1. Introduction
Pork is one of the most consumed meats worldwide and is an important and widely available protein component of human diet due to its unique chemical composition, nutritional value, and the content of balanced protein [
1]. The quality and safety of pork are closely related to human health [
2,
3]. Hence, it is of great significance to improve pork quality and provide healthy and safe pork for humans.
Pork quality is affected by multiple interactive factors, including genetics, nutrition, management practices, slaughtering procedures, and handling of the porcine carcass [
1,
4]. Importantly, previous studies have demonstrated that dietary fatty acid composition plays a vital role in regulating the nutritional quality of pork [
5,
6]. Fatty acids, especially essential fatty acids, are basic and important nutrients in the human diet. The content of n-3 and n-6 polyunsaturated fatty acids (PUFA) and their proportions are linked to human diseases, including obesity, cardiovascular, cerebrovascular diseases, depression, and cancer, and high n-3 PUFA content and low n-6/n-3 PUFA ratio are more beneficial to human health [
7,
8]. Notably, pork has a high n-6/n-3 PUFA ratio due to typical feeding practices [
9]. The content of n-3 PUFA in pork can be regulated by genetic modification and nutritional regulation, which can make pork more in line with human dietary demand for n-3 PUFA [
5,
10]. Nutritional regulation is a safe and acceptable strategy to improve fatty acid composition and is also a hot spot of research at this stage. Recent studies have found that fatty acids especially n-6/n-3 PUFA ratio could influence the fatty acid composition and meat quality in lean breeds of pigs [
5,
6,
11]. Breed is also an important factor that can significantly affect the fatty acid composition of pork. Compared with the typical lean pig breeds, some Chinese indigenous pig breeds have certain advantages in fatty acid composition, better flavor, and higher PUFA [
12]. Heigai pig, one of the Chinese local fatty breeds, exists in Shandong province and has the specific characteristics of prolificacy, crude feed tolerance, tender meat, strong disease resistance, strong adaptability to the environment, and so on, and is worth studying. However, research on indigenous pig breeds are few and the effects of dietary fatty acid composition on indigenous pig breeds are still poorly understood. Furthermore, no studies have been done to examine the regulation of dietary fatty acid composition on growth performance, meat quality, and fatty acid profiles in Heigai pigs.
In this study, we investigated the effects of dietary supplementation with different n-6/n-3 PUFA ratios on growth performance, meat quality, fatty acid composition, and lipid metabolism-related gene expression in Heigai pigs. Our results can provide an experimental reference for producing functional pork (e.g., better fatty acid composition) with the advantages of Chinese local breed pigs.
2. Materials and Methods
2.1. Experimental Design and Diets
All procedures and housing were approved by the Zhejiang University Animal Care and Use Committee. The ethical committee number for the study is ZJU20170466. A total of 54 Heigai finishing pigs (body weight: 71.59 ± 2.16 kg) were randomly divided into 3 treatments with 6 replications (3 pigs per replication) and were fed with different n-6/n-3 PUFA ratio diets: 8:1, 5:1, and 3:1 (the fatty acid profiles of the different diets were shown in
Table A1). The composition and nutritional levels of the diet were shown in
Table 1. The pigs were group-housed fed with the corresponding diet for 75 days (five days pre-feeding period and seventy days formal test period). The growth performance, including body weight (BW) and feed intake of each pen were recorded, and average daily gain (ADG), average daily feed intake (ADFI), ratio feed to gain (F/G), and feed conversion ratio of each pen, were calculated. At the end of the feeding, 1 pig (close to the average body weight) per replication were selected from each group and fasted for 12 h to then be humanely sacrificed.
2.2. Sample Collection
Samples of longissimus dorsi muscle (LDM) were obtained from the 3rd to 11th rib for meat quality measurement. About 150 g LDM and subcutaneous adipose tissue (SAT) at the 13th rib on right side carcass were rapidly collected, frozen in liquid nitrogen immediately, and subsequently stored at −80 °C for fatty acid composition and gene expression analysis. A block of (fat or muscle tissue) was removed from the body (not more than 0.25 cm2) and was put into an fixative solution (10% formalin) for hematoxylin-eosin staining.
2.3. Carcass Traits Measurement
Slaughter weight, carcass weight, dressing percentage, carcass length, backfat thickness, skin thickness, loin muscle area, and lean percentage were measured after slaughter. Backfat thickness measurements were taken at the midline with a sliding caliper. Mean backfat thickness was calculated by averaging the scores of three regions at the first rib, last rib, and last lumbar vertebrae of the right carcass sides.
2.4. Determination of Meat Quality
The pH value of each sample was measured three times between the fourth and fifth lumbar vertebrae in the left side LDM at 45 min and 24 h after slaughter using a pH-meter (PH-STAR, MATTHAUS, Germany). The drip loss was determined by suspending muscle samples standardized for surface area in plastic bags at 4 °C for 24 h. Drip loss was expressed as a percentage of the initial weight [
13]. Marbling scores and meat color scores were scored at 45 min after slaughter according to reference standards (NPPC-1994, America). There are 5 scores on the NPPC colorimetric board, which are arranged from light to dark for the quantitative evaluation of meat color: 1 point = off-white (abnormal meat color); 2 points = light gray (prone to abnormal meat color); 3 points = normal bright red; 4 points = slightly dark red (normal meat color); 5 points = dark purple (abnormal meat color). There are 5 scores on the NPPC marbling measurement board: 1 point = little fat trace; 2 points = fat trace; 3 points = fat; 4 points = a lot of fat; 5 points = excess fat. Meat color was respectively measured 45 min and 24 h after slaughter at the surface of a 2 -cm-thick boneless loin chop using a Minolta CM-2002 (Osaka, Japan) spectrophotometer with CIE lab color system: L* (lightness), a* (red-green) and b* (yellow-blue).
2.5. Hematoxylin-Eosin Staining
The tissues were taken from the fixative solution for paraffin embedding and microtome sectioning. The paraffin sections were stained by hematoxylin-eosin staining kit (Servicebio, Wuhan, China). Briefly, after deparaffinization and rehydration, sections were stained with hematoxylin solution for 5 min followed by being immersed in 1% acid ethanol (1% HCl in 70% ethanol) for 10 s and then rinsed in water for 1 h. Finally, the sections were stained with eosin solution for 3 min and followed by dehydration with graded alcohol and clearing in xylene [
14]. The slides were examined and photographed using an Olympus BX61 fluorescence microscope (Japan). Observed morphological structure of cells. The size of cells (4 random fields of equal area) was analyzed by Image-Pro Plus 6.0 software.
2.6. Determination of Triglyceride, Total Cholesterol, and Non-Esterified Fatty Acid
The contents of triglyceride (TG), total cholesterol (TC), and non-esterified fatty acid (NEFA) in LDM and SAT were determined by commercial kits (TG, A110-1-1; TC, A111-1-1; NEFA, A042-2-1) bought from Nanjing Jiancheng Institute of Bioengineering.
2.7. Fatty Acid Composition Analysis
Fatty acid profiles of LDM and SAT samples were determined by gas chromatography as previously reported [
15]. Briefly, samples were extracted with a mixture of chloroform and methanol (2:1;
v/
v) according to the methods previously described [
16]. Then, total fat was converted into fatty acid methyl esters (FAMEs) and determined by gas chromatography, which was equipped with a capillary column. The GC Chem Station software was used to separate FAMEs. The FAMEs profiles of the samples were compared with FAMEs standards to identify the fatty acids in SAT and LDM. Fatty acid content was expressed as a percentage of total fatty acids.
2.8. Total RNA Extraction, Reverse Transcription, and Quantitative Real-Time PCR
Total RNA was prepared from the LDM and SAT using TRIzol reagent (Thermo Fisher, Waltham, MA, USA) according to the instruction of the manufacture as previously described [
17]. The concentration and purity of the total RNA were measured using the NanoDrop 2000 instrument (Gene Company Limited, Hong Kong, China). About 2 μg of total RNA samples were subjected to reverse transcription with the use of random primers and a ReverAid First Strand cDNA Synthesis Kit (Thermo Fisher). The qPCR was performed by the BioRad CFX96Touch Fast Real-Time PCR System and FastStart Universal SYBR Green Master (ROX, Shanghai, China). The primers used for qPCR were: Glyceraldehyde-3-phosphate dehydrogenase (GPDH; GPDH-F: AAGGAGTAAGAGCCCCTGGA; GPDH-R: TCTGGGATGGAAACTGGAA); adipose triglyceride lipase (ATGL; ATGL-F: TCACCAACACCAGCATCCA; ATGL-R: GCACATCTCTCGAAGCACCA); Hormone-sensitive lipase (HSL-F: GCAGCATCTTCTTCCGCACA; HSL-R: AGCCCTTGCGTAGAGTGACA); Carnitine palmitoyltransferase 1 (CPT1-F: ATGGTGGGCGACTAACT; CPT1-R: TGCCTGCTGTCTGTGAG); Fatty acid binding protein 4 (FABP4-F: GGGACATCAAGGAGAAGC; FABP4-R: ACCGTGTTGGCGTAGAG). The relative changes in gene expression normalized against GAPDH rRNA as the internal control (analyzed by the 2−ΔΔCT method). Dietary n-6/n-3 PUFA ratio of 8:1 was used as the control diet to calculate relative gene expression.
2.9. Statistical Analysis
Data were analyzed by one-way ANOVA of SPSS 20.0 (IBM-SPSS Inc., Chicago, IL, USA) and compared using Duncan posthoc test. p < 0.05 was considered to be statistically significant.
4. Discussion
In this study, we investigated the effects of dietary supplementation with different n-6/n-3 PUFA ratios on the growth performance, meat quality, and fatty acid profiles in Heigai pigs. We found that dietary supplementation with a lower n-6/n-3 PUFA ratio increased the ratio of feed to gain. Notably, dietary n-6/n-3 PUFA ratio regulated the pH and meat color measured by CIE lab color system. However, sensory evaluation of the meat color was not affected. Moreover, dietary n-6/n-3 PUFA ratio affected the fatty acid profiles in LDM and SAT of Heigai pigs. The contents of the TG and TC as well as the expression of lipid metabolism-related genes in LDM and SAT were regulated by dietary n-6/n-3 PUFA ratio.
Dietary supplementation with lower n-6/n-3 PUFA ratio increased the ratio of feed to gain and decreased the carcass weight. However, a previous study showed that a diet with a lower n-6/n-3 PUFA ratio, rich in n-3 PUFA, was beneficial for the growth performance and health of animals [
18]. Although the difference was not significant, the backfat thickness was reduced in our results. These results indicate that the dietary n-6/n-3 PUFA ratio can affect the increase of carcass weight by reducing the backfat contents, causing the increased F: G ratio with a lower n-6/n-3 PUFA ratio.
In this study, pigs fed the dietary n-6/n-3 PUFA ratio of 3:1 reduced the ΔpH, a* (45 min), a* (24 h), b* (24 h), Δa*, and Δb*, but increased the pH (24 h), and L* (24 h). The results of ΔpH, Δa*, and Δb* suggest that lower dietary n-6/n-3 PUFA ratio protects against the rate of pH drop, and the rate of a* and b* raise. Likewise, a previous study reported that there was a reduction in b* after feeding a high n-3 PUFA content diet [
19]. However, other studies showed that a higher n-3 PUFA diet had no significant effect on pH, L*, a*, and b* [
20,
21,
22]. These differences might be due to the different breeds and diets used in the current and previous studies. These results suggested that supplementation with high n-3 PUFA and low n-6/n-3 PUFA ratio may regulate the pH and meat color of LDM. Moreover, we found no significant differences in sensory evaluation of meat color, which prompted us to assume that consumers may not feel the change in meat color.
We also found that high n-3 PUFA and low n-6/n-3 PUFA ratio diet reduced TC and TG contents. These results were consistent with the previous findings that n-3 PUFA could help to reduce TG and TC contents [
23,
24]. These data suggest that high n-3 PUFA and low n-6/n-3 PUFA ratio diets could help us to produce pork meat with low TC and TG contents.
Our results also demonstrate that the dietary n-6/n-3 PUFA ratio altered the fatty acid profiles in SAT and LDM of Heigai pigs, which are consistent with the results of previous studies that dietary fatty acid composition can affect serum, fat, muscle, and liver fatty acid composition [
5,
25,
26]. Consistent with the previous studies [
27,
28,
29] that a large alternation in C18: 3 (n-3 PUFA) caused the main changes in the total amount of n-3 PUFA in the current study. In addition, C16: 0 and C18: 1 were two of the most abundant, and UFA was more than SFA in LDM and SAT. These results are in agreement with the results reported by
A. de Tonnac [
5]. Both in LDM and SAT, the levels of SFA, UFA, and MUFA were not affected. Consistent with our results, a previous study also showed that SFA, UFA, and MUFA in LDM and SAT were not affected by dietary n-3 PUFA contents [
5]. However,
Monique J. Van Oeckel had reported the inconsistent result that SFA, UFA, and MUFA had significant differences after feeding with a high n-3 PUFA content diet [
30]. Moreover, the n-6/n-3 PUFA ratio in LDM and SAT were positively correlated with the ratio in diets. Consistent with previous studies [
6,
31], the n-6/n-3 PUFA ratio in LDM was higher than that in SAT, suggesting that the fatty acid metabolism in LDM and SAT are different. In addition, fatty acid absorption and deposition are different in different breeds and tissues. Not only n-6 PUFA and n-3 PUFA contents, but also the contents of the other fatty acids including C15:0, C16:0, C16:1, C18:0, C20:1 (n-9 PUFA), C22:0, and C22:1 (n-9 PUFA) were affected by dietary n-6/n-3 PUFA ratio, suggesting that the metabolism of fatty acids may be affected by dietary n-6/n-3 PUFA ratio.
Fatty acids are released from intracellular fat stores by the action (or signaling) of ATGL [
32]. Our results indicate that a lower dietary n-6/n-3 PUFA ratio may reduce fatty acids release by reducing ATGL expression in SAT. HSL, an intracellular enzyme, regulates the release of NEFA from lipid stores [
33]. We found that low n-6/n-3 PUFA ratio diet upregulated HSL expression in LDM. Previous studies had also reported that lower dietary n-6/n-3 PUFA ratio increased HSL expression level in SAT [
6]. Low n-6/n-3 PUFA ratio diet also enhances FABP4 expression in SAT, which against the previous study that different n-6/n-3 PUFA diets, did not affect the expression of FABP4 [
34]. The expression of CPT1 was increased in the Heigai pigs fed the dietary n-6/n-3 PUFA ratio of 3:1 in SAT and LDM. This result was consistent with the previous studies that n-3 PUFA enhanced the expression of CPT1 [
24]. ATGL, HSL, CPT1, and FABP4 expression are related to lipid metabolism especially lipolysis. Hence, a lower dietary n-6/n-3 PUFA ratio may enhance lipolysis and affect fatty acid metabolism through increasing the expression level of HSL, FABP4, and CPT1. The enhanced fat catabolism through increasing expression level of HSL, FABP4, and CPT1 may be the reason why lower dietary n-6/n-3 PUFA ratio groups showed lower F: G ratio, carcass weight, and TG content. However, the mechanism is not yet clear and needs further investigation.