Effects of Glucose Levels on Inflammation and Amino Acid Utilization in Lipopolysaccharide-Induced Bovine Mammary Epithelial Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design and Treatment
2.2. qRT-PCR
2.3. Chromatographic Conditions
2.4. Statistical Analysis
3. Results
3.1. Effects of LPS and Glucose on Inflammation Regulation and Inflammatory Cytokine Gene Expression of BMECs
3.2. Effects of LPS and Glucose on Glucose Metabolism of BMECs
3.3. Effects of LPS and Glucose on Amino Acid Utilization of BMECs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lahouassa, H.; Moussay, E.; Rainard, P.; Riollet, C. Differential cytokine and chemokine responses of bovine mammary epithelial cells to Staphylococcus aureus and Escherichia coli. Cytokine 2007, 38, 12–21. [Google Scholar] [CrossRef]
- Borges, Á.M.; Healey, G.D.; Sheldon, I.M. Explants of Intact Endometrium to Model Bovine Innate Immunity and Inflammation Ex Vivo. Am. J. Reprod. Immunol. 2012, 67, 526–539. [Google Scholar] [CrossRef]
- Cronin, J.G.; Turner, M.L.; Goetze, L.; Bryant, C.E.; Sheldon, I.M. Toll-Like Receptor 4 and MYD88-Dependent Signaling Mechanisms of the Innate Immune System Are Essential for the Response to Lipopolysaccharide by Epithelial and Stromal Cells of the Bovine Endometrium1. Biol. Reprod. 2012, 86, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Grommers, F.J.; Van De Geer, D.; Van Der Vliet, H.; Henricks, P.A.J.; Nijkamp, F.P. Polymorphonuclear leucocyte function: Relationship between induced migration into the bovine mammary gland and in vitro cell activity. Vet. Immunol. Immunopathol. 1989, 23, 75–83. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Zhou, E.; Liu, Z.; Li, F.; Liang, D.; Liu, B.; Song, X.; Zhao, F.; Fen, X.; Li, D.; et al. Staphylococcus aureus and Escherichia coli elicit different innate immune responses from bovine mammary epithelial cells. Vet. Immunol. Immunopathol. 2013, 155, 245–252. [Google Scholar] [CrossRef]
- Zheng, L.; Xu, Y.; Lu, J.; Liu, M.; Dai, B.; Miao, J.; Yin, Y. Variant innate immune responses of mammary epithelial cells to challenge by Staphylococcus aureus, Escherichia coli and the regulating effect of taurine on these bioprocesses. Free Radic. Biol. Med. 2016, 96, 166–180. [Google Scholar] [CrossRef]
- Wolowczuk, I.; Verwaerde, C.; Viltart, O.; Delanoye, A.; Delacre, M.; Pot, B.; Grangette, C. Feeding Our Immune System: Impact on Metabolism. Clin. Dev. Immunol. 2008, 2008, 639803. [Google Scholar] [CrossRef] [PubMed]
- Yang, T.; Datsomor, O.; Jiang, M.; Ma, X.; Zhao, G.; Zhan, K. Protective Roles of Sodium Butyrate in Lipopolysaccharide-Induced Bovine Ruminal Epithelial Cells by Activating G Protein-Coupled Receptors 41. Front. Nutr. 2022, 9, 842634. [Google Scholar] [CrossRef] [PubMed]
- Kominsky, D.J.; Campbell, E.L.; Colgan, S.P. Metabolic Shifts in Immunity and Inflammation. J. Immunol. 2010, 184, 4062–4068. [Google Scholar] [CrossRef]
- Kvidera, S.K.; Horst, E.A.; Abuajamieh, M.; Mayorga, E.J.; Fernandez, M.V.S.; Baumgard, L.H. Glucose requirements of an activated immune system in lactating Holstein cows. J. Dairy Sci. 2017, 100, 2360–2374. [Google Scholar] [CrossRef] [PubMed]
- Waldron, M.R.; Kulick, A.E.; Bell, A.W.; Overton, T.R. Acute Experimental Mastitis Is Not Causal Toward the Development of Energy-Related Metabolic Disorders in Early Postpartum Dairy Cows. J. Dairy Sci. 2006, 89, 596–610. [Google Scholar] [CrossRef] [PubMed]
- Hartl, W.H.; Jauch, K.W. Metabolic self-destruction in critically ill patients: Origins, mechanisms and therapeutic principles. Nutrition 2014, 30, 261–267. [Google Scholar] [CrossRef] [PubMed]
- Maitra, S.R.; Wojnar, M.M.; Lang, C.H. Alterations in tissue glucose uptake during the hyperglycemic and hypoglycemic phases of sepsis. Shock 2000, 13, 379–385. [Google Scholar] [CrossRef] [PubMed]
- Lunt, S.Y.; Vander Heiden, M.G. Aerobic Glycolysis: Meeting the Metabolic Requirements of Cell Proliferation. Annu. Rev. Cell Dev. Biol. 2011, 27, 441–464. [Google Scholar] [CrossRef] [PubMed]
- Newsholme, E.; Dimitriadis, G. Integration of biochemical and physiologic effects of insulin on glucose metabolism. Exp. Clin. Endocrinol. Diabetes 2001, 109, S122–S134. [Google Scholar] [CrossRef]
- Zhang, L.S.; Davies, S.S. Microbial metabolism of dietary components to bioactive metabolites: Opportunities for new therapeutic interventions. Genome Med. 2016, 8, 46. [Google Scholar] [CrossRef]
- Bradford, H.F.; Ward, H.K.; Thomas, A.J. Glutamine? A major substrate for never endings. J. Neurochem. 1978, 30, 1453–1459. [Google Scholar] [CrossRef] [PubMed]
- Tildon, J.T.; Roeder, L.M. Transport of 3-hydroxy[3-14C]butyrate by dissociated cells from rat brain. Am. J. Physiol.-Cell Physiol. 1988, 255, C133–C139. [Google Scholar] [CrossRef]
- Hassel, B.; Bachelard, H.; Jones, P.; Fonnum, F.; Sonnewald, U. Trafficking of Amino Acids between Neurons and Glia In Vivo. Effects of Inhibition of Glial Metabolism by Fluoroacetate. J. Cereb. Blood Flow Metab. 1997, 17, 1230–1238. [Google Scholar] [CrossRef] [PubMed]
- Zielke, H.R.; Collins, R.M.; Baab, P.J.; Huang, Y.; Zielke, C.L.; Tildon, J.T. Compartmentation of [14C]Glutamate and [14C]Glutamine Oxidative Metabolism in the Rat Hippocampus as Determined by Microdialysis. J. Neurochem. 2002, 71, 1315–1320. [Google Scholar] [CrossRef] [PubMed]
- Plaitakis, A.; Shashidharan, P. Glutamate transport and metabolism in dopaminergic neurons of substantia nigra: Implications for the pathogenesis of Parkinson’s disease. J. Neurol. 2000, 247, II25–II35. [Google Scholar] [CrossRef] [PubMed]
- Cooper, A.J.; Plum, F. Biochemistry and physiology of brain ammonia. Physiol. Rev. 1987, 67, 440–519. [Google Scholar] [CrossRef]
- McNeil, C.J.; Hoskin, S.O.; Bremner, D.M.; Holtrop, G.; Lobley, G.E. Whole-body and splanchnic amino acid metabolism in sheep during an acute endotoxin challenge. Br. J. Nutr. 2016, 116, 211–222. [Google Scholar] [CrossRef] [PubMed]
- Lochmiller, R.L.; Deerenberg, C. Trade-offs in evolutionary immunology: Just what is the cost of immunity? Oikos 2000, 88, 87–98. [Google Scholar] [CrossRef]
- Johnson, R.W. Fueling the immune response: What’s the cost? In Feed Efficiency in Swine; Springer: Berlin/Heidelberg, Germany, 2012; pp. 211–223. ISBN 978-90-8686-756-1. [Google Scholar]
- Meng, M.; Huo, R.; Wang, Y.; Ma, N.; Shi, X.; Shen, X.; Chang, G. Lentinan inhibits oxidative stress and alleviates LPS-induced inflammation and apoptosis of BMECs by activating the Nrf2 signaling pathway. Int. J. Biol. Macromol. 2022, 222, 2375–2391. [Google Scholar] [CrossRef]
- Huang, Y.; Shen, L.; Jiang, J.; Xu, Q.; Luo, Z.; Luo, Q.; Yu, S.; Yao, X.; Ren, Z.; Hu, Y.; et al. Metabolomic Profiles of Bovine Mammary Epithelial Cells Stimulated by Lipopolysaccharide. Sci. Rep. 2019, 9, 19131. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.P.; Yang, J.; Jiao, P.; Ren, Q.Q.; Luoreng, Z.M.; Wang, X.P.; Ma, Y.; Wei, D.W. Differential expression of circRNAs related to lipopolysaccharide-induced inflammation in bovine mammary epithelial cells. Res. Vet. Sci. 2022, 146, 24–27. [Google Scholar] [CrossRef]
- Zhan, K.; Yang, T.; Feng, B.; Zhu, X.; Chen, Y.; Huo, Y.; Zhao, G. The protective roles of tea tree oil extracts in bovine mammary epithelial cells and polymorphonuclear leukocytes. J. Anim. Sci. Biotechnol. 2020, 11, 62. [Google Scholar] [CrossRef]
- Zhang, M.C.; Zhao, S.G.; Wang, S.S.; Luo, C.C.; Gao, H.N.; Zheng, N.; Wang, J.Q. d-Glucose and amino acid deficiency inhibits casein synthesis through JAK2/STAT5 and AMPK/mTOR signaling pathways in mammary epithelial cells of dairy cows. J. Dairy Sci. 2018, 101, 1737–1746. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, J.A.; Kafatos, F.C.; Janeway, C.A.; Ezekowitz, R.A.B. Phylogenetic Perspectives in Innate Immunity. Science 1999, 284, 1313–1318. [Google Scholar] [CrossRef] [PubMed]
- Bannerman, D.D.; Paape, M.J.; Lee, J.W.; Zhao, X.; Hope, J.C.; Rainard, P. Escherichia coli and Staphylococcus aureus Elicit Differential Innate Immune Responses following Intramammary Infection. Clin. Vaccine Immunol. 2004, 11, 463–472. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, C.A.; Rietschel, E.T.; Wagner, H. Cytokines as Mediators in the Pathogenesis of Septic Shock. In Pathology of Septic Shock; Springer: Berlin/Heidelberg, Germany, 1996; Volume 216, pp. 133–165. ISBN 978-3-642-80188-4. [Google Scholar]
- Suffredini, A.F.; Fantuzzi, G.; Badolato, R.; Oppenheim, J.J.; O’Grady, N.P. New insights into the biology of the acute phase response. J. Clin. Immunol. 1999, 19, 203–214. [Google Scholar] [CrossRef]
- Dienz, O.; Rud, J.G.; Eaton, S.M.; Lanthier, P.A.; Burg, E.; Drew, A.; Bunn, J.; Suratt, B.T.; Haynes, L.; Rincon, M. Essential role of IL-6 in protection against H1N1 influenza virus by promoting neutrophil survival in the lung. Mucosal Immunol. 2012, 5, 258–266. [Google Scholar] [CrossRef] [PubMed]
- Van Der Poll, T.; Lowry, S.F. Tumor necrosis factor in sepsis: Mediator of multiple organ failure or essential part of host defense? Shock 1995, 3, 1–12. [Google Scholar] [CrossRef]
- Kan, X.; Liu, J.; Chen, Y.; Guo, W.; Xu, D.; Cheng, J.; Cao, Y.; Yang, Z.; Fu, S. Protective effect of myricetin on LPS-induced mastitis in mice through ERK1/2 and p38 protein author. Naunyn. Schmiedebergs Arch. Pharmacol. 2021, 394, 1727–1735. [Google Scholar] [CrossRef] [PubMed]
- Che, H.Y.; Zhou, C.H.; Lyu, C.C.; Meng, Y.; He, Y.T.; Wang, H.Q.; Wu, H.Y.; Zhang, J.B.; Yuan, B. Allicin Alleviated LPS-Induced Mastitis via the TLR4/NF-κB Signaling Pathway in Bovine Mammary Epithelial Cells. Int. J. Mol. Sci. 2023, 24, 3805. [Google Scholar] [CrossRef]
- Wang, W.; Hu, X.; Shen, P.; Zhang, N.; Fu, Y. Sodium houttuyfonate inhibits LPS-induced inflammatory response via suppressing TLR4/NF-ĸB signaling pathway in bovine mammary epithelial cells. Microb. Pathog. 2017, 107, 12–16. [Google Scholar] [CrossRef]
- Dong, Y.; An, D.; Wang, J.; Liu, H.; Zhang, Q.; Zhao, J.; Lu, W. Effect of DNA Methylation on LPS-Induced Expression of Tumour Necrosis Factor Alpha (TNF-α) in Bovine Mammary Epithelial Cells. Indian J. Anim. Res. 2021, 55, 1079–1084. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Song, J.T.; Li, W.; Zhuang, Y.L.; Li, C.Z.; Song, W.H. Effects of Glucose on Expression of Inflammation Related Genes in Dairy Cow Mammary Epithelial Cells Stimulated by Lipopolysaccharide. Chin. J. Anim. Nutr. 2022, 34, 7350–7360. [Google Scholar] [CrossRef]
- Zarrin, M.; Wellnitz, O.; Van Dorland, H.A.; Gross, J.J.; Bruckmaier, R.M. Hyperketonemia during lipopolysaccharide-induced mastitis affects systemic and local intramammary metabolism in dairy cows. J. Dairy Sci. 2014, 97, 3531–3541. [Google Scholar] [CrossRef]
- Pires, J.A.A.; Pawlowski, K.; Rouel, J.; Delavaud, C.; Foucras, G.; Germon, P.; Leroux, C. Undernutrition modified metabolic responses to intramammary lipopolysaccharide but had limited effects on selected inflammation indicators in early-lactation cows. J. Dairy Sci. 2019, 102, 5347–5360. [Google Scholar] [CrossRef] [PubMed]
- Enger, B.D. Invited Review: Reevaluating how mastitis reduces milk yield: Discussion of competitive substrate utilization. Appl. Anim. Sci. 2019, 35, 408–415. [Google Scholar] [CrossRef]
- Bickerstaffe, R.; Annison, E.F.; Linzell, J.L. The metabolism of glucose, acetate, lipids and amino acids in lactating dairy cows. J. Agric. Sci. 1974, 82, 71–85. [Google Scholar] [CrossRef]
- Drackley, J.K.; Dann, H.M.; Douglas, N.; Guretzky, N.A.J.; Litherland, N.B.; Underwood, J.P.; Loor, J.J. Physiological and pathological adaptations in dairy cows that may increase susceptibility to periparturient diseases and disorders. Ital. J. Anim. Sci. 2005, 4, 323–344. [Google Scholar] [CrossRef]
- Gross, J.; Van Dorland, H.A.; Schwarz, F.J.; Bruckmaier, R.M. Endocrine changes and liver mRNA abundance of somatotropic axis and insulin system constituents during negative energy balance at different stages of lactation in dairy cows. J. Dairy Sci. 2011, 94, 3484–3494. [Google Scholar] [CrossRef] [PubMed]
- Suriyasathaporn, W.; Heuer, C.; Noordhuizen-Stassen, E.N.; Schukken, Y.H. Hyperketonemia and the impairment of udder defense: A review. Vet. Res. 2000, 31, 397–412. [Google Scholar] [CrossRef]
- Van Dorland, H.A.; Richter, S.; Morel, I.; Doherr, M.G.; Castro, N.; Bruckmaier, R.M. Variation in hepatic regulation of metabolism during the dry period and in early lactation in dairy cows. J. Dairy Sci. 2009, 92, 1924–1940. [Google Scholar] [CrossRef]
- Ingvartsen, K.L. Feeding- and management-related diseases in the transition cow. Anim. Feed Sci. Technol. 2006, 126, 175–213. [Google Scholar] [CrossRef]
- Pyrl, S. Mastitis in Post-Partum Dairy Cows. Reprod. Domest. Anim. 2008, 43, 252–259. [Google Scholar] [CrossRef]
- Shuster, D.E.; Lee, E.K.; Kehrli, M.E. Bacterial growth, inflammatory cytokine production, and neutrophil recruitment during coliform mastitis in cows within ten days after calving, compared with cows at midlactation. Am. J. Vet. Res. 1996, 57, 1569–1575. [Google Scholar] [PubMed]
- Gong, X.X.; Su, X.S.; Zhan, K.; Zhao, G.Q. The protective effect of chlorogenic acid on bovine mammary epithelial cells and neutrophil function. J. Dairy Sci. 2018, 101, 10089–10097. [Google Scholar] [CrossRef] [PubMed]
- Li, X.P.; Tan, Z.L.; Jiao, J.Z.; Long, D.L.; Zhou, C.S.; Yi, K.L.; Liu, C.H.; Kang, J.H.; Wang, M.; Duan, F.H.; et al. Supplementation with fat-coated rumen-protected glucose during the transition period enhances milk production and influences blood biochemical parameters of liver function and inflammation in dairy cows. Anim. Feed Sci. Technol. 2019, 252, 92–102. [Google Scholar] [CrossRef]
- Burvenich, C.; Bannerman, D.D.; Lippolis, J.D.; Peelman, L.; Nonnecke, B.J.; Kehrli, M.E.; Paape, M.J. Cumulative Physiological Events Influence the Inflammatory Response of the Bovine Udder to Escherichia coli Infections During the Transition Period. J. Dairy Sci. 2007, 90, E39–E54. [Google Scholar] [CrossRef]
- Paape, M.J.; Bannerman, D.D.; Zhao, X.; Lee, J.W. The bovine neutrophil: Structure and function in blood and milk. Vet. Res. 2003, 34, 597–627. [Google Scholar] [CrossRef]
- Ebner, K.E.; Schanbacher, F.L. Biochemistry of Lactose and Related Carbohydrates. In Biosynthesis and Secretion of Milk/Diseases; Academic Press: Cambridge, MA, USA, 1974; pp. 77–113. ISBN 978-0-12-436702-9. [Google Scholar]
- Cant, J.P.; Trout, D.R.; Qiao, F.; Purdie, N.G. Milk Synthetic Response of the Bovine Mammary Gland to an Increase in the Local Concentration of Arterial Glucose. J. Dairy Sci. 2002, 85, 494–503. [Google Scholar] [CrossRef]
- Zhao, K.; Liu, H.Y.; Wang, H.F.; Zhou, M.M.; Liu, J.X. Effect of glucose availability on glucose transport in bovine mammary epithelial cells. Animal 2012, 6, 488–493. [Google Scholar] [CrossRef] [PubMed]
- Kent-Dennis, C.; Aschenbach, J.R.; Griebel, P.J.; Penner, G.B. Effects of lipopolysaccharide exposure in primary bovine ruminal epithelial cells. J. Dairy Sci. 2020, 103, 9587–9603. [Google Scholar] [CrossRef]
- Zhao, F.Q.; Dixon, W.T.; Kennelly, J.J. Localization and gene expression of glucose transporters in bovine mammary gland. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 1996, 115, 127–134. [Google Scholar] [CrossRef]
- Zhao, F.Q.; Miller, P.J.; Wall, E.H.; Zheng, Y.C.; Dong, B.; Neville, M.C.; McFadden, T.B. Bovine glucose transporter GLUT8: Cloning, expression, and developmental regulation in mammary gland. Biochim. Biophys. Acta BBA-Gene Struct. Expr. 2004, 1680, 103–113. [Google Scholar] [CrossRef]
- Lin, Y.; Sun, X.; Hou, X.; Qu, B.; Gao, X.; Li, Q. Effects of glucose on lactose synthesis in mammary epithelial cells from dairy cow. BMC Vet. Res. 2016, 12, 81. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Zi, Z.; Lee, E.E.; Zhao, J.; Contreras, D.C.; South, A.P.; Abel, E.D.; Chong, B.F.; Vandergriff, T.; Hosler, G.A.; et al. Differential glucose requirement in skin homeostasis and injury identifies a therapeutic target for psoriasis. Nat. Med. 2018, 24, 617–627. [Google Scholar] [CrossRef]
- Corcoran, S.E.; O’Neill, L.A.J. HIF1α and metabolic reprogramming in inflammation. J. Clin. Investig. 2016, 126, 3699–3707. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Bories, G.; Lantz, C.; Emmons, R.; Becker, A.; Liu, E.; Abecassis, M.M.; Yvan-Charvet, L.; Thorp, E.B. Immunometabolism of Phagocytes and Relationships to Cardiac Repair. Front. Cardiovasc. Med. 2019, 6, 42. [Google Scholar] [CrossRef]
- Xiao, C.T.; Cant, J.P. Relationship Between Glucose Transport and Metabolism in Isolated Bovine Mammary Epithelial Cells. J. Dairy Sci. 2005, 88, 2794–2805. [Google Scholar] [CrossRef] [PubMed]
- Singh, K.V.; Sharma, D.; Singh, S.K.; Srivastava, M.; Garg, S.K.; Yadav, B.K. Assessment of alteration in metabolic profile and milk composition of buffaloes with subclinical mastitis. BUFFALO Bull. 2017, 36, 349–356. [Google Scholar]
- Li, P.; Yin, Y.L.; Li, D.; Woo Kim, S.; Wu, G. Amino acids and immune function. Br. J. Nutr. 2007, 98, 237–252. [Google Scholar] [CrossRef]
- Holeček, M. Branched-chain amino acids in health and disease: Metabolism, alterations in blood plasma, and as supplements. Nutr. Metab. 2018, 15, 33. [Google Scholar] [CrossRef]
- Wu, S.; Liu, X.; Cheng, L.; Wang, D.; Qin, G.; Zhang, X.; Zhen, Y.; Wang, T.; Sun, Z. Protective Mechanism of Leucine and Isoleucine against H2O2-Induced Oxidative Damage in Bovine Mammary Epithelial Cells. Oxid. Med. Cell. Longev. 2022, 2022, 4013575. [Google Scholar] [CrossRef]
- Kuhla, B.; Nürnberg, G.; Albrecht, D.; Görs, S.; Hammon, H.M.; Metges, C.C. Involvement of skeletal muscle protein, glycogen, and fat metabolism in the adaptation on early lactation of dairy cows. J. Proteome Res. 2011, 10, 4252–4262. [Google Scholar] [CrossRef] [PubMed]
- Leal Yepes, F.A.; Mann, S.; Overton, T.R.; Ryan, C.M.; Bristol, L.S.; Granados, G.E.; Nydam, D.V.; Wakshlag, J.J. Effect of rumen-protected branched-chain amino acid supplementation on production- and energy-related metabolites during the first 35 days in milk in Holstein dairy cows. J. Dairy Sci. 2019, 102, 5657–5672. [Google Scholar] [CrossRef] [PubMed]
- Wu, G. Functional amino acids in nutrition and health. Amino Acids. 2013, 45, 407–411. [Google Scholar] [CrossRef]
- Aschenbach, J.R.; Kristensen, N.B.; Donkin, S.S.; Hammon, H.M.; Penner, G.B. Gluconeogenesis in dairy cows: The secret of making sweet milk from sour dough. IUBMB Life 2010, 62, 869–877. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence, 5′ to 3′ | Accession Number | Size (bp) |
---|---|---|---|
GAPDH | F: GGGTCATCATCTCTGCACCT R: GGTCATAAGTCCCTCCACGA | NM_001034034.2 | 176 |
IL-1β | F: CAGTGCCTACGCACATGTCT R: AGAGGAGGTGGAGAGCCTTC | NM_174093.1 | 209 |
IL-6 | F: CACCCCAGGCAGACTACTTC | NM_173923.2 | 129 |
R: TCCTTGCTGCTTTCACACTC | |||
TNF-α | F: GCCCTCTGGTTCAGACACTC R: AGATGAGGTAAAGCCCGTCA | NM_173966.3 | 192 |
CXCL2 | F: CCCGTGGTCAACGAACTGCGCTGC R: CTAGTTTAGCATCTTATCGATGATT | NM_174299.3 | 204 |
CXCL6 | F: TGAGACTGCTATCCAGCCG R: AGATCACTGACCGTTTTGGG | NM_174300.2 | 193 |
CXCL8 | F: TGGGCCACACTGTGAAAAT R: TCATGGATCTTGCTTCTCAGC | NM_173925.2 | 136 |
CCL5 | F: CTGCCTTCGCTGTCCTCCTGATG R: TTCTCTGGGTTGGCGCACACCTG | NM_175827 | 217 |
GLUT1 | F: CGTGCTCCTGGTTCTGTTCT R: GGAACAGCTCCTCAGGTGTC | NM_001274304.1 | 137 |
GLUT8 | F: AGTGACTGCCCGTCCTTGCT R: TGCTGTCCTGGCTCCTGACT | NM_201528.1 | 133 |
HK1 | F: GTGTGCTGTTGATAATCTCC R: AATAACTGTTGGACGAATGC | NM_001012668.2 | 149 |
HK2 | F: AAGATGCTGCCCACCTACG R: TCGCTTCCCGTTCCGCACA | XM_015473383.2 | 123 |
Treatment 1 | p-Value 2 | |||||||
---|---|---|---|---|---|---|---|---|
Item | LG | LG + LPS | HG | HG + LPS | SEM | A | B | A × B |
Lysine | 0.2938 | 0.3566 | 0.0989 | 0.1184 | 0.034 | 0.077 | <0.001 | 0.318 |
Tryptophan | 0.0312 | 0.0366 | 0.0116 | 0.0153 | 0.003 | 0.025 | <0.001 | 0.633 |
Phenylalanine | 0.1141 | 0.1606 | 0.0599 | 0.0655 | 0.014 | 0.192 | 0.004 | 0.295 |
Leucine | 0.1683 b | 0.2226 a | 0.0999 d | 0.1312 c | 0.015 | <0.001 | <0.001 | 0.034 |
Isoleucine | 0.2620 b | 0.3409 a | 0.1041 c | 0.1162 c | 0.030 | 0.004 | <0.001 | 0.021 |
Methionine | 0.0240 | 0.0276 | 0.0297 | 0.0397 | 0.001 | 0.004 | 0.001 | 0.101 |
Valine | 0.2001 b | 0.2785 a | 0.1081 c | 0.1226 c | 0.023 | 0.004 | <0.001 | 0.024 |
Tyrosine | 0.0589 | 0.0626 | 0.0594 | 0.0657 | 0.002 | 0.453 | 0.782 | 0.842 |
Proline | 0.1033 | 0.1207 | 0.0483 | 0.0516 | 0.009 | 0.136 | <0.001 | 0.292 |
Threonine | 0.2347 | 0.2685 | 0.1427 | 0.1522 | 0.017 | 0.219 | <0.001 | 0.475 |
Arginine | 0.3285 | 0.3367 | 0.1175 | 0.1495 | 0.032 | 0.445 | <0.001 | 0.647 |
Histidine | 0.0960 b | 0.1786 a | 0.0423 c | 0.0467 c | 0.016 | 0.001 | <0.001 | 0.002 |
Glycine | 0.1761 | 0.2067 | 0.0602 | 0.0674 | 0.020 | 0.103 | <0.001 | 0.288 |
Serine | 0.1319 | 0.1427 | 0.0579 | 0.0714 | 0.011 | 0.266 | <0.001 | 0.857 |
Glutamate | 0.0173 | 0.0286 | 0.0120 | 0.0190 | 0.001 | 0.001 | 0.003 | 0.263 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, H.; Lu, Z.; Zhan, K.; Datsomor, O.; Ma, X.; Yang, T.; Chen, Y.; Jiang, M.; Zhao, G. Effects of Glucose Levels on Inflammation and Amino Acid Utilization in Lipopolysaccharide-Induced Bovine Mammary Epithelial Cells. Animals 2023, 13, 3494. https://doi.org/10.3390/ani13223494
Song H, Lu Z, Zhan K, Datsomor O, Ma X, Yang T, Chen Y, Jiang M, Zhao G. Effects of Glucose Levels on Inflammation and Amino Acid Utilization in Lipopolysaccharide-Induced Bovine Mammary Epithelial Cells. Animals. 2023; 13(22):3494. https://doi.org/10.3390/ani13223494
Chicago/Turabian StyleSong, Han, Zhiqi Lu, Kang Zhan, Osmond Datsomor, Xiaoyu Ma, Tianyu Yang, Yuhang Chen, Maocheng Jiang, and Guoqi Zhao. 2023. "Effects of Glucose Levels on Inflammation and Amino Acid Utilization in Lipopolysaccharide-Induced Bovine Mammary Epithelial Cells" Animals 13, no. 22: 3494. https://doi.org/10.3390/ani13223494