Frequency of an X-Linked Maternal Variant of the Bovine FOXP3 Gene Associated with Infertility in Different Cattle Breeds: A Pilot Study
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and DNA Extraction
2.2. Genotyping of the SNP
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Walsh, S.W.; Williams, E.J.; Evans, A.C.O. A review of the causes of poor fertility in high milk producing dairy cows. Anim. Reprod. Sci. 2011, 123, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Deka, R.P.; Magnusson, U.; Grace, D.; Randolph, T.F.; Shome, R.; Lindahl, J.F. Estimates of the economic cost caused by five major reproductive problems in dairy animals in Assam and Bihar, India. Animals 2021, 11, 3116. [Google Scholar] [CrossRef] [PubMed]
- Yaginuma, H.; Funeshima, N.; Tanikawa, N.; Miyamura, M.; Tsuchiya, H.; Noguchi, T.; Iwata, H.; Kuwayama, T.; Shirasuna, K.; Hamano, S. Improvement of fertility in repeat breeder dairy cattle by embryo transfer following artificial insemination: Possibility of interferon tau replenishment effect. J. Reprod. Dev. 2019, 65, 223–229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Z.; Li, D.; Tsun, A.; Li, B. FOXP3+ regulatory T cells and their functional regulation. Cell. Mol. Immunol. 2015, 12, 558–565. [Google Scholar] [CrossRef] [PubMed]
- Tsuda, S.; Nakashima, A.; Shima, T.; Saito, S. New paradigm in the role of regulatory T cells during pregnancy. Front. Immunol. 2019, 10, 573. [Google Scholar] [CrossRef] [Green Version]
- Hori, S.; Nomura, T.; Sakaguchi, S. Control of regulatory T cell development by the transcription factor Foxp3. Science 2003, 299, 1057–1061. [Google Scholar] [CrossRef] [Green Version]
- Bennett, C.L.; Christie, J.; Ramsdell, F.; Brunkow, M.E.; Ferguson, P.J.; Whitesell, L.; Kelly, T.E.; Saulsbury, F.T.; Chance, P.F.; Ochs, H.D. The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat. Genet. 2001, 27, 20–21. [Google Scholar] [CrossRef]
- Chen, X.; Gan, T.; Liao, Z.; Chen, S.; Xiao, J. Foxp3 (−/ATT) polymorphism contributes to the susceptibility of preeclampsia. PLoS ONE 2013, 8, e59696. [Google Scholar]
- Arishima, T.; Sasaki, S.; Isobe, T.; Ikebata, Y.; Shimbara, S.; Ikeda, S.; Kawashima, K.; Suzuki, Y.; Watanabe, M.; Sugano, S.; et al. Maternal variant in the upstream of FOXP3 gene on the X chromosome is associated with recurrent infertility in Japanese Black cattle. BMC Genet. 2017, 18, 103. [Google Scholar] [CrossRef] [Green Version]
- Jasper, M.J.; Tremellen, K.P.; Robertson, S.A. Primary unexplained infertility is associated with reduced expression of the T-regulatory cell transcription factor Foxp3 in endometrial tissue. Mol. Hum. Reprod. 2006, 12, 301–308. [Google Scholar] [CrossRef] [Green Version]
- Fan, Q.; Zhang, J.; Cui, Y.; Wang, C.; Xie, Y.; Wang, Q.; Wu, L. The synergic effects of CTLA-4/Foxp3-related genotypes and chromosomal aberrations on the risk of recurrent spontaneous abortion among a Chinese Han population. J. Hum. Genet. 2018, 63, 579–587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mizukami, K.; Chang, H.S.; Yabuki, A.; Kawamichi, T.; Kawahara, N.; Hayashi, D.; Hossain, M.A.; Rahman, M.M.; Uddin, M.M.; Yamato, O. Novel rapid genotyping assays for neuronal ceroid lipofuscinosis in Border Collie dogs and high frequency of the mutant allele in Japan. J. Vet. Diagn. Investig. 2011, 23, 1131–1139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Islam, M.S.; Shinya, U.; Takagi, M.; Akahoshi, T.; Yabuki, A.; Pervin, S.; Rakib, T.M.; Rahman, M.M.; Tacharina, M.R.; Yamato, O. Carrier rate of the c.235G > C mutation in the bovine isoleucyl-tRNA synthetase (IARS) gene of Japanese Black cows at Kagoshima prefecture, Japan, and analysis of the metabolic profiling and reproductive performance of heterozygous cows. J. Vet. Med. Sci. 2021, 83, 254–259. [Google Scholar] [CrossRef] [PubMed]
- Kushida, K.; Giger, U.; Tsutsui, T.; Inaba, M.; Konno, Y.; Hayashi, K.; Noguchi, K.; Yabuki, A.; Mizukami, K.; Kohyama, M.; et al. Real-time PCR genotyping assay for feline erythrocyte pyruvate kinase deficiency and mutant allele frequency in purebred cats in Japan. J. Vet. Med. Sci. 2015, 77, 743–746. [Google Scholar] [CrossRef] [Green Version]
- Watanabe, U.; Takagi, M.; Yamato, O.; Otoi, T.; Okamoto, K. Retrospective surveillance of metabolic parameters affecting reproductive performance of Japanese black breeding cows. J. Vet. Sci. 2014, 15, 283–288. [Google Scholar] [CrossRef] [Green Version]
- Watanabe, U.; Takagi, M.; Yamato, O.; Otoi, T.; Tshering, C.; Okamoto, K. Metabolic profile of Japanese Black breeding cattle herds: Usefulness in selection for nutrient supplementation to enhance reproductive performance and regional differences. J. Vet. Med. Sci. 2013, 75, 481–487. [Google Scholar] [CrossRef] [Green Version]
- Kishida, K.; Sakase, M.; Minami, K.; Arai, M.M.; Syoji, R.; Kohama, N.; Akiyama, T.; Oka, A.; Harayama, H.; Fukushima, M. Effects of acrosomal conditions of frozen-thawed spermatozoa on the results of artificial insemination in Japanese Black cattle. J. Reprod. Dev. 2015, 61, 519–524. [Google Scholar] [CrossRef] [Green Version]
- Katagiri, S.; Moriyoshi, M.; Takahashi, Y. Low incidence of an altered endometrial epidermal growth factor (EGF) profile in repeat breeder Holstein heifers and differential effect of parity on the EGF profile between fertile Holstein (dairy) and Japanese Black (beef) cattle. J. Reprod. Dev. 2013, 59, 575–579. [Google Scholar] [CrossRef] [Green Version]
- Yi, J.; Yum, S.Y.; Kim, D.; Han, S.; Ha, J.; Kim, J.; Jung, D.; Jang, G.; Lee, W.; Moon, J. Differences in hormone levels around parturition in Hanwoo cattle (Bos taurus coreanae) following artificial insemination and embryo transfer. Vet. Med. Sci. 2022. [Google Scholar] [CrossRef]
- Rhee, M.S.; Kim, B.C. Effect of low voltage electrical stimulation and temperature conditioning on postmortem changes in glycolysis and calpains activities of Korean native cattle (Hanwoo). Meat Sci. 2001, 58, 231–237. [Google Scholar] [CrossRef]
- Hur, S.J.; Park, G.B.; Joo, S.T. A Comparison of the meat qualities from the Hanwoo (Korean native cattle) and Holstein steer. Food Bioprocess Technol. 2008, 1, 196–200. [Google Scholar] [CrossRef]
- Riszqina, M.; Isbandi, M.; Rianto, E.; Santoso, S. Income of Madura cattle farmers in Madura island of east Java province of Indonesia. Bangl. J. Anim. Sci. 2014, 43, 68–73. [Google Scholar] [CrossRef] [Green Version]
- Popescu, C.P.; Smith, W.G. A Cytogenetic investigation of Madura cattle. Reprod. Domest. Anim. 1988, 23, 145–148. [Google Scholar] [CrossRef]
- Nurgiartiningsih, V.M.A.; Budiarto, A.; Kusmartono, K.; Suyadi, S. Evaluation of performance in female Madura cattle in Madura Island, Indonesia. Anim. Prod. 2016, 18, 125–130. [Google Scholar] [CrossRef] [Green Version]
Primer/Probe | Sequence 5′ to 3′ (mer) | Reporter (5′) | Quencher (3′) | Tm (°C) | Concentration (nM) |
---|---|---|---|---|---|
RT-PCR: | |||||
Forward primer | CCATGTGGCTTCTGAGAAATAGTCA (25) | NA | NA | 67.1 | 450 |
Reverse primer | TACCTGGAGGGCCAGACT (18) | NA | NA | 62.3 | 450 |
Probe for the A allele | TCTTCCTGCATTGTCTG (17) | VIC | NFQ | 50.0 | 100 |
Probe for the G allele | TCTTCCTGCACTGTCTG (17) | FAM | NFQ | 52.0 | 100 |
Sanger sequencing: | |||||
Forward primer | AGGGCTCAGATGCAGAC (17) | NA | NA | 54.0 | NA |
Reverse primer | GGATATGGTCTGTCTGGT (17) | NA | NA | 54.3 | NA |
Cattle Breed | Number of Examined Cows | Number of A/A Allele (%) | Number of A/G Allele (%) | Number of G/G Allele (%) | G Allele Frequency |
---|---|---|---|---|---|
Japanese Black | 581 | 333 (57.3) | 205 (35.3) | 43 (7.4) | 0.250 * |
Holstein Friesian | 73 | 24 (32.9) | 30 (41.1) | 19 (26.0) | 0.466 * |
Korean Hanwoo | 125 | 98 (78.4) | 26 (20.8) | 1 (0.8) | 0.112 * |
Indonesian Madura | 30 | 3 (10.0) | 12 (40. 0) | 15 (50. 0) | 0.700 * |
Total | 809 | 458 (56.6) | 273 (33.7) | 78 (9.6) | 0.265 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, M.S.; Takagi, M.; Lee, K.-W.; Chang, H.-S.; Okawa, H.; Yunus, M.; Lestari, T.D.; Tacharina, M.R.; Pervin, S.; Rakib, T.M.; et al. Frequency of an X-Linked Maternal Variant of the Bovine FOXP3 Gene Associated with Infertility in Different Cattle Breeds: A Pilot Study. Animals 2022, 12, 1044. https://doi.org/10.3390/ani12081044
Islam MS, Takagi M, Lee K-W, Chang H-S, Okawa H, Yunus M, Lestari TD, Tacharina MR, Pervin S, Rakib TM, et al. Frequency of an X-Linked Maternal Variant of the Bovine FOXP3 Gene Associated with Infertility in Different Cattle Breeds: A Pilot Study. Animals. 2022; 12(8):1044. https://doi.org/10.3390/ani12081044
Chicago/Turabian StyleIslam, Md Shafiqul, Mitsuhiro Takagi, Keun-Woo Lee, Hye-Sook Chang, Hiroaki Okawa, Muchammad Yunus, Tita Damayanti Lestari, Martia Rani Tacharina, Shahnaj Pervin, Tofazzal Md Rakib, and et al. 2022. "Frequency of an X-Linked Maternal Variant of the Bovine FOXP3 Gene Associated with Infertility in Different Cattle Breeds: A Pilot Study" Animals 12, no. 8: 1044. https://doi.org/10.3390/ani12081044