Next Article in Journal
Compensability of Enhanced Cytoplasmic Droplet Rates in Boar Semen: Insights of a Retrospective Field Study
Previous Article in Journal
Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli in Wild Birds from a Wildlife Rescue Centre
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy

1
Department of Veterinary Science, University of Pisa, Viale delle Piagge 2, 56124 Pisa, Italy
2
Centre for Climate Change Impact, University of Pisa, Viale delle Borghetto 80, 56124 Pisa, Italy
3
Struttura Semplice Section of Genoa-Portualità, Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta, 16129 Genoa, Italy
*
Author to whom correspondence should be addressed.
Animals 2022, 12(20), 2891; https://doi.org/10.3390/ani12202891
Submission received: 6 October 2022 / Revised: 19 October 2022 / Accepted: 20 October 2022 / Published: 21 October 2022
(This article belongs to the Section Wildlife)

Abstract

:

Simple Summary

Red foxes (Vulpes vulpes) are largely present in Italian wooded areas and often reach urban environments. These animals are susceptible to several bacterial and protozoan pathogens that are able to affect dogs and humans. Foxes may harbor arthropod-borne microorganisms, enteropathogens and leptospirae, and thus represent a potential source of infections for other animals. Previous surveys in fox populations have usually focused on few of these pathogens, whereas in the present investigation, the occurrence of several bacterial and protozoan pathogens have been investigated: Salmonella spp., Yersinia spp., Listeria monocytogenes, Brucella spp., Ehrlichia canis, Anaplasma phagocytophilum, Coxiella burnetii, Leptospira spp., Neospora caninum, Hepatozoon canis, Babesia spp. and microsporidia. Even though the survey was based on a small number of animals, the results suggested that red foxes in Central Italy are involved in the epidemiology of some infections.

Abstract

Most surveys of pathogens in red foxes (Vulpes vulpes) have focused on particular agents. The aim of this study was to verify, with bacteriological and molecular analyses, the occurrence of the main bacterial and protozoan pathogens that are able to infect canids, in red foxes regularly hunted in Central Italy. Spleen, brain, kidney and fecal samples from red foxes were submitted to bacteriological and/or molecular analyses to detect Salmonella spp., Yersinia spp., Listeria monocytogenes, Brucella spp., Ehrlichia canis, Anaplasma phagocytophilum, Coxiella burnetii, Leptospira spp., Neospora caninum, Hepatozoon canis, Babesia spp. and microsporidia. Two (9.1%) strains of Yersinia enterocolitica biotype 1 and 2 (9.1%) of Yersinia frederiksenii were isolated from 22 fecal samples. Among the 22 spleen samples, seven (31.8%) were PCR-positive for H. canis and 3 (13.6%) for Babesia vulpes. Kidneys from two (2.9%) foxes, among 71 tested, were PCR-positive for L. interrogans. Even though the analyses were carried out on a small number of animals, the results suggested that red foxes from the selected geographic area may act as reservoirs of some investigated pathogens.

1. Introduction

Red foxes (Vulpes vulpes) are the most widespread wild carnivore in Italy. They are largely present in forest and lightly wooded areas that are typically found in agricultural landscapes. Foxes often reach urban and peri-urban environments in search of food, and therefore they can act as possible reservoirs for many pathogens that are able to infect domestic animals, mainly dogs, and humans [1]. In fact, foxes and dogs often are affected by the same pathogens, which can also be zoonotic. Bacterial enteropathogens, such as Salmonella spp. and Yersinia enterocolitica, can cause diseases in both dogs and humans, and reproductive disorders can be due to Brucella spp. and Listeria monocytogenes [2,3]. Furthermore, pathogenic Leptospira may affect dogs and people, causing severe, often lethal, disease [4].
Arthropod-borne bacteria and protozoa usually affecting dogs, such as Ehrlichia canis, Anaplasma phagocytophilum, Hepatozoon canis, Babesia sp. and Encephalitozoon cuniculi have been found in foxes in different European areas [1,5,6,7,8]. Conversely, dogs can act as spreaders of Neospora caninum oocysts into the wild, contributing to maintaining the life cycle of this parasite, which severely affects ruminant health [9].
Hunting dogs have a higher risk than pets of acquiring arthropod-borne pathogens due to increased frequency of tick exposure. Furthermore, they can come in contact with urine and/or feces of infected foxes that harbor pathogens in kidneys and/or the intestine tract.
Surveys about the spreading of bacteria and protozoa affecting canids in red foxes living in Italian areas are usually limited to some pathogens [1,10,11,12,13,14,15,16,17]. In view of the scanty data about the health status of the fox population in Italy, the aim of the present study was to verify, with bacteriological and molecular analyses, the occurrence of the main bacterial and protozoan pathogens, which can infect canids in red foxes regularly hunted in Central Italy.

2. Materials and Methods

2.1. Sampling

Twenty-two adult red foxes shot during the regular hunting seasons of 2016, 2019, and 2021 in the Province of Pisa (43° N, 10–11° E) were examined.
Foxes were brought by hunters to the Department of Veterinary Sciences, University of Pisa, within 48 h of being shot. They were then submitted to post-mortem examinations and samples from spleen, kidneys, brain, and intestine were collected. All samples were kept at 4 °C for max 24 h until bacteriological and molecular analyses were executed.
Feces present in the intestine were submitted to bacteriological analyses, whereas all tissue samples were used for the DNA extraction.
DNA from kidneys and brains previously (hunting season 2012–2015) collected from 49 adult red foxes for other purpose, and stored at –20 °C, were included in the present investigation.

2.2. Bacteriological Analyses

  • Salmonella spp.
Each fecal sample was submitted to procedures previously described [18]. Briefly, about 1 g of feces was incubated in 9 mL of buffered peptone water at 37 °C for 24 h. One mL of this culture was transferred into 10 mL of Selenite Cystine Broth (Oxoid Ltd., Basingstoke, UK) and 0.1 mL into 10 mL of Rappaport Vassiliadis Broth. The tubes were incubated at 37 °C for 24 h and at 42 °C for 24 h, respectively. One loopful from each broth culture was streaked onto Salmonella-Shigella Agar (Oxoid) and Brilliant Green Agar (Oxoid) plates. After incubation of the plates at 37 °C for 24 h, suspected colonies were submitted for biochemical characterization.
  • Yersinia spp.
After enrichment for each fecal sample in Peptone Sorbitol Bile Broth (Oxoid) for 21 days at 4 °C, a loop of the broth culture was sub-cultured onto Cefsulodin Irgasan Novobiocin (CIN) Agar (Oxoid) and the plates were incubated at 30 °C for 48 h. Suspected colonies were submitted to biochemical tests to determine the species [19] and confirmation was performed using the API20E biochemical gallery (bioMerieux, Marcy l’Etoile, France). Yersinia enterocolitica isolates were successively characterized on the basis of biochemical tests to distinguish the biotype [20].
  • Listeria monocytogenes
Listeria strains were isolated according to the ISO 11290 method with some modifications. Feces were introduced into 10 mL Half-Fraser broth (Oxoid) and incubated at 30 °C for 24 h. Subsequently, 0.5 ml of the primary enrichment cultures were transferred to 4.5 mL of Fraser broth and incubated at 37 °C for 48 h. A loopful of secondary enrichment was streaked onto Agar Listeria Ottaviani Agosti (ALOA) (Biolife, Milan, Italy) (Oxoid) and incubated at 37 °C for 24–48 h.

2.3. Molecular Analyses

DNA extraction was carried out on about 15 mg of each tissue specimen using Tissue Genomic DNA Extraction Kit (Fisher Molecular Biology, Trevose, PA, USA) and according to the manufacturer’s instructions. DNA samples were stored at 4 °C until used as a template in the PCR assays.
DNAs extracted from 22 spleens were employed in PCR tests to detect E. canis, A. phagocytophilum, C. burnetii, Brucella spp., Babesia sp., and H. canis. DNA samples obtained from 71 brains were used to search N. caninum and microsporidia; DNAs from 71 kidneys were used to detect microsporidia, C. burnetii and Leptospira spp.
PCR assays were performed following the protocols previously reported and using primers and conditions summarized in Table 1.
Sterile distilled water instead of DNA was used as negative control in each PCR assay. As positive controls, DNA extracted from commercial IFAT slides (Fuller Laboratories Fullerton, CA, USA) containing the following pathogens were employed: A. phagocytophilum, E. canis, B. canis, C. burnetii, H. canis, and N. caninum. DNA from the brain of rabbit affected by E. cuniculi, DNA from cultures of L. interrogans (serovar Hardjo) and Brucella ovis were added as positive controls as well.
All PCR assays were performed using the EconoTaqPLUS 2xMaster Mix (Lucigen Corporation, Middleton, Wisconsin, USA) and an automated thermal cycler (SimpliAmp™ Thermal Cycler, Applied Biosystems, Waltham, Massachusetts, U.S.A.). PCR products were analyses by electrophoresis on 1.5% agarose gel at 100 V for 45 min. Amplicons were sequenced by a commercial laboratory (BMR-Genomics, Padova, Italy). Sequences were assembled and corrected by visual analysis of the electropherogram using Bioedit v.7.2, then compared with those available in GenBank using the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST, accessed on 15 September 2022).

3. Results

Bacteriological examinations carried out on the 22 tested fecal samples isolated four (18.2%) Yersinia strains and two (9.1%) Y. enterocolitica biotypes 1 and 2 (9.1%) Y. frederiksenii. No Salmonella or L. monocytogenes were isolated.
PCR assays on DNAs from spleens detected 3 (13.6%) animals positive for Babesia vulpes and 7 (31.8%) for H. canis. All 22 foxes spleens were negative for E. canis, A. phagocytophilum, C. burnetii, and Brucella spp.
DNAs from the 71 brain samples were negative for N. caninum and microsporidia.
PCR assays carried out on DNAs from the 71 kidneys resulted negative for microsporidia and C. burnetii, whereas three samples were positive for Leptospira genus; in detail, one (1.4%) sample was positive for non-pathogenic Leptospira, two (2.9%) for L. interrogans, as confirmed by the sequencing analysis.

4. Discussion

Even though the investigation was performed on a small number of red foxes, the results obtained by bacteriological and molecular analyses suggested that these animals do not act as relevant reservoirs of the investigated pathogens.
Few investigations about the occurrence of bacterial pathogens have been carried out in fox population in Italy, thus our data are not easily comparable.
Negative results for Salmonella disagree with a previous investigation that found a prevalence of 5.7% in red foxes living in Northern Italy [12], but they agree with a recent study that detected a 0% prevalence in V. vulpes in Northern Ireland [33]. However, the low number of samples investigated in our study could not reflect the real epidemiological situation and account for the discrepancy with the results of the other investigations.
Similarly, L. monocytogenes was found in 4.5% of V. vulpes in Poland [2], whereas no previous reports about the detection of this pathogens in Italian fox population are available.
The detection of Y. enterocolitica and Y. frederiksenii shows that these bacteria are circulating among wildlife in Italy, as well as other European countries, as also found by previous surveys in foxes and other wild mammals [2,17].
Foxes are susceptible to Brucella infection. Brucella vulpis and B. microti have been isolated from mandibular lymph nodes of V. vulpes in Austria [3,34]. In Italy, no cases of brucellosis in foxes have been reported, thus our results could really reflect the epidemiological scenarios in the investigated area, also considering that Tuscany is an officially brucellosis free region [35].
No foxes were found to be positive for E. canis, A. phagocytophilum and C. burnetii. These findings partially disagree with previous studies carried out in red foxes living in the same area that detected a different prevalences. In fact, 16.6% of red foxes tested in 2007–2008 were positive for A. phagocytophilum, but none of them were positive for E. canis [10]. Conversely, red foxes examined in 2014–2016 were positive with a prevalence of 44.44% for E. canis, 1.96% for C. burnetii and 0.65% for A. phagocytophilum [1].
Studies carried out in foxes from other European regions found variable prevalences in relation to the investigated pathogen, period, geographic area, density of tick population. In fact, prevalence from 0% to 52% were found for E. canis [5,13,36,37,38], from 0% to 8.2% for A. pahgocytophilum [5,36,39], from 0% to 17% for C. burnetii [13,38,40].
Members of the genus Leptospira are tightly coiled spirochetes that are rapidly killed on drying, heating and exposure to detergents or disinfectants, but they remain viable for several weeks in stagnant alkaline water or wet soil [41]. Leptospira interrogans species includes several serovars distributed worldwide in relation to geographic areas and animal species involved in the epidemiology. Wild mammals have been recognized as reservoirs for many serovars [42]. Serological investigations showed the exposure of red foxes to Leptospira, sometimes with remarkable seroprevalences: 33.8% in Croatia [43], 34% in Slovenia [44], 47% in Spain [45], 26.3% in Poland [46]. Conversely, data about the occurrence of pathogenic leptospirae in urine and/or kidneys from foxes are very scanty. Millan et al. [47] found one PCR-positive among nine investigated foxes in Spain, whereas Ayral et al. [48] found 6.1% of foxes PCR-positive for pathogenic Leptospira in France.
In Italy, the little information about leptospiral infections in foxes that come from national serological surveillance reported 22.7% prevalence in the period 2010–2011 [4].
Even though molecular analysis did not allow us to identify the serovar of the found leptospirae, our findings show the circulation of pathogenic leptospirae in the investigated area and the role of red foxes as possible carriers of the spirochetes.
Foxes carrying pathogenic leptospirae can act as maintenance hosts and contribute to the spreading of these bacteria to other species that share the environment.
Hunting dogs are at high risk of infection during their activity. Moreover, foxes often reach urban areas, thus they may be source of leptospirae for pet dogs, too. Serovars most frequently found in foxes in previous studies are Icterohaemorrhagie, Bratislava, Pomona that are well known to cause severe diseases in dogs.
Babesia vulpes DNA was recovered in 13.63%. Babesia vulpes (formerly Theileria annae) was recently renamed [49] and has been reported in canine babesiosis throughout the Europe [49,50,51]. It is responsible for asymptomatic infections in foxes (its reservoir host) while in dogs causes anemia, thrombocytopenia and renal damage [49,52]. Hepatozoon canis DNA was identified in 31.81% V. vulpes. The parasite is not a zoonotic agent, but can represent an important pathogen mostly for hunting dogs, more frequently exposed to ixodid ticks. Such data confirm the occurrence of these tick-borne parasites in the fox population examined, as previously reported [1].
Conversely, N. caninum DNA was not found in selected tissues. It is an apicomplexan protozoon responsible for reproductive disorders in ruminants and neuromuscular disease in dogs. The parasite has a cosmopolitan distribution and dog, wolf and coyote act as final hosts, shedding oocysts which sporulate in the environment. Oocysts are infective for several intermediate hosts such as cattle, where N. caninum can transmit transplacentally as well [53]. Carnivores can become infected by ingesting tissues of intermediate hosts. Foxes are considered as natural intermediate hosts for the protozoon, while fail to excrete oocysts [54] and rarely develop clinical signs [55]. Seroprevalences in Europe range from 0% [56,57] to 26.4% [58]. In surveys similar to the present study parasite DNA was not recovered from red foxes in Saxony [59] nor in Czech Republic [60], while was identified in 4.6% animals in a previous study in Czech Republic [61], in 4.8% from United Kingdom [62], in 9% to 18% from Slovakia [58], and 10% from Spain [54]. Our results are also supported by the lack of seropositivity in 253 foxes living in the same area (unpublished data), examined by IFAT in the last 10 years.
Encephalitozoon cuniculi was not reported from the examined brains. This is a microsporidian parasite associated with its natural host (Oryctolagus cuniculus) and has a broad range of hosts, with zoonotic potential, inducing neurologic, ocular and renal clinical signs. The parasite is responsible for clinical forms in blue and silver foxes [63]. Red foxes are reported to be infected in Ireland with about 0.7% prevalence [64], in Czech Republic with 3.8% [61], while in a further study in the same area microsporidian DNA was not detected [60].

5. Conclusions

Even though our study investigated a small number of red foxes, the obtained results showed that these animals can harbor bacteria and protozoans transmissible to dogs and humans. Foxes infected by Yersinia spp. seem to be involved in the epidemiology of these pathogens contributing to environmental contamination with their feces. Further studies are necessary to better understand the role of red foxes in the epidemiology of leptospirosis, because our survey detected L. interrogans DNA in kidneys, but it was not possible to verify if the animals had live leptospirae in their urine.
Furthermore, the survey suggested the role of red foxes as reservoirs of canine pathogens such as B. vulpes and H. canis.

Author Contributions

Conceptualization, V.V.E. and F.M.; methodology, C.T., L.G., F.B., G.C., S.N., E.W., E.S., A.P.; resources, V.V.E., A.P., F.M.; writing—original draft preparation, V.V.E., F.M.; writing—review and editing, V.V.E., F.M..; funding acquisition, V.V.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by University of Pisa, grant number PRA_2020_88.

Institutional Review Board Statement

Ethical review and approval were waived for this study because the analyses were carried out on samples from foxes regularly hunted during Italian hunting seasons.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are reported in the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ebani, V.V.; Rocchigiani, G.; Nardoni, S.; Bertelloni, F.; Vasta, V.; Papini, R.A.; Verin, R.; Poli, A.; Mancianti, F. Molecular detection of tick-borne pathogens in wild red foxes (Vulpes vulpes) from Central Italy. Acta Trop. 2017, 172, 197–200. [Google Scholar] [CrossRef] [PubMed]
  2. Nowakiewicz, A.; Zięba, P.; Ziółkowska, G.; Gnat, S.; Muszyńska, M.; Tomczuk, K.; Dziedzic, B.M.; Ulbrych, Ł.; Trościańczyk, A. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus. PLoS ONE 2016, 11, e0155533. [Google Scholar] [CrossRef] [PubMed]
  3. Scholz, H.C.; Revilla-Fernández, S.; Al Dahouk, S.; Hammerl, J.A.; Zygmunt, M.; Cloeckaert, A.; Koylass, M.; Whatmore, A.; Blom, J.; Vergnaud, G.; et al. Brucella vulpis sp. nov., isolated from mandibular lymph nodes of red foxes (Vulpes vulpes). Int. J. Syst. Evol. Microbiol. 2016, 66, 2090–2098. [Google Scholar] [CrossRef] [PubMed]
  4. Tagliabue, S.; Figarolli, B.M.; D’Incau, M.; Foschi, G.; Gennero, M.S.; Giordani, R.; Giordani, R.; Natale, A.; Papa, P.; Ponti, N.; et al. Serological surveillance of Leptospirosis in Italy: Two-year national data (2010–2011). Vet. Ital. 2016, 52, 129–138. [Google Scholar] [CrossRef] [PubMed]
  5. Hodžić, A.; Alić, A.; Fuehrer, H.-P.; Harl, J.; Wille-Piazzai, W.; Duscher, G.G. A molecular survey of vector-borne pathogens in red foxes (Vulpes vulpes) from Bosnia and Herzegovina. Parasites Vectors 2015, 8, 88. [Google Scholar] [CrossRef] [Green Version]
  6. Hodžić, A.; Mrowietz, N.; Cézanne, R.; Bruckschwaiger, P.; Punz, S.; Habler, V.E.; Tomsik, V.; Lazar, J.; Duscher, G.G.; Glawischnig, W.; et al. Occurrence and diversity of arthropod-transmitted pathogens in red foxes (Vulpes vulpes) in western Austria, and possible vertical (transplacental) transmission of Hepatozoon canis. Parasitology 2017, 145, 335–344. [Google Scholar] [CrossRef]
  7. Mierzejewska, E.J.; Dwużnik, D.; Koczwarska, J.; Stańczak, Ł.; Opalińska, P.; Krokowska-Paluszak, M.; Wierzbicka, A.; Górecki, G.; Bajer, A. The red fox (Vulpes vulpes), a possible reservoir of Babesia vulpes, B. canis and Hepatozoon canis and its association with the tick Dermacentor reticulatus occurrence. Ticks Tick-Borne Dis. 2021, 12, 101551. [Google Scholar] [CrossRef]
  8. Meredith, A.L.; Cleaveland, S.C.; Brown, J.; Mahajan, A.; Shaw, D.J. Seroprevalence of Encephalitozoon cuniculi in wild rodents, foxes and domestic cats in three sites in the United Kingdom. Transbound Emerg Dis. 2015, 62, 148–156. [Google Scholar] [CrossRef]
  9. Lempp, C.; Jungwirth, N.; Grilo, M.L.; Reckendorf, A.; Ulrich, A.; van Neer, A.; Bodewes, R.; Pfankuche, V.M.; Bauer, C.; Osterhaus, A.D.; et al. Pathological findings in the red fox (Vulpes vulpes), stone marten (Martes foina) and raccoon dog (Nyctereutes procyonoides), with special emphasis on infectious and zoonotic agents in Northern Germany. PLoS ONE 2017, 12, e0175469. [Google Scholar] [CrossRef] [Green Version]
  10. Ebani, V.V.; Verin, R.; Fratini, F.; Poli, A.; Cerri, D. Molecular survey of Anaplasma phagocytophilum and Ehrlichia canis in red foxes (Vulpes vulpes) frrom Central Italy. J. Wildl. Dis. 2011, 47, 699–703. [Google Scholar] [CrossRef]
  11. Verin, R.; Mugnaini, L.; Nardoni, S.; Papini, R.A.; Ariti, G.; Poli, A.; Mancianti, F. Serologic, molecular, and pathologic survey of Toxoplasma gondii infection in free-ranging red foxes (Vulpes vulpes) in central Italy. J. Wildl. Dis. 2013, 49, 545–551. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Chiari, M.; Ferrari, N.; Giardiello, D.; Lanfranchi, P.; Zanoni, M.; Lavazza, A.; Alborali, L.G. Isolation and identification of Salmonella spp. from red foxes (Vulpes vulpes) and badgers (Meles meles) in northern Italy. Acta Vet. Scand. 2014, 56, 86. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Santoro, M.; Veneziano, V.; D′Alessio, N.; Di Prisco, F.; Lucibelli, M.G.; Borriello, G.; Cerrone, A.; Dantas-Torres, F.; Latrofa, M.S.; Otranto, D.; et al. Molecular survey of Ehrlichia canis and Coxiella burnetii infections in wild mammals of southern Italy. Parasitol. Res. 2016, 115, 4427–4431. [Google Scholar] [CrossRef] [PubMed]
  14. Santoro, M.; Auriemma, C.; Lucibelli, M.G.; Borriello, G.; D’Alessio, N.; Sgroi, G.; Veneziano, V.; Galiero, G.; Fusco, G. Molecular Detection of Babesia spp. (Apicomplexa: Piroplasma) in Free-Ranging Canids and Mustelids From Southern Italy. Front. Vet Sci. 2019, 6, 269. [Google Scholar] [CrossRef] [Green Version]
  15. Battisti, E.; Zanet, S.; Khalili, S.; Trisciuoglio, A.; Hertel, B.; Ferroglio, E. Molecular Survey on Vector-Borne Pathogens in Alpine Wild Carnivorans. Front. Vet. Sci. 2020, 7, 1. [Google Scholar] [CrossRef] [Green Version]
  16. Sgroi, G.; Iatta, R.; Veneziano, V.; Bezerra-Santos, M.A.; Lesiczka, P.; Hrazdilová, K.; Annoscia, G.; D′Alessio, N.; Golovchenko, M.; Rudenko, N.; et al. Molecular survey on tick-borne pathogens and Leishmania infantum in red foxes (Vulpes vulpes) from southern Italy. Ticks Tick Borne Dis. 2021, 12, 101669. [Google Scholar] [CrossRef]
  17. Carella, E.; Romano, A.; Domenis, L.; Robetto, S.; Spedicato, R.; Guidetti, C.; Pitti, M.; Orusa, R. Characterisation of Yersinia enterocolitica strains isolated from wildlife in the northwestern Italian Alps. J. Vet. Res. 2022, 66, 141–149. [Google Scholar] [CrossRef]
  18. Bertelloni, F.; Chemaly, M.; Cerri, D.; LeGall, F.; Ebani, V.V. Salmonella infection in healthy pet reptiles: Bacteriological isolation and study of some pathogenic characters. Acta Microbiol. Immunol. Hung. 2016, 63, 203–216. [Google Scholar] [CrossRef] [Green Version]
  19. Murphy, B.P.; Drummond, N.; Ringwood, T.; O’Sullivan, E.; Buckley, J.F.; Whyte, P.; Prentice, M.B.; Fanning, S. First report: Yersinia enterocolitica recovered from canine tonsils. Vet. Microbiol. 2010, 146, 336–339. [Google Scholar] [CrossRef]
  20. Bottone, E.J. Yersinia enterocolitica: The charisma continues. Clin. Microbiol. Rev. 1997, 10, 257–276. [Google Scholar] [CrossRef]
  21. Massung, R.F.; Slater, K.; Owens, J.H.; Nicholson, W.L.; Mather, T.N.; Solberg, V.B.; Olson, J.G. Nested PCR assay for detection of granulocytic Ehrlichiae. J. Clin. Microbiol. 1988, 36, 1090–1095. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Beck, R.; Vojta, L.; Mrljak, V.; Marinculic, A.; Beck, A.; Zivicnjak, T.; Cacciò, S.M. Diversity of Babesia and Theileria species in symptomatic and asymptomatic dogs in Croatia. Int. J. Parasitol. 2009, 39, 843–848. [Google Scholar] [CrossRef] [PubMed]
  23. Romero, C.; Gamazo, C.; Pardo, M.; Lopez-Goni, I. Specific detection of Brucella DNA by PCR. J. Clin. Microbiol. 1995, 33, 615–617. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Berri, M.; Rekiki, A.; Boumedini, A.; Rodolakis, A. Simultaneous differential detection of Chlamydia abortus, Chlamydia pecorum and Coxiella burnetii from aborted ruminant’s cclinical samples using multiplex PCR. BMC Microbiol. 2009, 9, 130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Dawson, J.E.; Stallknecht, D.E.; Howerth, E.W.; Warner, C.; Biggie, K.; Davidson, W.R.; Lockhart, J.M.; Nettles, V.F.; Olsen, J.G.; Childs, J.E. Suscceptibility of white-tailed deer (Odocoileus virginianus) to infection with Ehrlichia chaffeensis, the etiologic agent of human ehrlichiosis. J. Clin. Microbiol. 1994, 32, 2725–2728. [Google Scholar] [CrossRef] [Green Version]
  26. Wen, B.; Rikihisa, Y.; Mott, J.M.; Greene, R.; Kim, H.Y.; Zhi, N.; Couto, G.C.; Unver, A.; Bartsch, R. Comparison of nested PCR with immunofluorescent-antibody assay for detection of Ehrlichia canis infection in dogs treated with doxycycline. J. Clin. Microbiol. 1997, 35, 1852–1855. [Google Scholar] [CrossRef] [Green Version]
  27. Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef]
  28. Bedir, O.; Kilic, A.; Atabek, E.; Kuskucu, A.M.; Turhan, V.; Basustaoglu, A.C. Simultaneous detection and differentiation of pathogenic and non-pathogenic Leptospira spp. By multiplex real-time PCR (TaqMan) assay. Polish J. Microbiol. 2010, 59, 167–173. [Google Scholar] [CrossRef]
  29. Stoddard, R.A.; Gee, J.E.; Wilkins, P.P.; McCaustland, K.; Hoffmaster, A.R. Detection of pathogenic Leptospira spp. Through TaqMan polymerase chain reactionn targeting the LipL32 gene. Diagn. Microbiol. Infect. Dis. 2009, 64, 247–255. [Google Scholar] [CrossRef]
  30. Ahmed, A.; Thaipadungpanit, J.; Boonsilp, S.; Wuthiekanun, V.; Nalam, K.; Spratt, B.G.; Aanensen, D.M.; Smythe, L.D.; Ahmed, N.; Feil, E.J.; et al. Comparison of Two Multilocus Sequence Based Genotyping Schemes for Leptospira Species. PLOS Negl. Trop. Dis. 2011, 5, e1374. [Google Scholar] [CrossRef]
  31. Müller, N.; Zimmermann, V.; Hentrich, B.; Gottstein, B. Diagnosis of Neospora caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassay. J. Clin. Microbiol. 1996, 34, 2850–2852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Fedorko, D.P.; Nelson, N.A.; Cartwright, C.P. Identification of microsporidia in stool specimens by using PCR and restriction endonucleases. J. Clin. Microbiol. 1995, 33, 1739–1741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. O’Hagan, M.J.H.; Pascual-Linaza, A.V.; Couzens, C.; Holmes, C.; Bell, C.; Spence, N.; Huey, R.J.; Murphy, J.A.; Devaney, R.; Lahuerta-Marin, A. Estimation of the Prevalence of Antimicrobial Resistance in Badgers (Meles meles) and Foxes (Vulpes vulpes) in Northern Ireland. Front. Microbiol. 2021, 12, 596891. [Google Scholar] [CrossRef] [PubMed]
  34. Scholz, H.C.; Hofer, E.; Vergnaud, G.; Le Fleche, P.; Whatmore, A.M.; Al Dahouk, S.; Pfeffer, M.; Krüger, M.; Cloeckaert, A.; Tomaso, H. Isolation of Brucella microti from Mandibular Lymph Nodes of Red Foxes, Vulpes vulpes, in Lower Austria. Vector-Borne Zoonotic Dis. 2009, 9, 153–156. [Google Scholar] [CrossRef] [PubMed]
  35. EFSA, (European Food Safety Authority); ECDC, (European Centre for Disease Prevention and Control). The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, e06406. [Google Scholar]
  36. Dumitrache, M.O.; Matei, I.A.; Ionică, A.M.; Kalmár, Z.; D’Amico, G.; Sikó-Barabási, S.; Ionescu, D.T.; Gherman, C.M.; Mihalca, A.D. Molecular detection of Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato genospecies in red foxes (Vulpes vulpes) from Romania. Parasites Vectors 2015, 8, 514. [Google Scholar] [CrossRef] [Green Version]
  37. Cardoso, L.; Gilad, M.; Cortes, H.C.; Nachum-Biala, Y.; Lopes, A.P.; Vila-Viçosa, M.J.; Simoes, M.; Rodrigues, P.A.; Baneth, G. First report of Anaplasma platys infection in red foxes (Vulpes vulpes) and molecular detection of Ehrlichia canis and Leishmania infantum in foxes from Portugal. Parasites Vectors 2015, 8, 144. [Google Scholar] [CrossRef] [Green Version]
  38. Millán, J.; Proboste, T.; de Mera, I.G.F.; Chirife, A.D.; de la Fuente, J.; Altet, L. Molecular detection of vector-borne pathogens in wild and domestic carnivores and their ticks at the human–wildlife interface. Ticks Tick-Borne Dis. 2015, 7, 284–290. [Google Scholar] [CrossRef] [PubMed]
  39. Hulinská, D.; Langrová, K.; Pejcoch, M.; Pavlásek, I. Detection of Anaplasma phagocytophilum in animals by real-time polymerase chain reaction. APMIS 2004, 112, 239–247. [Google Scholar] [CrossRef]
  40. Medkour, H.; Laidoudi, Y.; Marié, J.-L.; Fenollar, F.; Davoust, B.; Mediannikov, O. Molecular Investigation of Vector-Borne pathogens in red foxes (Vulpes vulpes) from southern France. J. Wildl. Dis. 2020, 56, 837–850. [Google Scholar] [CrossRef]
  41. Goering, R.V.; Dockrell, H.M.; Zuckerman, M.; Chiodini, P.L. Multisystem zoonoses. Mims’ Med. Microbiol.Immunol. 2019, 29, 386–399. [Google Scholar]
  42. Alić, A.; Šupić, J.; Goletić, T.; Rešidbegović, E.; Lutvikadić, I.; Hodžić, A. A Unique Case of Fatal Coinfection Caused by Leptospira spp. and Hepatozoon canis in a Red Fox Cub (Vulpes vulpes). Pathogens 2021, 11, 11. [Google Scholar] [CrossRef] [PubMed]
  43. Slavica, A.; Deždek, D.; Konjević, D.; Cvetnić, Z.; Sindicic, M.; Stanin, D.; Habus, J.; Turk, N. Prevalence of leptospiral antibodies in the red fox (Vulpes vulpes) population of Croatia. Vet. Med. 2011, 56, 209–213. [Google Scholar] [CrossRef] [Green Version]
  44. Žele-Vengušt, D.; Lindtner-Knific, R.; Mlakar-Hrženjak, N.; Jerina, K.; Vengušt, G. Exposure of Free-Ranging Wild Animals to Zoonotic Leptospira interrogans Sensu Stricto in Slovenia. Animals 2021, 11, 2722. [Google Scholar] [CrossRef] [PubMed]
  45. Millán, J.; Candela, M.G.; López-Bao, J.V.; Pereira, M.; Jiménez, M.A.; León-Vizcaíno, L. Leptospirosis in wild and domestic carnivores in natural areas in Andalusia, Spain. Vector-Borne Zoonotic Dis. 2009, 9, 549–554. [Google Scholar] [CrossRef]
  46. Żmudzki, J.; Arent, Z.; Jabłoński, A.; Nowak, A.; Zębek, S.; Stolarek, A.; Bocian, Ł.; Brzana, A.; Pejsak, Z. Seroprevalence of 12 serovars of pathogenic Leptospira in red foxes (Vulpes vulpes) in Poland. Acta Vet. Scand. 2018, 60, 34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Millán, J.; Velarde, R.; Chirife, A.D.; León-Vizcaíno, L. Carriage of pathogenic Leptospira in carnivores at the wild/domestic interface. Pol. J. Vet. Sci. 2019, 22, 589–598. [Google Scholar] [CrossRef] [PubMed]
  48. Ayral, F.; Djelouadji, Z.; Raton, V.; Zilber, A.L.; Gasqui, P.; Faure, E.; Baurier, F.; Vourc’h, G.; Kodjo, A.; Combes, B. Hedgehogs and Mustelid Species: Major Carriers of Pathogenic Leptospira, a Survey in 28 Animal Species in France (20122015). PLoS ONE 2016, 11, e0162549. [Google Scholar] [CrossRef]
  49. Baneth, G.; Florin-Christensen, M.; Cardoso, L.; Schnittger, L. Reclassification of Theileria annae as Babesia vulpes sp. nov. Parasites Vectors 2015, 8, 1–7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Solano-Gallego, L.; Sainz, Á.; Roura, X.; Estrada-Peña, A.; Miró, G. A review of canine babesiosis: The European perspective. Parasites Vectors 2016, 9, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Radyuk, E.; Karan, L. A case of Babesia vulpes infection in a dog in Russia. Vet. Parasitol. Reg. Stud. Rep. 2020, 22, 100467. [Google Scholar] [CrossRef] [PubMed]
  52. Baneth, G.; Cardoso, L.; Brilhante-Simões, P.; Schnittger, L. Establishment of Babesia vulpes n. sp. (Apicomplexa: Babesiidae), a piroplasmid species pathogenic for domestic dogs. Parasites Vectors 2019, 12, 1–8. [Google Scholar] [CrossRef] [PubMed]
  53. Lindsay, D.S.; Dubey, J.P. Neosporosis, Toxoplasmosis, and Sarcocystosis in Ruminants: An Update. Vet. Clin. N. Am. Food Anim. Pract. 2020, 36, 205–222. [Google Scholar] [CrossRef]
  54. Almería, S.; Ferrer, D.; Pabón, M.; Castellà, J.; Mañas, S. Red foxes (Vulpes vulpes) are a natural intermediate host of Neospora caninum. Vet. Parasitol. 2002, 107, 287–294. [Google Scholar] [CrossRef]
  55. Dubey, J.P.; Whitesell, L.E.; Culp, W.E.; Daye, S. Diagnosis and treatment of Neospora caninum-associated dermatitis in a red fox (Vulpes vulpes) with concurrent Toxoplasma gondii infection. J. Zoo Wildl. Med. 2014, 45, 454–457. [Google Scholar] [CrossRef] [PubMed]
  56. Jakubek, E.B.; Bröjer, C.; Regnersen, C.; Uggla, A.; Schares, G.; Björkman, C. Seroprevalences of Toxoplasma gondii and Neospora caninum in Swedish red foxes (Vulpes vulpes). Vet. Parasitol. 2001, 102, 167–172. [Google Scholar] [CrossRef]
  57. Wanha, K.; Edelhofer, R.; Gabler-Eduardo, C.; Prosl, H. Prevalence of antibodies against Neospora caninum and Toxoplasma gondii in dogs and foxes in Austria. Vet. Parasitol. 2005, 128, 189–193. [Google Scholar] [CrossRef]
  58. Reiterová, K.; Špilovská, S.; Čobádiová, A.; Hurníková, Z. Prevalence of Toxoplasma gondii and Neospora caninum in red foxes in Slovakia. Acta Parasitol. 2016, 61, 762–768. [Google Scholar] [CrossRef]
  59. Höche, J.; House, R.V.; Heinrich, A.; Schliephake, A.; Albrecht, K.; Pfeffer, M.; Ellenberger, C. Pathogen Screening for Possible Causes of Meningitis/Encephalitis in Wild Carnivores From Saxony-Anhalt. Front. Vet. Sci. 2022, 9, 826355. [Google Scholar] [CrossRef]
  60. Lukášová, R.; Marková, J.; Bártová, E.; Murat, J.B.; Sedlák, K. Molecular Evidence of Toxoplasma gondii, Neospora caninum, and Encephalitozoon cuniculi in Red Foxes (Vulpes vulpes). J. Wildl. Dis. 2018, 54, 825–828. [Google Scholar] [CrossRef]
  61. Hůrková, L.; Modrý, D. PCR detection of Neospora caninum, Toxoplasma gondii and Encephalitozoon cuniculi in brains of wild carnivores. Vet. Parasitol. 2006, 137, 150–154. [Google Scholar] [CrossRef] [PubMed]
  62. Bartley, P.M.; Wright, S.E.; Zimmer, I.A.; Roy, S.; Kitchener, A.C.; Meredith, A.; Innes, E.A.; Katzer, F. Detection of Neospora caninum in wild carnivorans in Great Britain. Vet. Parasitol. 2013, 192, 279–283. [Google Scholar] [CrossRef] [PubMed]
  63. Magalhães, T.R.; Pinto, F.F.; Queiroga, F.L. A multidisciplinary review about Encephalitozoon cuniculi in a One Health perspective. Parasitol. Res. 2022, 121, 2463–2479. [Google Scholar] [CrossRef] [PubMed]
  64. Murphy, T.M.; Walochnik, J.; Hassl, A.; Moriarty, J.; Mooney, J.; Toolan, D.; Sanchez-Miguel, C.; O’Loughlin, A.; McAuliffe, A. Study on the prevalence of Toxoplasma gondii and Neospora caninum and molecular evidence of Encephalitozoon cuniculi and Encephalitozoon (Septata) intestinalis infections in red foxes (Vulpes vulpes) in rural Ireland. Vet. Parasitol. 2007, 146, 227–234. [Google Scholar] [CrossRef] [PubMed]
Table 1. PCR primers and conditions employed in the assays for the detection of each pathogen.
Table 1. PCR primers and conditions employed in the assays for the detection of each pathogen.
PathogenAmplicons
(Target Gene)
Primers Sequence
(5′–3′)
PCR ConditionsReference
Anaplasma
phagocytophilum *
932 bp
(16 S rRNA)
[First PCR]
GE3a (CACATGCAAGTCGAACGGATTATTC)
GE10r (TTCCGTTAAGAAGGATCTAATCTCC)
95 °C–30 s
55 °C–30 s
72 °C–1 min
[21]
546 bp
(16S rRNA)
[Second PCR]
GE9f (AACGGATTATTCTTTATAGCTTGCT)
GE2 (GGCAGTATTAAAAGCAGCTCCAGG)
Babesia560 pb
(ssrRNA)
Mic1 (GTCTTGTAATTGGAATGATGG)
Mic2 (CCAAAGACTTTGATTTCTCTC)
95 °C–30 s
50 °C–30 s
72 °C–1 min
[22]
Brucella spp.905 bp
(16SrRNA)
F4 (TCGAGCGCCCGCAAGGGG)
R2 (AACCATAGTGTCTCCACTAA)
95 °C–30 s
54 °C–1 min
72 °C–1 min
[23]
Coxiella burnetii687 bp
(IS1111a)
Trans-1 (TATGTATCCACCGTAGCCAGT)
Trans-2 (CCCAACAACACCTCCTTATTC)
95 °C–30 s
64 °C–1 min
72 °C–1 min
[24]
Ehrlichia canis *478 bp
(16S rRNA)
[First PCR]
ECCf (AGAACGAACGCTGGCGGCAAGC)
ECBr (CGTATTACCGCGGCTGCTGGCA)
95 °C–1 min
55 °C–2 min
72 °C–1.5 min
[25,26]
389 bp
(16S rRNA)
[Second PCR]
ECA (CAATTATTTATAGCCTCTGGCTATAGGA)
HE3r (TATAGGTACCGTCATTATCTTCCCTAT)
Hepatozoon spp.660 pb
(18S rRNA)
HepF (ATACATGAGCAAAATCTCAAC)
HepR (CTTATTATTCCATGCTGCAG)
95 °C–30 s
57 °C–30 s
72 °C–1 min
[27]
Leptospira spp.103 bp
(16S rRNA)
[Leptospira genus]
16S-P1 (TAGTGAACGGGATTAGATAC)
16S-P2 (GGTCTACTTAATCCGTTAGG)
95 °C–30 s
60 °C–30 s
72 °C–1 min
[28]
242 bp
(lipL32)
[pathogenic leptospirae]
LipL32–45F (AAGCATTACCGCTTGTGGTG)
LipL32–286R (GAACTCCCATTTCAGCGA TT)
95 °C–30 s
58 °C–30 s
72 °C–1 min
[29]
450
(rrs2)
[for sequencing]
rrs2F (CATGCAAGTCAAGCGGAGTA)
rrs2R (AGTTGAGCCCGCAGTTTTC)
95 °C–30 s
58 °C–30 s
72 °C–1 min
[30]
Neospora caninum337 pb
(Region NC5)
Np6 + (TCGCCAGTCAACCTACGTCTTCT)
Np21 (CCCAGTGCGTCCAATCCTGTAAC)
95 °C–30 s
63 °C–30 s
72 °C–30 s
[31]
Microsporidia250–280 pb
(18S rRNA)
V1 (CACCAGGTTGATTCTGCCTGAC)
PMP2 (CCTCTCCGGAACCAAACCCTG)
94 °C–30 s
60 °C–30 s
72 °C–30 s
[32]
Legend. * Nested PCR.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ebani, V.V.; Trebino, C.; Guardone, L.; Bertelloni, F.; Cagnoli, G.; Nardoni, S.; Sel, E.; Wilde, E.; Poli, A.; Mancianti, F. Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy. Animals 2022, 12, 2891. https://doi.org/10.3390/ani12202891

AMA Style

Ebani VV, Trebino C, Guardone L, Bertelloni F, Cagnoli G, Nardoni S, Sel E, Wilde E, Poli A, Mancianti F. Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy. Animals. 2022; 12(20):2891. https://doi.org/10.3390/ani12202891

Chicago/Turabian Style

Ebani, Valentina Virginia, Chiara Trebino, Lisa Guardone, Fabrizio Bertelloni, Giulia Cagnoli, Simona Nardoni, Emily Sel, Emily Wilde, Alessandro Poli, and Francesca Mancianti. 2022. "Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy" Animals 12, no. 20: 2891. https://doi.org/10.3390/ani12202891

APA Style

Ebani, V. V., Trebino, C., Guardone, L., Bertelloni, F., Cagnoli, G., Nardoni, S., Sel, E., Wilde, E., Poli, A., & Mancianti, F. (2022). Occurrence of Bacterial and Protozoan Pathogens in Red Foxes (Vulpes vulpes) in Central Italy. Animals, 12(20), 2891. https://doi.org/10.3390/ani12202891

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop