Identification and Expression Pattern of cyp26b1 Gene in Gonad of the Chinese Tongue Sole (Cynoglossus semilaevis)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval
2.2. Fish and Sample Collection
2.3. Gene Cloning and Phylogenetic Analysis
2.4. Quantitative Real-Time PCR (qPCR)
2.5. In Situ RNA Hybridization (ISH)
3. Results
3.1. Cloning and Sequencing of the cyp26b1 Gene
3.2. Phylogenetic Analysis
3.3. The Spatiotemporal Expression of cyp26b1
3.4. Cellular Localization of cyp26b1
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Burgoyne, M.S. Role of mammalian Y chromosome in sex determination. Philos. Trans. R. Soc. Lond. B Biol. 1988, 322, 63–72. [Google Scholar]
- Koopman, P.; Gubbay, J.; Vivian, N.; Goodfellow, P.; Lovell-Badge, R. Male development of chromosomally female mice transgenic for Sry. Nature 1991, 351, 117–121. [Google Scholar] [CrossRef] [PubMed]
- Craig, A.S.; Kelly, N.R.; Thomas, O.; David, M.C.; Peter, G.F.; Timothy, J.D.; Andrew, H.S. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature 2009, 461, 267–271. [Google Scholar]
- Bowles, J.; Feng, C.W.; Spiller, C.; Davidson, T.L.; Jackson, A.; Koopman, P. FGF9 suppresses meiosis and promotes male germ cell fate in mice. Dev. Cell 2010, 19, 440–449. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bowles, J.; Feng, C.W.; Ineson, J.; Miles, K.; Spiller, C.M.; Harley, V.R.; Sinclair, A.H.; Koopman, P. Retinoic acid antagonizes testis development in mice. Cell Rep. 2018, 24, 1330–1341. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamaguchi, T.; Kitano, T. High temperature induces cyp26b1 mRNA expression and delays meiotic initiation of germ cells by increasing cortisol levels during gonadal sex differentiation in Japanese flounder. Biochem. Biophys. Res. Commun. 2012, 419, 287–292. [Google Scholar] [CrossRef] [PubMed]
- Saba, R.; Wu, Q.; Saga, Y. CYP26B1 promotes male germ cell differentiation by suppressing STRA8-dependent meiotic and STRA8-independent mitotic pathways. Dev. Biol. 2014, 389, 173–181. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- King, A.C.; Gut, M.; Zenker, A.K. Shedding new light on early sex determination in zebrafsh. Arch. Toxicol. 2020, 94, 4143–4158. [Google Scholar] [CrossRef]
- Parekh, P.A.; Garcia, T.X.; Waheeb, R.; Jain, V.; Gandhi, P.; Meistrich, M.; Shetty, G.; Hofmann, M.C. Undifferentiated spermatogonia regulate Cyp26b1 expression through NOTCH signaling and drive germ cell differentiation. FASEB J. 2019, 33, 8423–8435. [Google Scholar] [CrossRef]
- McClelland, K.; Bowles, J.; Koopman, P. Male sex determination: Insights into molecular mechanisms. Asian J. Adrol. 2012, 14, 164–171. [Google Scholar] [CrossRef] [Green Version]
- Bowles, J.; Knight, D.; Smith, C.; Wilhelm, D.; Richman, J.; Mamiya, S.; Yashiro, K.; Chawengsaksophak, K.; Wilson, M.J.; Rossant, J. Retinoid signaling determines germ cell fate in mice. Science 2006, 312, 596–600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koubova, J.; Menke, D.B.; Zhou, Q.; Capel, B.; Griswold, M.D.; Page, D.C. Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proc. Natl. Acad. Sci. USA 2006, 103, 2474–2479. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Marí, A.; Cañestro, C.; BreMiller, R.A.; Catchen, J.M.; Yan, Y.L.; Postlethwait, J.H. Retinoic acid metabolic genes, meiosis, and gonadal sex differentiation in zebrafish. PLoS ONE 2013, 8, e73951. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kashimada, K.; Svingen, T.; Feng, C.W.; Pelosi, E.; Bagheri-Fam, S.; Harley, V.R.; Schlessinger, D.; Bowles, J.; Koopman, P. Antagonistic regulation of Cyp26b1 by transcription factors SOX9/SF1 and FOXL2 during gonadal development in mice. FASEB J. 2011, 25, 3561–3569. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.L.; Tian, Y.S.; Yang, J.F.; Shao, C.W.; Ji, X.S.; Zhai, J.M.; Liao, X.L.; Zhuang, Z.M.; Su, P.Z.; Xu, J.Y.; et al. Artificial gynogenesis and sex determination in half-smooth tongue sole (Cynoglossus semilaevis). Mar. Biotechnol. 2009, 11, 243–251. [Google Scholar] [CrossRef]
- Chen, S.; Zhang, G.; Shao, C.; Huang, Q.; Liu, G.; Zhang, P.; Song, W.; An, N.; Chalopin, D.; Volff, J.N.; et al. Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle. Nat. Genet. 2014, 46, 253–260. [Google Scholar] [CrossRef] [Green Version]
- Cui, Z.; Liu, Y.; Wang, W.; Wang, Q.; Zhang, N.; Lin, F.; Wang, N.; Shao, C.; Dong, Z.; Li, Y.; et al. Genome editing reveals dmrt1 as an essential male sex-determining gene in Chinese tongue sole (Cynoglossus semilaevis). Sci. Rep. 2017, 7, 42213. [Google Scholar] [CrossRef] [Green Version]
- Shao, C.; Li, Q.; Chen, S.; Zhang, P.; Lian, J.; Hu, Q.; Sun, B.; Jin, L.; Liu, S.; Wang, Z.; et al. Epigenetic modification and inheritance in sexual reversal of fish. Genome Res. 2014, 24, 604–615. [Google Scholar] [CrossRef] [Green Version]
- Deng, S.P.; Chen, S.L.; Xu, J.Y.; Liu, B.W. Molecular cloning, characterization and expression analysis of gonadal P450 aromatase in the half-smooth tonguesole, Cynoglossus semilaevis. Aquaculture 2009, 287, 211–218. [Google Scholar] [CrossRef]
- Dong, X.L.; Chen, S.L.; JI, X.S.; Shao, C.W. Molecular cloning, characterization and expression analysis of Sox9a and Foxl2 genes in half-smooth tongue sole (Cynoglossus semilaevis). Acta Oceanol. Sin. 2011, 30, 68–77. [Google Scholar] [CrossRef]
- Li, H.; Xu, W.; Zhang, N.; Shao, C.; Zhu, Y.; Dong, Z.; Wang, N.; Jia, X.; Xu, H.; Chen, S. Two Figla homologues have disparate functions during sex differentiation in half-smooth tongue sole (Cynoglossus semilaevis). Sci. Rep. 2016, 6, 28219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, Y.; Meng, L.; Xu, W.; Cui, Z.; Zhang, N.; Guo, H.; Wang, N.; Shao, C.; Chen, S. The autosomal Gsdf gene plays a role in male gonad development in Chinese tongue sole (Cynoglossus semilaevis). Sci. Rep. 2018, 8, 17716. [Google Scholar] [CrossRef]
- Chen, S.L.; Ji, X.S.; Shao, C.W.; Li, W.L.; Yang, J.F.; Liang, Z.; Liao, X.L.; Xu, G.B.; Xu, Y.; Song, W.T. Induction of mitogynogenetic diploids and identification of WW super-female using sex-specific SSR markers in half-smooth tongue sole (Cynoglossus semilaevis). Mar. Biotechnol. 2012, 14, 120–128. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Yang, L.; Wang, J.; Shi, W.; Pawar, R.A.; Liu, Y.; Xu, C.; Cong, W.; Hu, Q.; Lu, T.; et al. β-Actin is a useful internal control for tissue-specific gene expression studies using quantitative real-time PCR in the half-smooth tongue sole Cynoglossus semilaevis challenged with LPS or Vibrio anguillarum. Fish Shellfish Immunol. 2010, 29, 89–93. [Google Scholar] [CrossRef]
- Bowles, J.; Secker, G.; Nguyen, C.; Kazenwadel, J.; Truong, V.; Frampton, E.; Curtis, C.; Skoczylas, R.; Davidson, T.L.; Miura, N.; et al. Control of retinoid levels by CYP26B1 is important for lymphatic vascular development in the mouse embryo. Dev. Biol. 2014, 386, 25–33. [Google Scholar] [CrossRef] [PubMed]
- Piprek, R.P.; Pecio, A.; Laskowska-Kaszub, K.; Kloc, M.; Kubiak, J.Z.; Szymura, J.M. Retinoic acid homeostasis regulates meiotic entry in developing anuran gonads and in Bidder’s organ through Raldh2 and Cyp26b1 proteins. Mech. Dev. 2013, 130, 613–627. [Google Scholar] [CrossRef]
- MacLean, G.; Li, H.; Metzger, D.; Chambon, P.; Petkovich, M. Apoptotic extinction of germ cells in testes of Cyp26b1 knockout mice. Endocrinology 2007, 148, 4560–4567. [Google Scholar] [CrossRef] [Green Version]
- Minkina, A.; Lindeman, R.E.; Gearhart, M.D.; Chassot, A.A.; Chaboissier, M.C.; Ghyselinck, N.B.; Bardwell, V.J.; Zarkower, D. Retinoic acid signaling is dispensable for somatic development and function in the mammalian ovary. Dev. Biol. 2017, 424, 208–220. [Google Scholar] [CrossRef]
- Snyder, E.M.; Small, C.; Griswold, M.D. Retinoic acid availability drives the asynchronous initiation of spermatogonial differentiation in the mouse. Biol. Reprod. 2010, 83, 783–790. [Google Scholar] [CrossRef] [Green Version]
- Kurashima, Y.; Amiya, T.; Fujisawa, K.; Shibata, N.; Suzuki, Y.; Kogure, Y.; Hashimoto, E.; Otsuka, A.; Kabashima, K.; Sato, S.; et al. The enzyme Cyp26b1 mediates inhibition of mast cell activation by fibroblasts to maintain skin-barrier homeostasis. Immunity 2014, 40, 530–541. [Google Scholar] [CrossRef] [Green Version]
- Zolfaghari, R.; Cifelli, C.J.; Lieu, S.O.; Chen, Q.; Li, N.; Ross, A.C. Lipopolysaccharide opposes the induction of CYP26A1 and CYP26B1 gene expression by retinoic acid in the rat liver in vivo. Am. J. Physiol. Gastrointest. Liver Physiol. 2006, 292, 1029–1036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pennimpede, T.; Cameron, D.A.; Maclean, G.A.; Petkovich, M. Analysis of Cyp26b1/Rarg compound-null mice reveals two genetically separable effects of retinoic acid on limb outgrowth. Dev. Biol. 2010, 339, 179–186. [Google Scholar] [CrossRef] [PubMed]
- Abu-Abed, S.; MacLean, G.; Fraulob, V.; Chambon, P.; Petkovich, M.; Dolle, P. Differential expression of the retinoic acid-metabolizing enzymes CYP26A1 and CYP26B1 during murine organogenesis. Mech. Dev. 2002, 110, 173–177. [Google Scholar] [CrossRef]
Age | Average Weight (g) | Anesthesia Dose (mg/L) | ||
---|---|---|---|---|
Male | Female | Male | Female | |
80 dph | 1.24 | 1.26 | 10 | 10 |
4 mph | 2.57 | 2.79 | 10 | 10 |
6 mph | 17.38 | 23.80 | 60 | 60 |
1 yph | 89.30 | 390.60 | 60 | 180 |
1.5 yph | 195.00 | 1050.00 | 60 | 180 |
2 yph | 300.40 | 1860.00 | 180 | 180 |
Primer Name | Sequence (5′-3′) | Application | Product Size |
---|---|---|---|
Cyp26b1-F | ATGATGTTCGACACCTTTGACCTGG | Cloning the ORF | 1536 bp |
Cyp26b1-R | TCAGACGGTTGCTCCCAGAAGCTC | ||
q-Cyp26b1-F | AGTACCTGTGGTCCATCCTGTTGA | Real-time PCR | 87 bp |
q-Cyp26b1- R | TCTGACTTAGCCATGATCTCGTTCTG | ||
β-actin-F | GCTGTGCTGTCCCTGTA | 150 bp | |
β-actin-R | GAGTAGCCACGCTCTGTC | ||
Cy-ISH-F | GGCTGCTGCAGGGTTCAA | in situ hybridization | 443 bp |
Cy-ISH-R | GGAGAACAGATGTTTCATCTCGTCT | ||
CS-sex-F | GAGGCCGACAGGATCGTAC | Sex genotype | 206 bp/218 bp |
CS-sex-R | TACGACGTACTCCGGTGGTTTT |
No | Species Name | GenBank Accession Number for Cyp26b1 Protein | GenBank Accession Number for cyp26b1 Gene | Source |
---|---|---|---|---|
1 | Cynoglossus semilaevis | XP_008322472.1 | XM_008324250.3 | Obtained in this study |
2 | Paralichthys olivaceus | XP_019951364.1 | XM_020095805.1 | GenBank |
3 | Scophthalmus maximus | XP_035462952.1 | XM_035607059.2 | |
4 | Takifugu rubripes | XP_003966921.1 | XM_003966872.3 | |
5 | Larimichthys crocea | XP_010742602.1 | XM_010744300.3 | |
6 | Epinephelus lanceolatus | XP_033465922.1 | XM_033610031.1 | |
7 | Salmo salar | XP_045557602.1 | XM_045701646.1 | |
8 | Oncorhynchus mykiss | XP_036843080.1 | XM_036987185.1 | |
9 | Channa argus | KAF3697672.1 | CM015724.1 | |
10 | Cyprinus carpio | XP_042583369.1 | XM_042727435.1 | |
11 | Danio rerio | NP_997831.1 | NM_212666.1 | |
12 | Xenopus tropicalis | NP_001072655.1 | NM_001079187.2 | |
13 | Gallus gallus | XP_015141554.1 | XM_015286068.4 | |
14 | Mus musculus | AAN08613.1 | AY134662.1 | |
15 | Homo sapiens | NP_063938.1 | NM_019885.4 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, Z.; Wang, J.; Yang, Y.; Chen, Z.; Wang, Q.; Wang, J.; Zhang, T.; Xu, W.; Chen, S. Identification and Expression Pattern of cyp26b1 Gene in Gonad of the Chinese Tongue Sole (Cynoglossus semilaevis). Animals 2022, 12, 2652. https://doi.org/10.3390/ani12192652
Cui Z, Wang J, Yang Y, Chen Z, Wang Q, Wang J, Zhang T, Xu W, Chen S. Identification and Expression Pattern of cyp26b1 Gene in Gonad of the Chinese Tongue Sole (Cynoglossus semilaevis). Animals. 2022; 12(19):2652. https://doi.org/10.3390/ani12192652
Chicago/Turabian StyleCui, Zhongkai, Jie Wang, Yingming Yang, Zhangfan Chen, Qian Wang, Jialin Wang, Tingting Zhang, Wenteng Xu, and Songlin Chen. 2022. "Identification and Expression Pattern of cyp26b1 Gene in Gonad of the Chinese Tongue Sole (Cynoglossus semilaevis)" Animals 12, no. 19: 2652. https://doi.org/10.3390/ani12192652