 3684–3691. [Google Scholar] [CrossRef]
- Cao, G.; Tao, F.; Hu, Y.; Li, Z.; Zhang, Y.; Deng, B.; Zhan, X. Positive effects of a Clostridium butyricum-based compound probiotic on growth performance, immune responses, intestinal morphology, hypothalamic neurotransmitters, and colonic microbiota in weaned piglets. Food Funct. 2019, 10, 2926–2934. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Duan, Y.; Dong, H.; Zhang, J. Effects of Dietary Lactobacillus plantarum on Growth Performance, Digestive Enzymes and Gut Morphology of Litopenaeus vannamei. Probiotics Antimicrob. Proteins 2018, 10, 504–510. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.-B.; Jia, L.; Yan, Q.-Q.; Deng, Q.; Wei, B. Effect of Clostridium butyricum and Butyrate on Intestinal Barrier Functions: Study of a Rat Model of Severe Acute Pancreatitis With Intra-Abdominal Hypertension. Front. Physiol. 2020, 11, 561061. [Google Scholar] [CrossRef]
- Ukeda, H. Novel assay methods of enzyme superoxide dismutase (SOD). Nippon Nogeikagaku Kaishi J. Japan Soc. Biosci. Biotechnol. Agrochem. 2001, 75, 562–565. [Google Scholar]
- Buege, J.A.; Aust, S.D. Microsomal lipid peroxidation. Methods Enzymol. 1978, 52, 302–310. [Google Scholar] [CrossRef] [PubMed]
- Nebot, C.; Moutet, M.; Huet, P.; Xu, J.; Yadan, J.; Chaudière, J. Spectrophotometric Assay of Superoxide Dismutase Activity Based on the Activated Autoxidation of a Tetracyclic Catechol. Anal. Biochem. 1993, 214, 442–451. [Google Scholar] [CrossRef]
- Reiners, J.J.; Thai, G.; Rupp, T.; Cantu, A.R. Assessment of the antioxidant/prooxidant status of murine skin following topical treatment with 12- O -tetradecanoylphorbol-13-acetate and throughout the ontogeny of skin cancer. Part I: Quantitation of superoxide dismutase, catalase, glutathione peroxidase and xanthine oxidase. Carcinogenesis 1991, 12, 2337–2343. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Magoč, T.; Salzberg, S.L. FLASH: Fast Length Adjustment of Short Reads to Improve Genome Assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C.; Haas, B.J.; Bioinformatics, C.J. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME Allows Analysis of High-Throughput Community Sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [Green Version]
- Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aßhauer, K.P.; Wemheuer, B.; Daniel, R.; Meinicke, P. Tax4Fun: Predicting functional profiles from metagenomic 16S rRNA data: Fig. 1. Bioinformatics 2015, 31, 2882–2884. [Google Scholar] [CrossRef]
- Seitz, J.; Trinh, S.; Herpertz-Dahlmann, B. The Microbiome and Eating Disorders. Psychiatr. Clin. N. Am. 2019, 42, 93–103. [Google Scholar] [CrossRef] [PubMed]
- Dinan, T.G.; Cryan, J.F. Melancholic microbes: A link between gut microbiota and depression? Neurogastroenterol. Motil. 2013, 25, 713–719. [Google Scholar] [CrossRef]
- Chen, X.; Yi, H.; Liu, S.; Zhang, Y.; Su, Y.; Liu, X.; Bi, S.; Lai, H.; Zeng, Z.; Li, G. Promotion of pellet-feed feeding in mandarin fish (Siniperca chuatsi) by Bdellovibrio bacteriovorus is influenced by immune and intestinal flora. Aquaculture 2021, 542, 736864. [Google Scholar] [CrossRef]
- Fernandez-Diaz, C.; Kopecka, J.; Cañavate, J.P.; Sarasquete, C.; Sole, M. Variations on development and stress defences in Solea senegalensis larvae fed on live and microencapsulated diets. Aquaculture 2006, 251, 573–584. [Google Scholar] [CrossRef]
- Dawood, M.A. Nutritional immunity of fish intestines: Important insights for sustainable aquaculture. Rev. Aquac. 2021, 13, 642–663. [Google Scholar] [CrossRef]
- Yúfera, M.; Fernandez-Diaz, C.; Pascual, E. Food microparticles for larval fish prepared by internal gelation. Aquaculture 2005, 248, 253–262. [Google Scholar] [CrossRef]
- Pérez-Sánchez, T.; Balcazar, J.L.; Merrifield, D.; Carnevali, O.; Gioacchini, G.; de Blas, I.; Ruiz-Zarzuela, I. Expression of immune-related genes in rainbow trout (Oncorhynchus mykiss) induced by probiotic bacteria during Lactococcus garvieae infection. Fish Shellfish Immunol. 2011, 31, 196–201. [Google Scholar] [CrossRef]
- Duan, Y.; Zhang, J.; Huang, J.; Jiang, S. Effects of Dietary Clostridium butyricum on the Growth, Digestive Enzyme Activity, Antioxidant Capacity, and Resistance to Nitrite Stress of Penaeus monodon. Probiotics Antimicrob. Proteins 2018, 11, 938–945. [Google Scholar] [CrossRef] [PubMed]
- Oliva-Teles, A. Nutrition and health of aquaculture fish. J. Fish Dis. 2012, 35, 83–108. [Google Scholar] [CrossRef] [PubMed]
- A Casas, G.; Blavi, L.; Cross, T.-W.L.; Lee, A.H.; Swanson, K.; Stein, H.H. Inclusion of the direct-fed microbial Clostridium butyricum in diets for weanling pigs increases growth performance and tends to increase villus height and crypt depth, but does not change intestinal microbial abundance. J. Anim. Sci. 2020, 98. [Google Scholar] [CrossRef]
- Zhang, F.; Li, Y.; Wang, X.; Wang, S.; Bi, D. The Impact ofLactobacillus plantarumon the Gut Microbiota of Mice with DSS-Induced Colitis. BioMed Res. Int. 2019, 2019, 1–10. [Google Scholar] [CrossRef] [Green Version]
- He, S.; Liang, X.F.; Sun, J.; Li, L.; Yu, Y.; Huang, W.; Qu, C.M.; Cao, L.; Bai, X.L.; Tao, Y. Insights into food preference in hybrid F1 of Siniperca chuatsi (♀)× Siniperca scherzeri (♂) mandarin fish through transcriptome analysis. BMC Genom. 2013, 14, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Biochemistry, H.V.J.C.; Molecular, P.P.A.; Physiology, I. The role of neuropeptide Y, orexins, cocaine and amphetamine-related transcript, cholecystokinin, amylin and leptin in the regulation of feeding in fish. Biochem. Physiol. Part A Mol. Integr. Physiol. 2006, 144, 325–331. [Google Scholar]
- Rui, L. Brain regulation of energy balance and body weight. Rev. Endocr. Metab. Disord. 2013, 14, 387–407. [Google Scholar] [CrossRef] [Green Version]
- Crespo, C.S.; Cachero, A.P.; Jimã Nez, L.P.; Barrios, V.; Ferreiro, E.A. Peptides and Food Intake. Front. Endocrinol. 2014, 5, 58. [Google Scholar] [CrossRef] [Green Version]
- Volkoff, H.; Canosa, L.; Unniappan, S.; Cerdá-Reverter, J.; Bernier, N.; Kelly, S.; Peter, R. Neuropeptides and the control of food intake in fish. Gen. Comp. Endocrinol. 2005, 142, 3–19. [Google Scholar] [CrossRef]
- Holzer, P.; Reichmann, F.; Farzi, A. Neuropeptide Y, peptide YY and pancreatic polypeptide in the gut–brain axis. Neuropeptides 2012, 46, 261–274. [Google Scholar] [CrossRef] [Green Version]
- Cerdá-Reverter, J.M.; Agulleiro, M.J.; Guillot, R.; Sánchez, E.; Ceinos, R.M.; Rotllant, J. Fish melanocortin system. Eur. J. Pharmacol. 2011, 660, 53–60. [Google Scholar] [CrossRef] [Green Version]
- Riley, L.G.; Fox, B.K.; Kaiya, H.; Hirano, T.; Grau, E.G. Long-term treatment of ghrelin stimulates feeding, fat deposition, and alters the GH/IGF-I axis in the tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 2005, 142, 234–240. [Google Scholar] [CrossRef] [PubMed]
- Kaiya, H.; Miyazato, M.; Kangawa, K.; Peter, R.E.; Unniappan, S. Ghrelin: A multifunctional hormone in non-mammalian vertebrates. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2008, 149, 109–128. [Google Scholar] [CrossRef]
- Tan, Y.-Y.; Ji, Z.-L.; Zhao, G.; Jiang, J.-R.; Wang, N.; Wang, J.-M. Decreased SCF/c-kit signaling pathway contributes to loss of interstitial cells of Cajal in gallstone disease. Int. J. Clin. Exp. Med. 2014, 7, 4099–4106. [Google Scholar] [PubMed]
- ThanThan, S.; Mekaru, C.; Seki, N.; Hidaka, K.; Ueno, A.; ThidarMyint, H.; Kuwayama, H. Endogenous ghrelin released in response to endothelin stimulates growth hormone secretion in cattle. Domest. Anim. Endocrinol. 2010, 38, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Won, E.T.; Douros, J.D.; Hurt, D.A.; Borski, R.J. Leptin stimulates hepatic growth hormone receptor and insulin-like growth factor gene expression in a teleost fish, the hybrid striped bass. Gen. Comp. Endocrinol. 2016, 229, 84–91. [Google Scholar] [CrossRef] [Green Version]
- Browning, K.N.; Verheijden, S.; Boeckxstaens, G.E. The Vagus Nerve in Appetite Regulation, Mood, and Intestinal Inflammation. Gastroenterology 2017, 152, 730–744. [Google Scholar] [CrossRef] [Green Version]
- Caricilli, A. Intestinal barrier: A gentlemen’s agreement between microbiota and immunity. World J. Gastrointest. Pathophysiol. 2014, 5, 18. [Google Scholar] [CrossRef]
- Uribe, C.; Folch, H.; Enriquez, R.; Moran, G. Innate and adaptive immunity in teleost fish: A review. Veterinární Medicína 2011, 56, 486–503. [Google Scholar] [CrossRef] [Green Version]
- Singh, P.B.; Singh, V. Cypermethrin induced histological changes in gonadotrophic cells, liver, gonads, plasma levels of estradiol-17β and 11-ketotestosterone, and sperm motility in Heteropneustes fossilis (Bloch). Chemosphere 2008, 72, 422–431. [Google Scholar] [CrossRef] [PubMed]
- Dominguez, M.; Takemura, A.; Tsuchiya, M.; Nakamura, S. Impact of different environmental factors on the circulating immunoglobulin levels in the Nile tilapia, Oreochromis niloticus. Aquaculture 2004, 241, 491–500. [Google Scholar] [CrossRef]
- Zhai, Q.; Wang, H.; Tian, F.; Zhao, J.; Zhang, H.; Chen, W. Dietary Lactobacillus plantarum supplementation decreases tissue lead accumulation and alleviates lead toxicity in Nile tilapia (Oreochromis niloticus). Aquac. Res. 2017, 48, 5094–5103. [Google Scholar] [CrossRef]
- Wang, K.; Cao, G.; Zhang, H.; Li, Q.; Yang, C. Effects of Clostridium butyricum and Enterococcus faecalis on growth performance, immune function, intestinal morphology, volatile fatty acids, and intestinal flora in a piglet model. Food Funct. 2019, 10, 7844–7854. [Google Scholar] [CrossRef] [PubMed]
- Liao, X.D.; Ma, G.; Cai, J.; Fu, Y.; Yan, X.Y.; Wei, X.B.; Zhang, R.J. Effects ofClostridium butyricum on growth performance, antioxidation, and immune function of broilers. Poult. Sci. 2015, 94, 662–667. [Google Scholar] [CrossRef]
- Jia, R.; Gu, Z.; He, Q.; Du, J.; Cao, L.; Jeney, G.; Xu, P.; Yin, G. Anti-oxidative, anti-inflammatory and hepatoprotective effects of Radix Bupleuri extract against oxidative damage in tilapia (Oreochromis niloticus) via Nrf2 and TLRs signaling pathway. Fish Shellfish Immunol. 2019, 93, 395–405. [Google Scholar] [CrossRef]
- Dong, Y.; Tu, J.; Zhou, Y.; Zhou, X.H.; Xu, B.; Zhu, S.Y. Silybum marianum oil attenuates oxidative stress and ameliorates mitochondrial dysfunction in mice treated with D-galactose. Pharmacogn. Mag. 2014, 10, S92–S99. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, P.; Chen, F.; Zhou, B. Antioxidative, anti-inflammatory and anti-apoptotic effects of ellagic acid in liver and brain of rats treated by D-galactose. Sci. Rep. 2018, 8, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Li, J.; Lu, J.; Li, Z.; Shi, S.; Liu, Z. Effects of live and artificial feeds on the growth, digestion, immunity and intestinal microflora of mandarin fish hybrid (Siniperca chuatsi ♀ × Siniperca scherzeri ♂). Aquac. Res. 2017, 48, 4479–4485. [Google Scholar] [CrossRef]
- Peters, L.D.; Livingstone, D. Antioxidant enzyme activities in embryologic and early larval stages of turbot. J. Fish Biol. 1996, 49, 986–997. [Google Scholar] [CrossRef]
- Mourente, G.; Tocher, D.; Diaz, E.; Grau, A.; Pastor, E. Relationships between antioxidants, antioxidant enzyme activities and lipid peroxidation products during early development in Dentex dentex eggs and larvae. Aquaculture 1999, 179, 309–324. [Google Scholar] [CrossRef]
- Dandapat, J.; Chainy, G.B.; Rao, K.J. Lipid peroxidation and antioxidant defence status during larval development and metamorphosis of giant prawn, Macrobrachium rosenbergii. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2003, 135, 221–233. [Google Scholar] [CrossRef]
- Rueda-Jasso, R.; Conceição, L.; Dias, J.; De Coen, W.; Gomes, E.; Rees, J.; Soares, F.; Dinis, M.T.; Sorgeloos, P. Effect of dietary non-protein energy levels on condition and oxidative status of Senegalese sole (Solea senegalensis) juveniles. Aquaculture 2004, 231, 417–433. [Google Scholar] [CrossRef]
- Solé, M.; Potrykus, J.; Fernandez-Diaz, C.; Blasco, J. Variations on stress defences and metallothionein levels in the Senegal sole, Solea senegalensis, during early larval stages. Fish Physiol. Biochem. 2004, 30, 57–66. [Google Scholar] [CrossRef]
- Liu, J.; Fu, Y.; Zhang, H.; Wang, J.; Zhu, J.; Wang, Y.; Guo, Y.; Wang, G.; Xu, T.; Chu, M.; et al. The hepatoprotective effect of the probiotic Clostridium butyricum against carbon tetrachloride-induced acute liver damage in mice. Food Funct. 2017, 8, 4042–4052. [Google Scholar] [CrossRef] [PubMed]
- Alcock, J.; Maley, C.C.; Aktipis, C.A. Is eating behavior manipulated by the gastrointestinal microbiota? Evolutionary pressures and potential mechanisms. BioEssays 2014, 36, 940–949. [Google Scholar] [CrossRef] [PubMed]
- Soriano, E.L.; Ramírez, D.T.; Araujo, D.R.; Gómez-Gil, B.; Castro, L.I.; Sánchez, C.G. Effect of temperature and dietary lipid proportion on gut microbiota in yellowtail kingfish Seriola lalandi juveniles. Aquaculture 2018, 497, 269–277. [Google Scholar] [CrossRef]
- Dehler, C.E.; Secombes, C.J.; Martin , S.A.M. Environmental and physiological factors shape the gut microbiota of Atlantic salmon parr (Salmo salar L.). Aquaculture 2017, 467, 149–157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Benson, A.K.; Kelly, S.A.; Legge, R.; Ma, F.; Low, S.J.; Kim, J.; Zhang, M.; Oh, P.L.; Nehrenberg, D.; Hua, K.; et al. Individuality in gut microbiota composition is a complex polygenic trait shaped by multiple environmental and host genetic factors. Proc. Natl. Acad. Sci. USA 2010, 107, 18933–18938. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kovacs, A.; Ben-Jacob, N.; Tayem, H.; Halperin, E.; Iraqi, F.A.; Gophna, U. Genotype Is a Stronger Determinant than Sex of the Mouse Gut Microbiota. Microb. Ecol. 2010, 61, 423–428. [Google Scholar] [CrossRef]
- Rawls, J.; Mahowald, M.A.; Ley, R.E.; Gordon, J.I. Reciprocal Gut Microbiota Transplants from Zebrafish and Mice to Germ-free Recipients Reveal Host Habitat Selection. Cell 2006, 127, 423–433. [Google Scholar] [CrossRef] [Green Version]
- Arkoosh, M.R.; Clemons, E.; Kagley, A.N.; Stafford, C.; Glass, A.C.; Jacobson, K.; Reno, P.; Myers, M.S.; Casillas, E.; Loge, F.; et al. Survey of Pathogens in Juvenile SalmonOncorhynchusSpp. Migrating through Pacific Northwest Estuaries. J. Aquat. Anim. Heal. 2004, 16, 186–196. [Google Scholar] [CrossRef]
- De Filippo, C.; Cavalieri, D.; Di Paola, M.; Ramazzotti, M.; Poullet, J.B.; Massart, S.; Collini, S.; Pieraccini, G.; Lionetti, P. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc. Natl. Acad. Sci. USA 2010, 107, 14691–14696. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- A Koeth, R.; Wang, Z.; Levison, B.S.; A Buffa, J.; Org, E.; Sheehy, B.T.; Britt, E.B.; Fu, X.; Wu, Y.; Li, L.; et al. Intestinal microbiota metabolism of l-carnitine, a nutrient in red meat, promotes atherosclerosis. Nat. Med. 2013, 19, 576–585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muegge, B.D.; Kuczynski, J.; Knights, D.; Clemente, J.C.; González, A.; Fontana, L.; Henrissat, B.; Knight, R.; Gordon, J.I. Diet Drives Convergence in Gut Microbiome Functions Across Mammalian Phylogeny and Within Humans. Science 2011, 332, 970–974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bolnick, D.I.; Snowberg, L.K.; Hirsch, P.E.; Lauber, C.L.; Org, E.; Parks, B.; Lusis, A.J.; Knight, R.; Caporaso, J.G.; Svanbäck, R. Individual diet has sex-dependent effects on vertebrate gut microbiota. Nat. Commun. 2014, 5, 4500. [Google Scholar] [CrossRef]
- David, L.A.; Maurice, C.F.; Carmody, R.N.; Gootenberg, D.; Button, J.E.; Wolfe, B.E.; Ling, A.V.; Devlin, A.S.; Varma, Y.; Fischbach, M.A.; et al. Diet rapidly and reproducibly alters the human gut microbiome. Nat. Cell Biol. 2014, 505, 559–563. [Google Scholar] [CrossRef] [Green Version]
- Turnbaugh, P.J.; Hamady, M.; Yatsunenko, T.; Cantarel, B.L.; Duncan, A.; Ley, R.E.; Sogin, M.L.; Jones, W.J.; Roe, B.A.; Affourtit, J.P.; et al. A core gut microbiome in obese and lean twins. Nat. Cell Biol. 2008, 457, 480–484. [Google Scholar] [CrossRef] [Green Version]
- Burns, A.R.; Stephens, W.Z.; Stagaman, K.; Wong, S.; Rawls, J.; Guillemin, K.; Bohannan, B.J. Contribution of neutral processes to the assembly of gut microbial communities in the zebrafish over host development. ISME J. 2016, 10, 655–664. [Google Scholar] [CrossRef] [Green Version]
- Nayak, S.K. Role of gastrointestinal microbiota in fish. Aquac. Res. 2010, 41, 1553–1573. [Google Scholar] [CrossRef]
- Sekirov, I.; Finlay, B.B. The role of the intestinal microbiota in enteric infection. J. Physiol. 2009, 587, 4159–4167. [Google Scholar] [CrossRef]
- Olsen, R.E.; Sundell, K.; Mayhew, T.M.; Myklebust, R.; Ringø, E. Acute stress alters intestinal function of rainbow trout, Oncorhynchus mykiss (Walbaum). Aquaculture 2005, 250, 480–495. [Google Scholar] [CrossRef]
- Gareau, M.G.; Wine, E.; Sherman, P.M. Early Life Stress Induces Both Acute and Chronic Colonic Barrier Dysfunction: Figure. NeoReviews 2009, 10, e191–e197. [Google Scholar] [CrossRef]
- Stecher, B.; Robbiani, R.; Walker, A.W.; Westendorf, A.M.; Barthel, M.; Kremer, M.; Chaffron, S.; MacPherson, A.J.; Buer, J.; Parkhill, J.; et al. Salmonella enterica Serovar Typhimurium Exploits Inflammation to Compete with the Intestinal Microbiota. PLoS Biol. 2007, 5, e244–e2189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dethlefsen, L.; Huse, S.; Sogin, M.L.; Relman, D.A. The Pervasive Effects of an Antibiotic on the Human Gut Microbiota, as Revealed by Deep 16S rRNA Sequencing. PLoS Biol. 2008, 6, e280. [Google Scholar] [CrossRef] [PubMed]
- Cain, K.; Swan, C. Barrier function and immunology. In The Multifunctional Gut of Fish; Fish Physiology; Grosell, M., Farrell, A.P., Brauner, C.J., Eds.; Academic Press: Cambridge, MA, USA, 2010; Volume 30, pp. 111–134. [Google Scholar]
- Gaggìa, F.; Mattarelli, P.; Biavati, B. Probiotics and prebiotics in animal feeding for safe food production. Int. J. Food Microbiol. 2010, 141, S15–S28. [Google Scholar] [CrossRef] [PubMed]
- Gómez, G.D.; Balcázar, J.L. A review on the interactions between gut microbiota and innate immunity of fish: Table 1. FEMS Immunol. Med. Microbiol. 2008, 52, 145–154. [Google Scholar] [CrossRef]
- Nikoskelainen, S.; Salminen, S.; Bylund, G.; Ouwehand, A.C. Characterization of the Properties of Human- and Dairy-Derived Probiotics for Prevention of Infectious Diseases in Fish. Appl. Environ. Microbiol. 2001, 67, 2430–2435. [Google Scholar] [CrossRef] [Green Version]
- Dash, G.; Raman, R.P.; Prasad, K.P.; Makesh, M.; Pradeep, M.; Sen, S. Evaluation of Lactobacillus plantarum as feed supplement on host associated microflora, growth, feed efficiency, carcass biochemical composition and immune response of giant freshwater prawn, Macrobrachium rosenbergii (de Man, 1879). Aquaculture 2014, 432, 225–236. [Google Scholar] [CrossRef]
- Xue-Feng, W.U.; Zhao, J.L.; Qian, Y.Z.; Chao, W. Histological Study of the Digestive System Organogenesis for the Mandarin Fish, Siniperca chuatsi. Zool. Res. 2007, 28, 511–518. [Google Scholar]
- Yúfera, M.; Pascual, E.; Fernandez-Diaz, C. A highly efficient microencapsulated food for rearing early larvae of marine fish. Aquaculture 1999, 177, 249–256. [Google Scholar] [CrossRef]
- Olsen, A.I.; Attramadal, Y.; Reitan, K.I.; Olsen, Y. Food selection and digestion characteristics of Atlantic halibut (Hippoglossus hippoglossus) larvae fed cultivated prey organisms. Aquaculture 2000, 181, 293–310. [Google Scholar] [CrossRef]
- Meng, Y.; Wang, J.; Wang, Z.; Zhang, G.; Liu, L.; Huo, G.; Li, C. Lactobacillus plantarum KLDS1.0318 Ameliorates Impaired Intestinal Immunity and Metabolic Disorders in Cyclophosphamide-Treated Mice. Front. Microbiol. 2019, 10, 731. [Google Scholar] [CrossRef] [PubMed]
- Doan, H.V.; Doolgindachbaporn, S.; Suksri, A.J.A.N. Effect of Lactobacillus plantarum and Jerusalem artichoke (Helianthus tuberosus) on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880). Aquac. Nutr. 2016, 22, 444–456. [Google Scholar] [CrossRef]
Gene | Primer Name | Primer Sequence (5′-3′) | Annealing Temp (°C) |
---|---|---|---|
ghrelin | Scghrelin-F | GCTTTCTCAGCCCTTCAC | 60 |
Scghrelin-R | GGTTGTCCTCAGTGGGTTG | ||
leptin | scleptinB-F | CGAGAGTCACCTTTACCTG | 58 |
scleptinB-R | GTGCAAATAAGCCTCTAAGTG | ||
npy | scNPY-F | GCAAATCTCCCTCTGACAATC | 60 |
scNPY-R | GGTTTCACCGGGTATCCTT | ||
agrp | scAgRP-F | GAGCCAAGCGAAGACCAGA | 58 |
scAgRP-R | GCAGCACGGCAAATGAGAG | ||
β-actin | β-actin-F | CCCTCTGAACCCCAAAGCCA | 59 |
β-actin-R | CAGCCTGGATGGCAACGTACA |
Index | LBFD | PFD | PFDCB | PFDLR | PFDLP |
---|---|---|---|---|---|
Observed species | 418.33 ± 107.84 c | 721.00 ± 66.55 a,b | 435.75 ± 18.91 c | 493.75 ± 85.17 b,c | 777.25 ± 35.03 a |
Shannon | 2.61 ± 125.16 a | 2.85 ± 39.55 a | 1.88 ± 22.37 a | 1.62 ± 126.45 a | 2.85 ± 12.40 a |
Simpson | 0.71 ± 151.35 a | 0.59 ± 47.19 a | 0.49 ± 16.06 a | 0.41 ± 131.67 a | 0.55 ± 29.14 a |
Chao 1 | 579.12 ± 0.51 b,c | 859.22 ± 0.10 a,b | 556.92 ± 0.34 c | 692.79 ± 0.35 a,b,c | 918.94 ± 0.33 a |
ACE | 612.28 ± 0.07 b | 902.63 ± 0.07 a,b | 588.27 ± 0.12 b | 722.63 ± 0.12 a,b | 993.75 ± 0.05 a |
PD whole tree | 68.41 ± 15.70 b | 85.20 ± 5.46 b | 80.21 ± 16.99 b | 169.72 ± 44.11 a,b | 199.00 ± 36.99 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Yi, H.; Liu, S.; Zhang, Y.; Su, Y.; Liu, X.; Bi, S.; Lai, H.; Zeng, Z.; Li, G. Probiotics Improve Eating Disorders in Mandarin Fish (Siniperca chuatsi) Induced by a Pellet Feed Diet via Stimulating Immunity and Regulating Gut Microbiota. Microorganisms 2021, 9, 1288. https://doi.org/10.3390/microorganisms9061288
Chen X, Yi H, Liu S, Zhang Y, Su Y, Liu X, Bi S, Lai H, Zeng Z, Li G. Probiotics Improve Eating Disorders in Mandarin Fish (Siniperca chuatsi) Induced by a Pellet Feed Diet via Stimulating Immunity and Regulating Gut Microbiota. Microorganisms. 2021; 9(6):1288. https://doi.org/10.3390/microorganisms9061288
Chicago/Turabian StyleChen, Xiaoli, Huadong Yi, Shuang Liu, Yong Zhang, Yuqin Su, Xuange Liu, Sheng Bi, Han Lai, Zeyu Zeng, and Guifeng Li. 2021. "Probiotics Improve Eating Disorders in Mandarin Fish (Siniperca chuatsi) Induced by a Pellet Feed Diet via Stimulating Immunity and Regulating Gut Microbiota" Microorganisms 9, no. 6: 1288. https://doi.org/10.3390/microorganisms9061288