The mutL Gene as a Genome-Wide Taxonomic Marker for High Resolution Discrimination of Lactiplantibacillus plantarum and Its Closely Related Taxa
Abstract
:1. Introduction
2. Materials and Methods
2.1. Genome-Based Mining of Taxonomic Markers for Species-Level Discrimination within L. plantarum Group
2.2. L. plantarum Group Strains and Culture Conditions
2.3. Degenerate PCR Primer Design, Nucleotide Sequencing and Phylogenetic Analysis on mutL Gene
2.4. Species-Specific Primer Design and Direct PCR-Based Identification
2.5. WGS of BCRC 06B0048 and Calculation of dDDH and Phylogenomic Tree Analysis
2.6. Differentiation of Strain BCRC 06B0048 and BCRC 11053T Based on Biochemical and Chemotaxonomic Characteristics
3. Results and Discussion
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zheng, J.; Wittouck, S.; Salvetti, E.; Franz, C.M.A.P.; Harri, H.M.B.; Mattarelli, P.; O’Toole, P.W.; Pot, B.; Vandamme, P.; Walter, J.; et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 2782–2858. [Google Scholar] [CrossRef]
- Tamang, J.P.; Holzapfel, W.H.; Watabane, K. Review: Diversity of microorganisms in global fermented foods and beverages. Front. Microbiol. 2016, 7, 377. [Google Scholar] [CrossRef] [Green Version]
- De Vries, M.C.; Vaughan, E.E.; Kleerebezem, M.; de Vos, W.M. Lactobacillus plantarum-survival, functional and potential probiotic properties in the human gastrointestinal tract. Int. Dairy J. 2006, 16, 1018–1028. [Google Scholar] [CrossRef]
- Ray, R.C.; Joshi, V.K. Fermented Foods: Past, present and future scenario. In Microorganisms and Fermentation of Traditional Foods; Ray, R.C., Montet, D., Eds.; CRC Press: Boca Raton, FL, USA, 2015; pp. 1–36. [Google Scholar]
- EFSA Panel on Biological Hazards (BIOHAZ); Ricci, A.; Allende, A.; Bolton, D.; Chemaly, M.; Davies, R.; Girones, R.; Koutsoumanis, K.; Herman, L.; Lindqvist, R.; et al. Update of the list of QPS-recommended biological agents intentionally added to food or feed as notified to EFSA 12: Suitability of taxonomic units notified to EFSA until March 2020. EFSA J. 2020, 18, 6174. [Google Scholar] [CrossRef]
- Venema, K.; Meijerink, M. Lactobacilli as probiotics: Discovering new functional aspects and target sites. In Probiotics and Prebiotics: Current Research and Future Trends; Venema, K., do Carmo, A.P., Eds.; Caister Academic Press: Norfolk, UK, 2015; pp. 29–42. [Google Scholar]
- Diaz, M.; Sayavedra, L.; Atter, A.; Mayer, M.J.; Saha, S.; Amoa-Awua, W.; Narbad, A. Lactobacillus garii sp. nov., isolated from a fermented cassava product. Int. J. Syst. Evol. Microbiol. 2020, 70, 3012–3017. [Google Scholar] [CrossRef]
- Liu, D.D.; Gu, C.T. Lactobacillus pingfangensis sp. nov., Lactobacillus daoliensis sp. nov., Lactobacillus nangangensis sp. nov., Lactobacillus daowaiensis sp. nov., Lactobacillus dongliensis sp. nov., Lactobacillus songbeiensis sp. nov. and Lactobacillus kaifaensis sp. nov., isolated from traditional Chinese pickle. Int. J. Syst. Evol. Microbiol. 2019, 69, 3237–3247. [Google Scholar] [PubMed]
- Bringel, F.; Castioni, A.; Olukoya, D.K.; Felis, G.E.; Torriani, S.; Dellaglio, F. Lactobacillus plantarum subsp. argentoratensis subsp. nov., isolated from vegetable matrices. Int. J. Syst. Evol. Microbiol. 2005, 55, 1629–1634. [Google Scholar]
- Petti, C.A. Detection and identification of microorganisms by gene amplification and sequencing. Clin. Infect. Dis. 2007, 44, 1108–1114. [Google Scholar] [PubMed]
- Naser, S.M.; Dawyndt, P.; Hoste, B.; Gevers, D.; Vandemeulebroecke, K.; Cleenwerck, I.; Vancanneyt, M.; Swings, J. Identification of lactobacilli by pheS and rpoA gene sequence analyses. Int. J. Syst. Evol. Microbiol. 2007, 57, 2777–2789. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naser, S.M.; Thompson, F.L.; Hoste, B.; Gevers, D.; Dawyndt, P.; Vancanneyt, M.; Swings, J. Application of multilocus sequence analysis (MLSA) for rapid identification of Enterococcus species based on rpoA and pheS genes. Microbiology 2005, 151, 2141–2150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Bruyne, K.; Camu, N.; De Vuyst, L.; Vandamme, P. Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation. Int. J. Syst. Evol. Microbiol. 2010, 60, 1999–2005. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Bruyne, K.; Franz, C.M.; Vancanneyt, M.; Schillinger, U.; Mozzi, F.; de Valdez, G.F.; de Vuyst, L.; Vandamme, P. Pediococcus argentinicus sp. nov. from Argentinean fermented wheat flour and identification of Pediococcus species by pheS, rpoA and atpA sequence analysis. Int. J. Syst. Evol. Microbiol. 2008, 58, 2909–2916. [Google Scholar] [CrossRef] [Green Version]
- De Bruyne, K.; Schillinger, U.; Caroline, L.; Boehringer, B.; Cleenwerck, I.; Vancanneyt, M.; De Vuyst, L.; Franz, C.M.A.P.; Vandamme, P. Leuconostoc holzapfelii sp. nov., isolated from Ethiopian coffee fermentation and assessment of sequence analysis of housekeeping genes for delineation of Leuconostoc species. Int. J. Syst. Evol. Microbiol. 2007, 57, 2952–2959. [Google Scholar] [CrossRef] [PubMed]
- Chao, S.H.; Huang, H.Y.; Kang, Y.H.; Watanabe, K.; Tsai, Y.C. The diversity of lactic acid bacteria in a traditional Taiwanese millet alcoholic beverage during fermentation. LWT Food Sci. Technol. 2013, 51, 135–142. [Google Scholar] [CrossRef]
- Chao, S.H.; Kudo, Y.; Tsai, Y.C.; Watanabe, K. Lactobacillus futsaii sp. nov., isolated from traditional fermented mustard products of Taiwan, futsai and suan-tsai. Int. J. Syst. Evol. Microbiol. 2012, 62, 489–494. [Google Scholar] [CrossRef] [Green Version]
- Chao, S.H.; Sasamoto, M.; Kudo, Y.; Fujimoto, J.; Tsai, Y.C.; Watanabe, K. Lactobacillus odoratitofui sp. nov., isolated from stinky tofu brine. Int. J. Syst. Evol. Microbiol. 2010, 60, 2903–2907. [Google Scholar] [CrossRef] [Green Version]
- Oki, K.; Kudo, Y.; Watanabe, K. Lactobacillus saniviri sp. nov. and Lactobacillus senioris sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 2012, 62, 601–607. [Google Scholar] [CrossRef] [Green Version]
- Nyanzi, R.; Jooste, P.J.; Cameron, M.; Witthuhn, C. Comparison of rpoA and pheS gene sequencing to 16S rRNA gene sequencing in identification and phylogenetic analysis of LAB from probiotic food products and supplements. Food Biotechnol. 2013, 27, 303–327. [Google Scholar] [CrossRef]
- Huang, C.H.; Liou, J.S.; Lee, A.Y.; Tseng, M.; Miyashita, M.; Huang, L.; Watanabe, K. Polyphasic characterization of a novel species in the Lactobacillus casei group from cow manure of Taiwan: Description of L. chiayiensis sp. nov. Syst. Appl. Microbiol. 2018, 41, 270–278. [Google Scholar] [CrossRef]
- Mattarelli, P.; Holzapfel, W.; Franz, C.M.; Endo, A.; Felis, G.E.; Hammes, W.; Pot, B.; Dicks, L.; Dellaglio, F. Recommended minimal standards for description of new taxa of the genera Bifidobacterium, Lactobacillus and related genera. Int. J. Syst. Evol. Microbiol. 2014, 64, 1434–1451. [Google Scholar] [CrossRef] [Green Version]
- Glaeser, S.P.; Kämpfer, P. Multilocus sequence analysis (MLSA) in prokaryotic taxonomy. Syst. Appl. Microbiol. 2015, 38, 237–245. [Google Scholar] [CrossRef] [PubMed]
- Mulet, M.; Lalucat, J.; Valdes, E. DNA sequence-based analysis of the Pseudomonas species. Environ. Microbiol. 2010, 12, 1513–1530. [Google Scholar]
- Lai, Q.; Liu, Y.; Yuan, J.; Du, J.; Wang, L.; Sun, F.; Shao, Z. Multilocus sequence analysis for assessment of phylogenetic diversity and biogeography in Thalassospira bacteria from diverse marine environments. PLoS ONE 2014, 9, e106353. [Google Scholar] [CrossRef]
- Li, L.; Wieme, A.; Spitaels, F.; Balzarini, T.; Nunes, O.C.; Manaia, C.M.; Landchoot, A.V.; De Vuyst, L.; Cleenwerck, I.; Vandamme, P. Acetobacter sicerae sp. nov., isolated from cider and kefir, and identification of species of the genus Acetobacter by dnaK, groEL and rpoB sequence analysis. Int. J. Syst. Evol. Microbiol. 2014, 64, 2407–2415. [Google Scholar] [CrossRef]
- Rosselló-Móra, R.; Amann, R. Past and future species definitions for Bacteria and Archaea. Syst. Appl. Microbiol. 2015, 38, 209–216. [Google Scholar] [CrossRef] [PubMed]
- Peeters, C.; Meier-Kolthoff, J.P.; Verheyde, B.; De Brandt, E.; Cooper, V.S.; Vandamme, P. Phylogenomic study of Burkholderia glatheilike organisms, proposal of 13 novel Burkholderia species and emended descriptions of Burkholderia sordidicola, Burkholderia zhejiangensis, and Burkholderia grimmiae. Front. Microbiol. 2016, 7, 877. [Google Scholar] [CrossRef] [PubMed]
- Chun, J.; Rainey, F.A. Integrating genomics into the taxonomy and systematics of the Bacteria and Archaea. Int. J. Syst. Evol. Microbiol. 2014, 64, 316–324. [Google Scholar] [CrossRef]
- Ramasamy, D.; Mishra, A.K.; Lagier, J.C.; Padhmanabhan, R.; Rossi, M.; Sentausa, E.; Raoult, D.; Fournier, P.E. A polyphasic strategy incorporating genomic data for the taxonomic description of novel bacterial species. Int. J. Syst. Evol. Microbiol. 2014, 64, 384–391. [Google Scholar] [CrossRef]
- Vandamme, P.; Peeters, C. Time to revisit polyphasic taxonomy. Antonie Van Leeuwenhoek 2014, 106, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Zong, Z. Genome-based Taxonomy for Bacteria: A Recent Advance. Trends Microbiol. 2020, 28, 871–874. [Google Scholar] [CrossRef]
- Chun, J.; Oren, A.; Ventosa, A.; Christensen, H.; Arahal, D.R.; da Costa, M.S.; Rooney, A.P.; Yi, H.; Xu, X.W.; De Meyer, S.; et al. Proposed minimal standards for the use of genome data for the taxonomy of prokaryotes. Int. J. Syst. Evol. Microbiol. 2018, 68, 461–466. [Google Scholar] [CrossRef]
- Goris, J.; Konstantinidis, T.K.; Klappenbach, J.A.; Coenye, T.; Vandamme, P.; Tiedje, J.M. DNA–DNA hybridization values and their relationship to whole-genome sequence similarities. Int. J. Syst. Evol. Microbiol. 2007, 57, 81–91. [Google Scholar] [CrossRef] [Green Version]
- Meier-Kolthoff, J.P.; Auch, A.F.; Klenk, H.P.; Goker, M. Genome sequence-based species delimitation with confidence intervals and improved distance functions. BMC Bioinform. 2013, 14, 60. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.Y.; Lin, J.W.; Chen, C.C. cano-wgMLST_BacCompare: A Bacterial Genome Analysis Platform for Epidemiological Investigation and Comparative Genomic Analysis. Front. Microbiol. 2019, 10, 1687. [Google Scholar] [CrossRef] [PubMed]
- Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef]
- Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.Z.; Lopez, R.; McWilliam, H.; Remmert, M.; Soding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [PubMed]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [Green Version]
- Huang, C.H.; Huang, L. Rapid species- and subspecies-specific level classification and identification of Lactobacillus casei group members using MALDI Biotyper combined with ClinProTools. J. Dairy Sci. 2018, 101, 979–991. [Google Scholar] [CrossRef]
- Meier-Kolthoff, J.P.; Göker, M. TYGS is an automated high-throughput platform for state-of- the- art genome-based taxonomy. Nat. Commun. 2019, 10, 2182. [Google Scholar] [CrossRef]
- Chern, L.L.; Stackebrandt, E.; Lee, S.F.; Lee, F.L.; Chen, J.K.; Fu, H.M. Chitinibacter tainanensis gen. nov., sp. nov., a chitin-degrading aerobe from soil in Taiwan. Int. J. Syst. Evol. Microbiol. 2004, 54, 1387–1391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, M.; Oh, H.S.; Park, S.C.; Chun, J. Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. Int. J. Syst. Evol. Microbiol. 2014, 64, 346–351. [Google Scholar] [CrossRef] [PubMed]
- Torriani, S.; Clementi, F.; Vancanneyt, M.; Hoste, B.; Dellaglio, F.; Kersters, K. Differentiation of Lactobacillus plantarum, L. pentosus and L. paraplantarum species by RAPD-PCR and AFLP. Syst. Appl. Microbiol. 2001, 24, 554–560. [Google Scholar] [CrossRef] [PubMed]
- Koort, J.; Vandamme, P.; Schillinger, U.; Holzapfel, W.; Bjorkroth, J. Lactobacillus curvatus subsp. melibiosus is a later synonym of Lactobacillus sakei subsp. carnosus. Int. J. Syst. Evol. Microbiol. 2004, 54, 1621–1626. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, K.; Fujimoto, J.; Tomii, Y.; Sasamoto, M.; Makino, H.; Kudo, Y.; Okada, S. Lactobacillus kisonensis sp. nov., Lactobacillus otakiensis sp. nov. Lactobacillus rapi sp. nov. and Lactobacillus sunkii sp. nov., four novel heterofermentative species isolated from sunki, a Japanese traditional pickle. Int. J. Syst. Evol. Microbiol. 2009, 59, 754–760. [Google Scholar] [PubMed]
- Huang, C.H.; Lee, F.L.; Liou, J.S. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques. Antonie Van Leeuwenhoek 2010, 97, 289–296. [Google Scholar] [CrossRef]
- Huang, C.H.; Lee, F.L. The dnaK gene as a molecular marker for the classification and discrimination of the Lactobacillus casei group. Antonie Van Leeuwenhoek 2011, 99, 319–327. [Google Scholar] [CrossRef]
- Huang, H.; Huang, L.; Wu, C.P.; Chang, M.T. Molecular discrimination of Lactobacillus plantarum group using comparative sequence analysis of the dnaJ gene and as a target for developing novel species-specific PCR primers. J. Chin. Soc. Anim. Sci. 2016, 45, 45–55. [Google Scholar]
- Yu, J.; Sun, Z.; Liu, W.; Bao, Q.; Zhang, J.; Zhang, H. Phylogenetic study of Lactobacillus acidophilus group, L. casei group and L. plantarum group based on partial hsp60, pheS and tuf gene sequences. Eur. Food Res. Technol. 2014, 234, 927–934. [Google Scholar] [CrossRef]
- Conti, A.; Corte, L.; Pierantoni, D.C.; Robert, V.; Cardinali, G. What Is the Best Lens? Comparing the Resolution Power of Genome-Derived Markers and Standard Barcodes. Microorganisms 2021, 2, 299. [Google Scholar] [CrossRef]
- Grana-Miraglia, L.; Arreguin-Perez, C.; Lopez-Leal, G.; Munoz, A.; Perez-Oseguera, A.; Miranda-Miranda, E.; Cossío-Bayúgar, R.; Castillo-Ramírez, S. Phylogenomics picks out the par excellence markers for species phylogeny in the genus Staphylococcus. PeerJ 2018, 6, e5839. [Google Scholar] [CrossRef] [Green Version]
- Dong, W.; Liu, H.; Xu, C.; Zuo, Y.; Chen, Z.; Zhou, S. A chloroplast genomic strategy for designing taxon specific DNA mini-barcodes: A case study on ginsengs. BMC Genet. 2014, 15, 138. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.E.; Kim, E.; Yang, S.M.; Lee, S.; Kim, M.J.; Kim, H.Y. Development of Real-Time PCR Assay to Specifically Detect 22 Bifidobacterium Species and Subspecies Using Comparative Genomics. Front. Microbiol. 2020, 11, 2087. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.; Yang, S.M.; Cho, E.J.; Kim, H.Y. Novel real-time PCR assay for Lactobacillus casei group species using comparative genomics. Food Microbiol. 2020, 90, 103485. [Google Scholar] [CrossRef]
- Kim, E.; Yang, S.M.; Lim, B.; Park, S.H.; Rackerby, B.; Kim, H.Y. Design of PCR assays to specifically detect and identify 37 Lactobacillus species in a single 96 well plate. BMC Microbiol. 2020, 20, 96. [Google Scholar] [CrossRef] [Green Version]
- Li, G.M. Mechanisms and functions of DNA mismatch repair. Cell Res. 2008, 18, 85–98. [Google Scholar] [CrossRef] [Green Version]
- Bottari, B.; Felis, G.E.; Salvetti, E.; Castioni, A.; Campedelli, I.; Torriani, S.; Bernini, V.; Gatti, M. Effective identification of Lactobacillus casei group species: Genome-based selection of the gene mutL as the target of a novel multiplex PCR assay. Microbiology 2017, 163, 950–960. [Google Scholar] [CrossRef]
- Cai, H.; Rodriguez, B.T.; Zhang, W.; Broadbent, J.R.; Steele, J.L. Genotypic and phenotypic characterization of Lactobacillus casei strains isolated from different ecological niches suggests frequent recombination and niche specificity. Microbiology 2007, 153, 2655–2665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- de las Rivas, B.; Marcobal, A.; Muñoz, R. Development of a multilocus sequence typing method for analysis of Lactobacillus plantarum strains. Microbiology 2006, 152, 85–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, H.; Liu, W.; Zhang, W.; Yu, J.; Song, Y.; Menhe, B.; Zhang, F.; Sun, Z. Use of multilocus sequence typing to infer genetic diversity and population structure of Lactobacillus plantarum isolates from different sources. BMC Microbiol. 2015, 15, 241. [Google Scholar] [CrossRef] [Green Version]
- Meier-Kolthoff, J.P.; Hahnke, R.L.; Petersen, J.; Scheuner, C.; Michael, V.; Fiebig, A.; Rohde, C.; Rohde, M.; Fartmann, B.; Goodwin, L.A.; et al. Complete genome sequence of DSM 30083(T), the type strain (U5/41(T)) of Escherichia coli, and a proposal for delineating subspecies in microbial taxonomy. Stand. Genom. Sci. 2014, 9, 2. [Google Scholar] [CrossRef] [Green Version]
- Nouioui, I.; Carro, L.; Garcia-Lopez, M.; Meier-Kolthoff, J.P.; Woyke, T.; Kyrpides, N.C.; Pukall, R.; Klenk, H.R.; Goodfellow, M.; Göker, M. Genome-based taxonomic classification of the phylum Actinobacteria. Front. Microbiol. 2018, 9, 2007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, F.; Cheng, C.C.; Zheng, J.; Liou, J.; Quevedo, R.M.; Li, J.; Roos, S.; Gänzle, M.G.; Walter, J. Limosilactobacillus balticus sp. nov., Limosilactobacillus agrestis sp. nov., Limosilactobacillus albertensis sp. nov., Limosilactobacillus rudii sp. nov. and Limosilactobacillus fastidiosus sp. nov., five novel Limosilactobacillus species isolated from the vertebrate gastrointestinal tract, and proposal of six subspecies of Limosilactobacillus reuteri adapted to the gastrointestinal tract of specific vertebrate hosts. Int. J. Syst. Evol. Microbiol. 2021, 71, 004644. [Google Scholar]
No. | Species | Strain No. | Other Destination | Species-Specific PCR Assays | |||
---|---|---|---|---|---|---|---|
spLplan-F/R | spLarg-F/R | spLpara-F/R | spLpen-F/R | ||||
1 | L. plantarum | BCRC10069T | ATCC 14917T | + | − | − | − |
2 | BCRC 10357 | ATCC 8014 | + | − | − | − | |
3 | BCRC 12251 | ATCC 10241 | + | − | − | − | |
4 | BCRC 14059 | ATCC 10012 | + | − | − | − | |
5 | BCRC 15478 | NCDO 1193 | + | − | − | − | |
6 | BCRC 18858 | NRIC 1943 | + | − | − | − | |
7 | BCRC 80061 | − | + | − | − | − | |
8 | BCRC 80222 | CECT 5787 | + | − | − | − | |
9 | BCRC 80578 | NCDO 772 | + | − | − | − | |
10 | BCRC 80580 | CICC 6026 | + | − | − | − | |
11 | BCRC 80581 | CICC 20764 | + | − | − | − | |
12 | BCRC 06B0002 | − | + | − | − | − | |
13 | BCRC 06B0006 | − | + | − | − | − | |
14 | BCRC 06B0023 | − | + | − | − | − | |
15 | BCRC 06B0036 | − | + | − | − | − | |
16 | BCRC 11B0079 | − | + | − | − | − | |
17 | BCRC 11B0117 | − | + | − | − | − | |
18 | BCRC 11B0122 | − | + | − | − | − | |
19 | BCRC 11B0168 | − | + | − | − | − | |
20 | BCRC 11B0177 | − | + | − | − | − | |
21 | L. argentoratensis | BCRC17638T | DSM 16365T | − | + | − | − |
22 | BCRC 17639 | CCUG 50788 | − | + | − | − | |
23 | BCRC 17640 | CCUG 50789 | − | + | − | − | |
24 | L. paraplantarum | BCRC 17178T | DSM 10667T | − | − | + | − |
25 | BCRC 17970 | ATCC 10776 | − | − | + | − | |
26 | BCRC 17971 | ATCC 700210 | − | − | + | − | |
27 | BCRC 80221 | CECT 5783 | − | − | + | − | |
28 | L. pentosus | BCRC 11053T | ATCC 8041T | − | − | − | + |
29 | BCRC 17972 | LMG 9210 | − | − | − | + | |
30 | BCRC 80017 | JCM 8334 | − | − | − | + | |
31 | BCRC 80018 | JCM 8335 | − | − | − | + | |
32 | BCRC 06B0048 | − | − | − | − | + | |
33 | L. daoliensis | 116-1AT | NCIMB 15181 | − | − | − | − |
34 | L. pingfangensis | 382-1T | NCIMB 15187 | − | − | − | − |
35 | L. daowaiensis | 203-3T | NCIMB 15183 | − | − | − | − |
36 | L. nangangensis | 381-7T | NCIMB 15186 | − | − | − | − |
37 | L. herbarum | BCRC 80996T | DSM 100358T | − | − | − | − |
38 | L. fabifermentans | BCRC 18841T | LMG 24284T | − | − | − | − |
39 | L. plajomi | BCRC 80928T | NBRC 107233T | − | − | − | − |
40 | L. xiangfangensis | BCRC 80512T | LMG 26013T | − | − | − | − |
41 | L. modestisalitolerans | BCRC 80927T | NBRC 107235T | − | − | − | − |
42 | L. dongliensis | 218-3T | NCIMB 15184T | − | − | − | − |
43 | L. songbeiensis | 398-2T | NCIMB 15189T | − | − | − | − |
44 | L. mudanjiangensis | 11050T | LMG 27194T | − | − | − | − |
45 | L. acidophilus | BCRC 10695T | ATCC 4356T | − | − | − | − |
46 | L. casei | BCRC 10697T | ATCC 393T | − | − | − | − |
47 | L. crispatus | BCRC 14618T | ATCC 33820T | − | − | − | − |
48 | L. curvatus | BCRC 12189T | DSM 20019T | − | − | − | − |
49 | L. delbrueckii subsp. bulgaricus | BCRC 10696T | ATCC 11842T | − | − | − | − |
50 | L. gallinarum | BCRC 17266T | ATCC 33199T | − | − | − | − |
51 | L. gasseri | BCRC 14619T | ATCC 33323T | − | − | − | − |
52 | L. paracasei | BCRC 12248T | ATCC 25302T | − | − | − | − |
53 | L. rhamnosus | BCRC 10940T | ATCC 7469T | − | − | − | − |
54 | L. sakei | BCRC 14622T | ATCC 15521T | − | − | − | − |
55 | L. taiwanensis | BCRC 17755T | JCM 18086T | − | − | − | − |
56 | L. ultunensis | BCRC 17714T | DSM 16047T | − | − | − | − |
No. | Species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | L. plantarum BCRC 10069T | 85.6 | 76.1 | 69.4 | 64.9 | 64.0 | 64.5 | 67.0 | 64.8 | 67.9 | 64.6 | 65.9 | 68.1 | 66.8 | 65.0 | 65.7 | 64.9 | |
2 | L. argentoratensis BCRC 17638T | 100 | 73.6 | 68.6 | 65.1 | 64.4 | 64.6 | 66.2 | 65.4 | 66.6 | 64.7 | 65.6 | 68.0 | 66.4 | 63.8 | 65.1 | 64.4 | |
3 | L. paraplantarum BCRC 17178T | 99.7 | 99.7 | 69.3 | 66.7 | 66.2 | 66.5 | 66.4 | 66.5 | 68.1 | 66.2 | 65.4 | 68.8 | 65.2 | 67.0 | 66.1 | 66.6 | |
4 | L. pentosus BCRC 11053T | 99.9 | 99.9 | 99.8 | 65.4 | 65.9 | 66.5 | 66.5 | 63.3 | 66.4 | 64.1 | 65.8 | 67.9 | 64.5 | 65.8 | 67.5 | 66.1 | |
5 | L. daoliensis 116-1AT | 99.0 | 99.0 | 99.0 | 99.1 | 71.6 | 65.6 | 65.9 | 73.8 | 63.7 | 66.4 | 64.5 | 64.3 | 65.1 | 66.0 | 66.3 | 65.9 | |
6 | L. pingfangensis 382-1T | 99.0 | 99.0 | 99.2 | 99.1 | 99.7 | 70.4 | 64.5 | 73.0 | 66.3 | 65.9 | 65.5 | 66.5 | 66.2 | 65.8 | 66.9 | 69.9 | |
7 | L. daowaiensis 203-3T | 98.9 | 98.9 | 98.8 | 98.9 | 98.5 | 98.5 | 66.0 | 66.1 | 64.3 | 68.2 | 62.7 | 66.1 | 67.0 | 70.2 | 69.5 | 71.1 | |
8 | L. garii FI11369T | 98.9 | 98.9 | 98.9 | 98.9 | 98.5 | 98.5 | 98.7 | 61.6 | 64.9 | 65.4 | 69.6 | 73.3 | 64.6 | 66.1 | 66.3 | 64.3 | |
9 | L. nangangensis 381-7T | 98.9 | 98.9 | 99.0 | 99.0 | 99.9 | 99.8 | 98.6 | 98.6 | 63.8 | 66.7 | 63.4 | 65.4 | 64.3 | 66.0 | 67.6 | 67.6 | |
10 | L. herbarum BCRC 80996T | 98.9 | 98.9 | 98.9 | 98.9 | 98.3 | 98.5 | 98.0 | 98.0 | 98.4 | 64.0 | 64.9 | 67.7 | 62.4 | 64.0 | 64.6 | 64.3 | |
11 | L. fabifermentans BCRC 18841T | 98.9 | 98.9 | 98.9 | 98.9 | 98.5 | 98.6 | 98.5 | 98.5 | 98.5 | 98.3 | 62.7 | 64.5 | 65.0 | 66.3 | 67.3 | 66.1 | |
12 | L. plajomi BCRC 80928T | 98.8 | 98.8 | 98.5 | 98.7 | 98.0 | 97.8 | 98.2 | 99.0 | 97.9 | 97.7 | 98.1 | 68.1 | 64.3 | 65.4 | 64.8 | 62.8 | |
13 | L. xiangfangensis BCRC 80512T | 98.7 | 98.7 | 98.7 | 98.8 | 99.0 | 99.0 | 98.4 | 99.4 | 99.1 | 98.0 | 98.5 | 98.7 | 65.6 | 68.0 | 70.5 | 68.6 | |
14 | L. modestisalitolerans BCRC 80927T | 98.5 | 98.5 | 98.4 | 98.5 | 97.8 | 97.7 | 97.8 | 98.7 | 97.8 | 97.5 | 97.5 | 98.9 | 98.4 | 67.0 | 67.7 | 66.0 | |
15 | L. dongliensis 218-3T | 98.0 | 98.0 | 97.8 | 97.9 | 97.9 | 98.1 | 98.3 | 97.6 | 98.0 | 97.3 | 97.5 | 96.9 | 97.9 | 96.8 | 80.2 | 69.9 | |
16 | L. songbeiensis 398-2T | 97.9 | 97.9 | 97.9 | 98.0 | 98.1 | 98.2 | 98.2 | 97.5 | 98.2 | 97.4 | 97.6 | 96.9 | 98.0 | 96.7 | 99.8 | 70.3 | |
17 | L. mudanjiangensis 11050T | 97.8 | 97.8 | 97.9 | 97.9 | 97.9 | 98.1 | 98.5 | 97.6 | 98.0 | 97.6 | 97.5 | 96.9 | 97.5 | 96.8 | 98.7 | 98.8 |
No. | Primer | Target | Sequence (5′–3′) | Amplicon Size (bp) |
---|---|---|---|---|
1 | spLarg-F | L. argentoratensis | CCTTTGGTGAACCCGCTGAA | 319 |
spLarg-R | AGTTCGGCTAATAGTGGCAA | |||
2 | spLpara-F | L. paraplantarum | TCAGGTGGCGGATAAGACTAC | 115 |
spLpara-R | GGTTGCCGAMGTGGCGTCA | |||
3 | spLpen-F | L. pentosus | CCTCCGCTGAACCAATCATG | 385 |
spLpen-R | TTCAGGACATCACTGGTGGG | |||
4 | spLplan-F | L. plantarum | GCGRTTGTTCCGTCAGAAT | 176 |
spLplan-R | CTTGCAGCCGTGCTGGTTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, C.-H.; Chen, C.-C.; Lin, Y.-C.; Chen, C.-H.; Lee, A.-Y.; Liou, J.-S.; Gu, C.-T.; Huang, L. The mutL Gene as a Genome-Wide Taxonomic Marker for High Resolution Discrimination of Lactiplantibacillus plantarum and Its Closely Related Taxa. Microorganisms 2021, 9, 1570. https://doi.org/10.3390/microorganisms9081570
Huang C-H, Chen C-C, Lin Y-C, Chen C-H, Lee A-Y, Liou J-S, Gu C-T, Huang L. The mutL Gene as a Genome-Wide Taxonomic Marker for High Resolution Discrimination of Lactiplantibacillus plantarum and Its Closely Related Taxa. Microorganisms. 2021; 9(8):1570. https://doi.org/10.3390/microorganisms9081570
Chicago/Turabian StyleHuang, Chien-Hsun, Chih-Chieh Chen, Yu-Chun Lin, Chia-Hsuan Chen, Ai-Yun Lee, Jong-Shian Liou, Chun-Tao Gu, and Lina Huang. 2021. "The mutL Gene as a Genome-Wide Taxonomic Marker for High Resolution Discrimination of Lactiplantibacillus plantarum and Its Closely Related Taxa" Microorganisms 9, no. 8: 1570. https://doi.org/10.3390/microorganisms9081570