Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli from Laying Hens Housed in Different Rearing Systems
Abstract
:Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Study Design and Sampling
2.2. Campylobacter Identification
2.3. Antibiotic Susceptibility Testing
2.4. Plasma Corticosterone and IL-6-ELISA Test
2.5. Statistical Analysis
3. Results
3.1. Campylobacter Prevalence
3.2. Antibiotic Resistance
3.3. Corticosterone and Interleukin-6 Levels
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Buller, H.; Blokhuis, H.; Jensen, P.; Keeling, L. Towards farm animal welfare and sustainability. Animals 2018, 8, 81. [Google Scholar] [CrossRef] [Green Version]
- Hafez, H.M.; Shehata, A.A. Turkey production and health: Current challenges. Ger. J. Vet. Res. 2021, 1, 3–14. [Google Scholar] [CrossRef]
- Castellini, C.; Berri, C.; Le Bihan-Duval, E.; Martino, G. Qualitative attributes and consumer perception of organic and free-range poultry meat. Worlds Poult. Sci. 2008, 64, 500–512. [Google Scholar] [CrossRef]
- Gray, H.G.; Paradis, T.J.; Chang, P.W. Physiological effects of adrenocorticotropic hormone and hydrocortisone in laying hens. Poult. Sci. 1989, 68, 1710–1713. [Google Scholar] [CrossRef] [PubMed]
- Van Goor, A.; Redweik, G.A.; Stromberg, Z.R.; Treadwell, C.G.; Xin, H.; Mellata, M. Microbiome and biological blood marker changes in hens at different laying stages in conventional and cage free housings. Poult. Sci. 2020, 99, 2362–2374. [Google Scholar] [CrossRef]
- Jones, D.R.; Anderson, K.E.; Guard, J.Y. Prevalence of coliforms, Salmonella, Listeria, and Campylobacter associated with eggs and the environment of conventional cage and free-range egg production. Poult. Sci. 2012, 91, 1195–1202. [Google Scholar] [CrossRef] [PubMed]
- Jones, D.R.; Anderson, K.E.; Musgrove, M.T. Comparison of environmental and egg microbiology associated with conventional and free-range laying hen management. Poult. Sci. 2011, 90, 2063–2068. [Google Scholar] [CrossRef] [PubMed]
- De Reu, K.; Grijspeerdt, K.; Heyndrickx, M.; Zoons, J.; De Baere, K.; Uyttendaele, M.; Debevere, J.; Herman, L. Bacterial eggshell contamination in conventional cages, furnished cages and aviary housing systems for laying hens. Br. Poult. Sci. 2005, 46, 149–155. [Google Scholar] [CrossRef]
- De Reu, K.; Rodenburg, T.B.; Grijspeerdt, K.; Messens, W.; Heindrickx, M.; Tuyttens, F.A.; Snock, B.; Zoons, J.; Herman, L. Bacteriological contamination, dirt, and cracks of eggshells in furnished cages and non-cage systems for laying hens: An international on-farm comparison. Poult. Sci. 2009, 88, 2442–2448. [Google Scholar] [CrossRef] [PubMed]
- Goualie, G.B.; Bakayoko, S.; Coulibaly, K.J. Practices of biosecurity measures and their consequences on poultry farms in abidjan district. J. Food Saf. 2020, 19, 84–91. [Google Scholar]
- The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-Borne Outbreaks in 2013. Available online: https://www.efsa.europa.eu/it/efsajournal/pub/3991 (accessed on 28 January 2015).
- Rouger, A.; Tresse, O.; Zagorec, M. Bacterial Contaminants of Poultry Meat: Sources, Species, and Dynamics. Microorganisms 2017, 5, 50. [Google Scholar] [CrossRef] [Green Version]
- Garénaux, A.; Jugiau, F.; Rama, F.; de Jonge, R.; Denis, M.; Federighi, M.; Ritz, M. Survival of Campylobacter jejuni strains from different origins under oxidative stress conditions: Effect of temperature. Curr. Microbiol. 2008, 56, 293–297. [Google Scholar] [CrossRef] [PubMed]
- The Community Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-Borne Outbreaks in the European Union in 2008. Available online: https://www.efsa.europa.eu/en/efsajournal/pub/1496 (accessed on 28 January 2010).
- Fitzgerald, C. Campylobacter. Clin. Lab. Med. 2015, 35, 289–298. [Google Scholar] [CrossRef] [PubMed]
- Moffatt, C.R.; Kennedy, K.J.; Neill, B.; Selvey, L.; Kirk, M.D. Bacteraemia, antimicrobial susceptibility and treatment among Campylobacter-associated hospitalisations in the Australian Capital Territory: A review. BMC Infect. Dis. 2021, 21, 848. [Google Scholar] [CrossRef] [PubMed]
- Allos, B.M. Association between Campylobacter infection and Guillain-Barré syndrome. J. Infect. Dis. 1997, 176, 125–128. [Google Scholar] [CrossRef] [Green Version]
- van der Meché, F.G.; van Doorn, P.A. Guillain-Barré syndrome and chronic inflammatory demyelinating polyneuropathy: Immune mechanisms and update on current therapies. Ann. Neurol. 1995, 37, 14–31. [Google Scholar] [CrossRef] [PubMed]
- Berlit, P.; Rakicky, J. The Miller Fisher syndrome. Review of the literature. J. Clin. Neuroophthalmol. 1992, 12, 57–63. [Google Scholar]
- Burch, D. Avian vibrionic hepatitis in laying hens. Vet. Rec. 2005, 157, 528. [Google Scholar] [CrossRef]
- Gregory, M.; Klein, B.; Sahin, O.; Girgis, G. Isolation and Characterization of Campylobacter hepaticus from Layer Chickens with Spotty Liver Disease in the United States. Avian. Dis. 2018, 62, 79–85. [Google Scholar] [CrossRef]
- Phung, C.; Vezina, B.; Anwar, A.; Wilson, T.; Scott, P.C.; Moore, R.J.; Van, T.T. Campylobacter hepaticus, the Cause of Spotty Liver Disease in Chickens: Transmission and Routes of Infection. Front. Vet. Sci. 2020, 6, 505. [Google Scholar] [CrossRef] [Green Version]
- Broom, L.J.; Kogut, M.H. The role of the gut microbiome in shaping the immune system of chickens. Vet. Immunol. Immunopathol. 2018, 204, 44–51. [Google Scholar] [CrossRef]
- Stern, N.J.; Cox, N.A.; Bailey, J.S.; Berrang, M.E.; Musgrove, M.T. Comparison of mucosal competitive exclusion and competitive exclusion treatment to reduce Salmonella and Campylobacter spp. colonization in broiler chickens. Poul. Sci. 2001, 80, 156–160. [Google Scholar] [CrossRef] [PubMed]
- Petersen, L.; Nielsen, E.M.; On, S.L. Serotype and genotype diversity and hatchery transmission of Campylobacter jejuni in commercial poultry flocks. Vet. Microbiol. 2001, 82, 141–154. [Google Scholar] [CrossRef]
- Newell, D.G.; Fearnley, C. Sources of Campylobacter colonization in broiler chickens. Appl. Environ. Microbiol. 2003, 69, 43–51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rasschaert, G.; Houf, K.; Van Hende, J.; De Zutter, L. Investigation of the concurrent colonization with Campylobacter and Salmonella in poultry flocks and assessment of the sampling site for status determination at slaughter. Vet. Microbiol. 2007, 123, 104–109. [Google Scholar] [CrossRef]
- Asakura, H.; Nakayama, T.; Yamamoto, S.; Izawa, K.; Kawase, J.; Torii, Y.; Murakami, S. Long-term grow-out affects Campylobacter jejuni colonization fitness in coincidence with altered microbiota and lipid composition in the cecum of laying hens. Front. Vet. Sci. 2021, 18, 657. [Google Scholar] [CrossRef] [PubMed]
- Carsia, R.V.; Scanes, C.G.; Malamed, S. Polyhormonal regulation of avian and mammalian corticosteroidogenesis in vitro. Comp. Biochem. Physiol. 1987, 88, 131–140. [Google Scholar] [CrossRef]
- Romero, L.M.; Reed, J.M. Collecting baseline corticosterone samples in the field: Is under 3 min good enough? Comp. Biochem. Physiol. 2005, 140, 73–79. [Google Scholar] [CrossRef]
- Jones, R.B.; Satterlee, D.G. Threat-induced behavioural inhibition in Japanese quail genetically selected for contrasting adrenocortical response to mechanical restraint. Br. Poult. Sci. 1996, 37, 465–470. [Google Scholar] [CrossRef]
- Cockrem, J.F. Stress, corticosterone responses and avian personalities. J. Ornithol. 2007, 148, 169–178. [Google Scholar] [CrossRef]
- Ahmed, S.T.; Ivashkiv, L.B. Inhibition of IL-6 and IL-10 signaling and stat activation by inflammatory and stress pathways. J. Immunol. 2000, 165, 5227–5237. [Google Scholar] [CrossRef] [Green Version]
- Barsotti, A.M.; de Assis, V.R.; Titon, S.C.; Titon, B.; da Silva Ferreira, Z.F.; Gomes, F.R. ACTH modulation on corticosterone, melatonin, testosterone and innate immune response in the tree frog Hypsiboas faber. Comp. Biochem. Physiol. 2017, 204, 177–184. [Google Scholar] [CrossRef]
- Denis, M.; Soumet, C.; Rivoal, K.; Ermel, G.; Blivet, D.; Salvat, G.; Colin, P. Development of a m-PCR assay for simultaneous identification of Campylobacter jejuni and C. coli. Lett. Appl. Microbiol. 1999, 29, 406–410. [Google Scholar] [CrossRef]
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 12.0. 2022. Available online: http://www.eucast.org (accessed on 1 January 2022).
- Clinical Laboratory and Standards Institute. VET01-S2 Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals; Second Informational Supplement; Clinical Laboratory and Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- Gharbi, M.; Bejaoui, A.; Hamda, C.B.; Alaya, N.; Hamrouni, S.; Bessoussa, G.; Ghram, A.; Maaroufi, A. Campylobacter spp. In eggs and laying hens in the North-East of Tunisia: High prevalence and multidrug-resistance phenotypes. Vet. Sci. 2022, 9, 108. [Google Scholar] [CrossRef] [PubMed]
- Newell, D.G.; Elvers, K.T.; Dopfer, D.; Hansson, I.; Jones, P.; James, S.; Gittins, J.; Sterns, N.J.; Davies, R.; Connerton, I.; et al. Biosecurity-Based Interventions and Strategies to Reduce Campylobacter spp. on Poultry Farms. Appl. Environ. Microbiol. 2011, 77, 8605–8614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wayou, B.A.; Kassa, G.M.; Sori, T.; Mondin, A.; Tucciarone, C.M.; Cecchinato, M.; Pasotto, D. Molecular survey and identification of Campylobacter spp. in layer farms in Central Ethiopia. Trop. Med. Infect. Dis. 2022, 7, 31. [Google Scholar] [CrossRef] [PubMed]
- Jones, D.R.; Guard, J.; Gast, R.K.; Buhr, R.J.; Fedorka-Cray, P.J.; Abdo, Z.; Plumblee, J.R.; Bourassa, D.V.; Cox, N.A.; Rigsby, L.L.; et al. Influence of commercial laying hen housing systems on the incidence and identification of Salmonella and Campylobacter. Poult. Sci. 2016, 95, 1116–1124. [Google Scholar] [CrossRef]
- Sasaki, Y.; Taketoshi, I.; Masashi, U.; Kenzo, Y.; Shizunobu, I.; Hiroshi, A. Campylobacter spp. prevalence and fluoroquinolone resistance in chicken layer farms. J. Vet. Med. Sci. 2022, 22, 47. [Google Scholar] [CrossRef]
- Sulonen, J.; Karenlampi, R.; Holma, U.; Hanninen, M.L. Campylobacter in Finnish Organic Laying Hens in Autumn 2003 and Spring 2004. Poult. Sci. 2007, 86, 1223–1228. [Google Scholar] [CrossRef]
- Parisi, A.; Lanzilotta, S.G.; Addante, N.; Normanno, G.; Modugno, G.D.; Dambrosio, A.; Montagna, C.O. Prevalence, molecular characterization and antimicrobial resistance of thermophilic Campylobacter isolates from cattle, hens, broilers and broiler Meat in South-eastern Italy. Vet. Res. Commun. 2007, 31, 113–123. [Google Scholar] [CrossRef]
- Nshama, R.P.; Katakweba, A.S.; Kashoma, I.P.; Gahamanyi, N.; Komba, E.V. Prevalence and antimicrobial susceptibility profiles of Campylobacter coli isolated from broiler sand layers cloacal swabs in Mwanza and Arusha, Tanzania. Ger. J. Vet. Res. 2011, 10, 14116–14124. [Google Scholar] [CrossRef]
- ELraheam ELSayed, M.S.; Trabees, R.; Shehata, A.A.; El-Bagoury, A.E.; Awad, A.; Harb, O.H.; Sabry, A. Virulence repertoire and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolated from some poultry farms in Menoufia Governorate, Egypt. Pak. Vet. J. 2019, 39, 261–265. [Google Scholar] [CrossRef]
- Rama, N.E.; Bailey, M.; Jones, D.R.; Gast, R.K.; Anderson, K.; Brar, J.; Taylor, R.; Oliver, H.F.; Singh, M. Prevalence, persistence, and antimicrobial resistance of Campylobacter spp. from eggs and laying hens housed in five commercial housing systems. Foodborne Pathog. Dis. 2018, 15, 506–516. [Google Scholar] [CrossRef]
- Agunos, A.; Waddell, L.; Léger, D.; Taboada, E. A systematic review characterizing on farm sources of Campylobacter spp. for broiler chickens. PLoS ONE 2014, 8, e104905. [Google Scholar] [CrossRef] [Green Version]
- Guerin, M.T.; Martin, W.; Reiersen, J.; Berke, O.; McEwen, S.A.; Bisaillon, J.R.; Lowman, R. A farm-level study of risk factors associated with the colonization of broiler flocks with Campylobacter spp. in Iceland, 2001–2004. Acta. Vet. Scand. 2007, 49, 18. [Google Scholar] [CrossRef] [Green Version]
- Adkin, A.; Hartnett, E.; Jordan, L.; Newell, D.; Davison, H. Use of a systematic review to assist the development of Campylobacter control strategies in broilers. J. Appl. Microbiol. 2006, 100, 306–315. [Google Scholar] [CrossRef]
- Gahamanyi, N.; Mboera, L.E.; Matee, M.I.; Mutangana, D.; Komba, E.V. Prevalence, risk factors, and antimicrobial resistance profiles of thermophilic Campylobacter species in humans and animals in sub-Saharan Africa: A systematic review. Int. J. Microbiol. 2020, 2020, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fossum, O.; Jansson, D.S.; Etterlin, P.; Vagsholm, I. Causes of mortality in laying hens in different housing systems in 2001 to 2004. Acta Vet. Scand. 2009, 51, 3. [Google Scholar] [CrossRef] [Green Version]
- Jones, D.R.; Anderson, K.E. Housing system and laying hen strain impacts on egg microbiology. Poult. Sci. 2013, 92, 2221–2225. [Google Scholar] [CrossRef] [PubMed]
- Kreienbrock, L.; Schneider, B.; Schäl, J.; Glaser, S. Orientierende epidemiologische Untersuchung zum Leistungsniveau und Gesundheitsstatus. In Legehennenhaltungen Verschiedener Haltungssysteme. Zwischenbericht: Deskriptive Auswertung; Institut fur Biometrie, Epidemiologie und Informationsverarbeitung (IBEI): Hannover, Germany, 2003; pp. 1–60. [Google Scholar]
- Pedersen, B.K. Exercise and cytokines. Immunol. Cell Biol. 2000, 78, 532–535. [Google Scholar] [CrossRef] [PubMed]
- Smith, B.A.; Meadows, S.; Meyers, S.; Parmley, E.J.; Fazil, A. Seasonality and zoonotic foodborne pathogens in Canada: Relationships between climate and campylobacter, E. coli and Salmonella in meat products. Epidemiol. Infect. 2019, 147, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Schijven, J.; Bouwknegt, M.; de Roda Husman, A.M.; Rutjes, S.; Sudre, B.; Suk, J.E.; Semenza, J.C. A Decision Support Tool to Compare Waterborne and Foodborne Infection and/or Illness Risks Associated with Climate Change. Risk Anal. 2013, 33, 2154–2167. [Google Scholar] [CrossRef]
- Oh, E.J.; Kim, J.M.; Kim, J.K. Interrelationship between climatic factors and incidence of FBD caused by Clostridioides difficile toxin B, Clostridium perfringens, Campylobacter spp., and Escherichia coli O157:H7. Environ. Sci. Pollut. Res. 2021, 28, 44538–44546. [Google Scholar] [CrossRef]
- Sahin, O.; Kassem, I.I.; Shen, Z.; Lin, J.; Rajashekara, G.; Zhang, Q. Campylobacter in poultry: Ecology and potential interventions. Avian Dis. 2015, 59, 185–200. [Google Scholar] [CrossRef]
- Ekdahl, K.; Normann, B.; Andersson, Y. Could flies explain the elusive epidemiology of campylobacteriosis? BMC Infect. Dis. 2005, 5, 11. [Google Scholar] [CrossRef] [Green Version]
- Miflin, J.K.; Templeton, J.M.; Blackall, P.J. Antibiotic resistance in Campylobacter jejuni and Campylobacter coli isolated from poultry in the South-East Queensland region. J. Antimicrob. Chemother. 2007, 59, 775–778. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, X.; Naren, G.W.; Wu, C.M.; Wang, Y.; Dai, L.; Xia, L.N.; Luo, P.J.; Zhang, Q.; Shen, J.Z. Prevalence and antimicrobial resistance of Campylobacter isolates in broilers from China. Vet. Microbiol. 2010, 144, 133–139. [Google Scholar] [CrossRef] [PubMed]
- Rivera-Gomis, J.; Marín, P.; Martínez-Conesa, C.; Otal, J.; Jordán, M.J.; Escudero, E.; Cubero, M.J. Antimicrobial resistance of Campylobacter jejuni, Escherichia coli and Enterococcus faecalis commensal isolates from laying hen farms in Spain. Animals. 2021, 11, 1284. [Google Scholar] [CrossRef]
- Wieczoreck, K.; Szewczyk, R.; Osek, J. Prevalence, antimicrobial resistance and molecular characterization of Campylobacter jejuni and Campylobacter coli isolated from retail raw meat in Poland. Vet. Med. 2012, 57, 293–299. [Google Scholar] [CrossRef] [Green Version]
- Hariharan, H.; Sharma, S.; Chikweto, A.; Matthew, V.; DeAllie, C. Antimicrobial drug resistance as determined by the E-test in Campylobacter jejuni, C. coli, and C. lari isolates from the ceca of broiler and layer chickens in Grenada. Comp. Immunol. Microbiol. Infect. Dis. 2009, 32, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.; Sahin, O.; Grover, M.; Zhang, Q. New and alternative strategies for the prevention, control, and treatment of antibiotic-resistant Campylobacter. Transl. Res. 2020, 223, 76–88. [Google Scholar] [CrossRef] [PubMed]
- Bester, L.A.; Essack, S.Y. Observational Study of the Prevalence and Antibiotic Resistance of Campylobacter spp. from Different Poultry Production Systems in KwaZulu-Natal, South Africa. J. Food Prot. 2012, 75, 154–159. [Google Scholar] [CrossRef] [PubMed]
- Marotta, F.; Garofolo, G.; di Marcantonio, L.; Di Serafino, G.; Neri, D.; Romantini, R.; Sacchini, L.; Alessiani, A.; Di Donato, G.; Nuvoloni, R.; et al. Antimicrobial resistance genotypes and phenotypes of Campylobacter jejuni isolated in Italy from humans, birds from wild and urban habitats, and poultry. PLoS ONE 2019, 14, e0223804. [Google Scholar] [CrossRef] [Green Version]
- Wieczorek, K.; Osek, J. Antimicrobial Resistance Mechanisms among Campylobacter. BioMed Res. Int. 2013, 2013, 340605. [Google Scholar] [CrossRef] [Green Version]
- Gibreel, A. Macrolide resistance in Campylobacter jejuni and Campylobacter coli. J. Antimicrob. Chemother. 2006, 58, 243–255. [Google Scholar] [CrossRef]
- Schiaffino, F.; Colston, J.M.; Paredes Olortegui, M.; François, R.; Pisanic, N.; Burga, R.; Yori, P.P.; Kosek, M.N. Antibiotic resistance of Campylobacter spp. in a pediatric cohort study. Antimicrob. Agents Chemother. 2018, 63, e01911-18. [Google Scholar] [CrossRef] [Green Version]
- Bolinger, H.; Kathariou, S. The Current State of Macrolide Resistance in Campylobacter spp.: Trends and Impacts of Resistance Mechanisms. Appl. Environ. Microbiol. 2017, 83, e00416-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Možina, S.S.; Kurinčič, M.; Klančnik, A.; Mavri, A. Campylobacter and its multi-resistance in the food chain. Trends Food Sci. Technol. 2011, 22, 91–98. [Google Scholar] [CrossRef]
- Goualié, B.G.; Ouattara, H.G.; Akpa, E.E.; Guessends, N.K.; Bakayoko, S.; Niamké, S.L.; Dosso, M. Occurrence of multidrug resistance in Campylobacter from Ivorian poultry and analysis of bacterial response to acid shock. Food Sci. Biotechnol. 2014, 23, 1185–1191. [Google Scholar] [CrossRef]
- Abd El-Hack, M.E.; El-Saadony, M.T.; Shehata, A.M.; Arif, M.; Paswan, V.K.; Batiha, G.E.; Khafaga, A.F.; Elbestawy, A.R. Approaches to prevent and control Campylobacter spp. colonization in broiler chickens: A review. Environ. Sci. Poll. Res. 2020, 28, 4989–5004. [Google Scholar] [CrossRef]
- Cox, N.A.; Richardson, L.J.; Maurer, J.J.; Berrang, M.E.; Fedorka-Cray, P.J.; Buhr, R.J.; Byrd, J.A.; Lee, M.D.; Hofacre, C.L.; O’Kane, P.M.; et al. Evidence for horizontal and vertical transmission in Campylobacter passage from hen to her progeny. J. Food Prot. 2012, 75, 1896–1902. [Google Scholar] [CrossRef]
- Bain, M.M.; Mcdade, K.; Burchmore, R.; Law, A.; Wilson, P.W.; Schmutz, M.; Preisinger, R.; Dunn, I.C. Enhancing the egg’s natural defence against bacterial penetration by increasing cuticle deposition. Anim. Genet. 2013, 44, 661–668. [Google Scholar] [CrossRef]
- De Reu, K.; Grijspeerdt, K.; Messens, W.; Heyndrickx, M.; Uyttendaele, M.; Debevere, J.; Herman, L. Eggshell factors influencing eggshell penetration and whole egg contamination by different bacteria, including Salmonella enteritidis. Int. J. Food Microbiol. 2006, 112, 253–260. [Google Scholar] [CrossRef]
- Dunn, I.C.; Joseph, N.T.; Bain, M.; Edmond, A.; Wilson, P.W.; Milona, P.; Nys, Y.; Gautron, J.; Schmutz, M.; Preisinger, R.; et al. Polymorphisms in eggshell organic matrix genes are associated with eggshell quality measurements in pedigree Rhode Island Red hens. Anim. Genet. 2009, 40, 110–114. [Google Scholar] [CrossRef]
- Muñoz, A.; Dominguez-Gasca, N.; Jimenez-Lopez, C.; Rodriguez-Navarro, A.B. Importance of eggshell cuticle composition and maturity for avoiding trans-shell Salmonella contamination in chicken eggs. Food Control. 2015, 55, 31–38. [Google Scholar] [CrossRef]
- Jabalera, Y.; Dominguez-Gasca, N.; Munoz, A.; Hincke, M.; Jimenez-Lopez, C.; Rodriguez-Navarro, A.B. Antimicrobial defenses of table eggs: Importance of antibacterial proteins in egg white as a function og hen age in an extended production cycle. Food Microbiol. 2022, 107, 104068. [Google Scholar] [CrossRef]
- Gibbens, J.; Pascoe, S.J.; Evans, S.; Davies, R.; Sayers, A. A trial of biosecurity as a means to control Campylobacter infection of broiler chickens. Prev. Vet. Med. 2001, 48, 85–99. [Google Scholar] [CrossRef]
- Mainali, C.; Houston, I. Small Poultry Flocks in Alberta: Demographics and Practices. Avian Dis. 2017, 61, 46–54. [Google Scholar] [CrossRef]
- Derksen, T.; Lampron, R.; Hauck, R.; Pitesky, M.; Gallardo, R.A. Biosecurity assessment and seroprevalence of respiratory diseases in backyard poultry flocks located close to and far from commercial premises. Avian Dis. 2018, 62, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Brochu, N.M.; Guerin, M.T.; Varga, C.; Lillie, B.N.; Brash, M.L.; Susta, L. Demographic Characteristics and Husbandry and Biosecurity Practices of Small Poultry Flocks in Ontario, Canada. Avian Dis. 2021, 65, 287–294. [Google Scholar] [CrossRef] [PubMed]
- Borck Hog, B.; Sommer, H.M.; Larsen, L.S.; Sorensen, A.I.; David, B.; Hofshagen, M.; Rosenquist, H. Farm specific risk factors for Campylobacter colonisation in Danish and Norwegian broilers. Prev. Vet. Med. 2016, 130, 137–145. [Google Scholar] [CrossRef] [PubMed]
Farm | Rearing System | Flock | Consistence of Flock (Number of Birds) | Stage of Production (Months) | Environmental Temperature Inside the Shed (T °C) | Number of Sampled Birds |
---|---|---|---|---|---|---|
A | Cages | A1 | 12.500 | 6 | 26.9 °C | 31 |
A2 | 12.000 | 2 | 23 °C | 30 | ||
B | Barns | B1 | 3.000 | 8 | 24 °C | 30 |
B2 | 3.000 | 3 | 20 °C | 30 | ||
C | Aviaries | C1 | 12.000 | 7.5 | 24.7 °C | 26 |
C2 | 12.000 | 5 | 20.3 °C | 30 |
Target Gene | Primer | Sequence | Amplicon Molecular Weight | |
---|---|---|---|---|
Genus Campylobacter | 16S rRNA | MD16 S1 MD16 S2 | ATCTAATGGCTTAACCATTAAAC GGAGGGTAACTAGTTTAGTATT | 857 bp |
C. jejuni | MapA | MD mapA1 MD mapA2 | CTATTTTATTTTTGAGTGCTTGTG GCTTTATTTGCCATTTGTTTTATTA | 598 bp |
C. coli | CeuE | COL3 MDCOL2 | AATTGAAAATTGCTCCAACTATG TGATTTTATTATTTGTAGCAGCG | 462 bp |
C. jejuni | C. coli | Both C. jejuni and C. coli | |||||||
---|---|---|---|---|---|---|---|---|---|
Flocks | N° Pos/Tested (%) | p-Value | OR (CI 95%) | N° Pos/Tested (%) | p-Value | OR (CI 95%) | N° Pos/Tested (%) | p-Value | OR (CI 95%) |
A1 | 8/31 (25.8) | <0.001 | 2.26 (0.6–8.5) | 13/31 (41.9) | <0.001 | 10.11 (2.04–50.19) | 1/31 (3.2) | <0.001 | 1.00 (Reference group) |
A2 | 4/30 (13.3) | 1.00 (Reference group) | 24/30 (80) | 56.00 (10.33–303.68) | 2/30 (6.7) | 2.14 (0.18–24.96) | |||
B1 | 16/30 (53.3) | 7.43 (2.08–26.55) | 2/30 (6.7) | 1.00 (Reference group) | 11/30 (36.7) | 17.37 (2.07–145.61) | |||
B2 | 14/30 (46.7) | 5.69 (1.59–20.33) | 12/30 (40) | 9.33 (1.87–46.68) | 0/30 (0) | NA | |||
C1 | 9/26 (34.6) | 3.44 (0.91–12.97) | 14/26 (54.8) | 16.33 (3.2–83.25) | 0/26 (0) | NA | |||
C2 | 26/30 (86.7) | 42.25 (9.53–187.22) | 4/30 (13.3) | 2.15 (0.36–12.76) | 0/30 (0) | NA | |||
Total | 77/177 (43.5) | 69/177 (38.9) | 14/177 (7.9) |
AZM | CHL | CIP | ENR | E | CN | NA | TE | SXT | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Flock (N° strains) | I | R | I | R | I | R | I | R | I | R | I | R | I | R | I | R | I | R | ||
C. jejuni | Cage (A) | A1 (8) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (12.5) | 5 (62.5) | 0 (0) | 5 (62.5) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 3 (37.5) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
A2 (4) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | ||
Sub total (12) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (8.3) | 5 (41.6) | 0 (0) | 5 (41.6) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 3 (25) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | ||
Barn (B) | B1 (15) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 9 (60) | 1 (6.7) | 4 (26.7) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 6 (40) | 0 (0) | 4 (26.7) | 0 (0) | 8 (53.3) | |
B2 (14) | 0 (0) | 0 (0) | 0 (0) | 1 (7.1) | 2 (14.3) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (7.1) | 0 (0) | 0 (0) | 0 (0) | 1 (7.1) | 0 (0) | 0 (0) | 0 (0) | 2 (14.3) | ||
Sub total (29) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 2 (6.9) | 9 (31) | 1 (3.4) | 4 (13.8) | 0 (0) | 1 (3.4) | 0 (0) | 0 (0) | 0 (0) | 7 (24.1) | 0 (0) | 4 (13.8) | 0 (0) | 10 (34.5) | ||
Aviary (C) | C1 (9) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | |
C2 (26) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | ||
Sub total (35) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | ||
Total (76) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 3 (3.9) | 14 (18.4) | 1 (1.3) | 9 (11.8) | 0 (0) | 1 (1.3) | 0 (0) | 0 (0) | 0 (0) | 10 (13.1) | 0 (0) | 4 (5.3) | 0 (0) | 10 (13.1) | ||
C. coli | Cage (A) | A1 (13) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 4 (30.8) | 2 (15.4) | 0 (0) | 2 (15.4) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 2 (15.4) | 2 (15.4) | 0 (0) | 2 (15.4) | 2 (15.4) | 0 (0) |
A2 (20) | 0 (0) | 1 (5) | 0 (0) | 0 (0) | 4 (20) | 1 (5) | 0 (0) | 1 (5) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (5) | 1 (5) | 0 (0) | 2 (10) | 1 (5) | 5 (25) | ||
Sub total (33) | 0 (0) | 1 (3) | 0 (0) | 0 (0) | 8 (24.2) | 3 (9) | 0 (0) | 3 (9) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 3 (9) | 3 (9) | 0 (0) | 4 (12.1) | 3 (9) | 5 (15.1) | ||
Barn (B) | B1 (2) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 2 (100) | 0 (0) | 1 (50) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (50) | 1 (50) | 0 (0) | 2 (100) | 1 (50) | 1 (50) | |
B2 (12) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 11 (91.7) | 3 (25) | 2 (16.7) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 4 (33.3) | 3 (25) | 0 (0) | 7 (58.3) | 4 (33.3) | 0 (0) | ||
Sub total (14) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 13 (92.8) | 3 (21.4) | 3 (21.4) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 5 (35.7) | 4 (28.6) | 0 (0) | 9 (64.3) | 5 (35.7) | 1 (7.1) | ||
Aviary (C) | C1 (12) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 9 (75) | 2 (16.7) | 4 (33.3) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 2 (16.7) | 4 (33.3) | 0 (0) | 9 (75) | 4 (33.3) | 0 (0) | |
C2 (4) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (25) | 1 (25) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (25) | 0 (0) | 0 (0) | 3 (75) | 1 (25) | 0 (0) | ||
Sub total (16) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 10 (62.5) | 3 (18.7) | 4 (25) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 3 (18.7) | 4 (25) | 0 (0) | 12 (75) | 5 (31.2) | 0 (0) | ||
Total (63) | 0 (0) | 1 (1.6) | 0 (0) | 0 (0) | 8 (12.7) | 13 (20.6) | 16 (25.4) | 10 (15.9) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 11 (17.5) | 11 (17.5) | 0 (0) | 25 (39.7) | 13 (20.6) | 6 (9.5) |
3 Drugs | 4 Drugs | ||||||||
---|---|---|---|---|---|---|---|---|---|
Flock | CIP/ENR/NA | CIP/NA/ SXT | CIP/ENR/ SXT | CIP/ENR/ NA/TE | CIP/ENR/NA/SXT | CIP/NA/ TE/SXT | CHL/E/NA/SXT | ||
Multidrug resistant C. jejuni: 15/76 (19.7%) | Cage (A) | A1 | 3/8 (37,5) | 0/8 (0) | 0/8 (0) | 0/8 (0) | 0/8 (0) | 0/8 (0) | 0/8 (0) |
A2 | 0/4 (0) | 1/4 (25) | 0/4 (0) | 0/4 (0) | 1/4 (25) | 0/4 (0) | 0/4 (0) | ||
Sub total | 3/12 (25) | 1/12 (8.3) | 0/12 (0) | 0/12 (0) | 1/12 (8.3) | 0/12 (0) | 0/12 (0) | ||
On floor (B) | B1 | 0/15 (0) | 2/15 (13.3) | 2/15 (13.3) | 0/15 (0) | 2/15 (13.3) | 2/15 (13.3) | 0/15 (0) | |
B2 | 0/14 (0) | 0/14 (0) | 0/14 (0) | 0/14 (0) | 0/14 (0) | 0/14 (0) | 1/15 (7.1) | ||
Sub total | 0/29 (0) | 2/29 (6.9) | 2/29 (6.9) | 0/29 (0) | 2/29 (6.9) | 2/29 (6.9) | 1/29 (3.4) | ||
Aviary (C) | C1 | 0/9 (0) | 0/9 (0) | 0/9 (0) | 0/9 (0) | 0/9 (0) | 0/9 (0) | 0/9 (0) | |
C2 | 0/26 (0) | 0/26 (0) | 0/26 (0) | 0/26 (0) | 0/26 (0) | 0/26 (0) | 0/26 (0) | ||
Sub total | 0/35 (0) | 0/35 (0) | 0/35 (0) | 0/35 (0) | 0/35 (0) | 0/35 (0) | 0/35 (0) | ||
Total | 3/76 (3.9) | 3/76 (3.9) | 2/76 (2.6) | 0/76 (0) | 3/76 (3.9) | 3/76 (3.9) | 1/76 (1.3) | ||
Multidrug resistant C. coli: 11/63 (17.5%) | Cage (A) | Flock A1 | 2/13 (15.4) | 0/13 (0) | 0/13 (0) | 0/13 (0) | 0/13 (0) | 0/13 (0) | 0/13 (0) |
Flock A2 | 3/20 (15) | 0/20 (0) | 0/20 (0) | 0/20 (0) | 0/20 (0) | 0/20 (0) | 0/20 (0) | ||
Sub total | 5/33 (15.1) | 0/33 (0) | 0/33 (0) | 0/33 (0) | 0/33 (0) | 0/33 (0) | 0/33 (0) | ||
On floor (B) | B1 | 0/2 (0) | 0/2 (0) | 0/2 (0) | 1/2 (50) | 0/2 (0) | 0/2 (0) | 0/2 (0) | |
B2 | 0/12 (0) | 0/12 (0) | 0/12 (0) | 1/12 (8.3) | 0/12 (0) | 0/12 (0) | 0/12 (0) | ||
Sub total | 0/14 (0) | 0/14 (0) | 0/14 (0) | 2/14 (14.3) | 0/14 (0) | 0/14 (0) | 0/14 (0) | ||
Aviary (C) | C1 | 2/12 (16.7) | 0/12 (0) | 0/12 (0) | 2/12 (16.7) | 0/12 (0) | 0/12 (0) | 0/12 (0) | |
C2 | 0/4 (0) | 0/4 (0) | 0/4 (0) | 0/4 (0) | 0/4 (0) | 0/4 (0) | 0/4 (0) | ||
Sub total | 2/16 (12.5) | 0/16 (0) | 0/16 (0) | 2/16 (12.5) | 0/16 (0) | 0/16 (0) | 0/16 (0) | ||
Total | 7/63 (11.1) | 0/63 (0) | 0/63 (0) | 4/63 (6.3) | 0/63 (0) | 0/63 (0) | 0/63 (0) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Casalino, G.; Bozzo, G.; Dinardo, F.R.; D’Amico, F.; Dimuccio, M.M.; Camarda, A.; Ceci, E.; Romito, D.; Circella, E. Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli from Laying Hens Housed in Different Rearing Systems. Animals 2022, 12, 2978. https://doi.org/10.3390/ani12212978
Casalino G, Bozzo G, Dinardo FR, D’Amico F, Dimuccio MM, Camarda A, Ceci E, Romito D, Circella E. Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli from Laying Hens Housed in Different Rearing Systems. Animals. 2022; 12(21):2978. https://doi.org/10.3390/ani12212978
Chicago/Turabian StyleCasalino, Gaia, Giancarlo Bozzo, Francesca Rita Dinardo, Francesco D’Amico, Michela Maria Dimuccio, Antonio Camarda, Edmondo Ceci, Diana Romito, and Elena Circella. 2022. "Prevalence and Antimicrobial Resistance of Campylobacter jejuni and Campylobacter coli from Laying Hens Housed in Different Rearing Systems" Animals 12, no. 21: 2978. https://doi.org/10.3390/ani12212978