Differences in Muscle Lipogenic Gene Expression, Carcass Traits and Fat Deposition among Three Iberian Pig Strains Finished in Two Different Feeding Systems
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Tissue Sampling
2.2. Carcass Traits
2.3. Intramuscular Fat Content Determination
2.4. RNA Extraction, Quality, and Integrity
2.5. RNA Retrotranscription
2.6. Genes Studied in the Expression Analyses
2.7. Statistical Analysis
3. Results
3.1. Carcass Traits
3.2. Fat Deposition
3.3. Fatty Acid Composition
3.4. Gene Expression
4. Discussion
4.1. Fat Deposition and Muscle Accretion
4.2. Fatty acid Profiles
4.3. Gene Expression
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Serra, X.; Gil, F.; Pérez-Enciso, M.; Oliver, M.A.; Vázquez, J.M.; Gispert, M.; Díaz, I.; Moreno, F.; Latorre, R.; Noguera, J.L. A Comparison of Carcass, Meat Quality and Histochemical Characteristics of Iberian (Guadyerbas Line) and Landrace Pigs. Livest. Prod. Sci. 1998, 56, 215–223. [Google Scholar] [CrossRef]
- García-Gudiño, J.; Blanco-Penedo, I.; Gispert, M.; Brun, A.; Perea, J.; Font-i-Furnols, M. Understanding Consumers’ Perceptions towards Iberian Pig Production and Animal Welfare. Meat Sci. 2021, 172, 108317. [Google Scholar] [CrossRef] [PubMed]
- Ruiz Carrascal, J.; Lopez-Bote, C. Improvement of Dry-Cured Ham Quality by Lipid Modification through Dietary Means. In Research Advances in the Quality of Meat and Meat Products; Research Signpost: New York, NY, USA, 2002; pp. 255–271. [Google Scholar]
- Rey, A.I.; Daza, A.; López-Carrasco, C.; López-Bote, C.J. Feeding Iberian Pigs with Acorns and Grass in Either Free-Range or Confinement Affects the Carcass Characteristics and Fatty Acids and Tocopherols Accumulation in Longissimus dorsi Muscle and Backfat. Meat Sci. 2006, 73, 66–74. [Google Scholar] [CrossRef] [PubMed]
- Ministerio de Agricultura, Alimentación y Medio Ambiente. Real Decreto 4/2014; Ministerio de Agricultura, Alimentación y Medio Ambiente: Madrid, Spain, 2014; Volume 10, pp. 1569–1585.
- García-Gudiño, J.; Blanco-Penedo, I.; Font-I-furnols, M.; Angón, E.; Perea, J.M. Analysis of the Sustainability of Fattening Systems for Iberian Traditional Pig Production through a Technical and Environmental Approach. Animals 2021, 11, 411. [Google Scholar] [CrossRef]
- Cantos, E.; Espín, J.C.; López-Bote, C.; de la Hoz, L.; Ordóñez, J.A.; Tomás-Barberán, F.A. Phenolic Compounds and Fatty Acids from Acorns (Quercus Spp.), the Main Dietary Constituent of Free-Ranged Iberian Pigs. J. Agric. Food Chem. 2003, 51, 6248–6255. [Google Scholar] [CrossRef]
- Tejerina, D.; García-Torres, S.; Cabeza De Vaca, M.; Vázquez, F.M.; Cava, R. Effect of Production System on Physical-Chemical, Antioxidant and Fatty Acids Composition of Longissimus dorsi and Serratus ventralis Muscles from Iberian Pig. Food Chem. 2012, 133, 293–299. [Google Scholar] [CrossRef]
- Juárez, M.; Clemente, I.; Polvillo, O.; Molina, A. Meat Quality of Tenderloin from Iberian Pigs as Affected by Breed Strain and Crossbreeding. Meat Sci. 2009, 81, 573–579. [Google Scholar] [CrossRef]
- Benito, J.; Vázquez, C.; Menaya, C.; Ferrera, J.L.; García Casco, J.M.; Silió, L.; Rodrigáñez, J.; Rodríguez, M.C. Evaluation of the Productive Parameters in Different Strains of Iberian Pig. In Tradition and Innovation in Mediterranean Pig Production, Proceedings of the 4th International Symposium on Mediterranean Pig, Evora, Portugal, 26–28 November 1998; Afonso de Almeida, J.A., Tirapicos Nunes, J., Eds.; CIHEAMICAM-UE: Zaragoza, Spain, 2000; pp. 113–121. [Google Scholar]
- Ibáñez-Escriche, N.; Varona, L.; Magallón, E.; Noguera, J.L. Crossbreeding Effects on Pig Growth and Carcass Traits from Two Iberian Strains. Animal 2014, 8, 1569–1576. [Google Scholar] [CrossRef]
- González, E.; Carrapiso, A.I.; Noguera, J.L.; Ibáñez-Escriche, N.; Tejeda, J.F. Effect of Genetic and Diet on Iberian Pig Fresh Loin (M. Longissimus dorsi). Arch. Zootec. 2018, 67, 185–187. [Google Scholar] [CrossRef] [Green Version]
- Muriel, E.; Ruiz, J.; Ventanas, J.; Petrón, M.J.; Antequera, T. Meat Quality Characteristics in Different Lines of Iberian Pigs. Meat Sci. 2004, 67, 299–307. [Google Scholar] [CrossRef]
- Clemente, I.; Membrillo, A.; Azor, P.J.; Polvillo, O.; Juárez, M.; Santos, E.; Jiménez, A.M.; Diéguez, E.; Molina, A. Caracterización de La Diversidad Genética Intrarracial Del Cerdo Ibérico. ITEA Inf. Tec. Econ. Agrar. 2008, 104, 314–322. [Google Scholar]
- Astiz, C.S.; Alfranca, I.S. Razas Porcinas En Peligro Mejoradoras de La Calidad de La Carne: El Negro Lampiño. Arch. Zootec. 1998, 47, 417–424. [Google Scholar]
- Izquierdo, M.; Hernández-García, F.I.; Lopez-Parra, M.; Del Rosario, A.I.; Montero, A.; Pérez, M.A.; García-Gudiño, J.; García-Rubio, L.; Garrido, N. Carcass and Meat Traits of Different Iberian Pig Genotypes Fed in a Traditional Extensive System. Arch. Zootec. 2018, 67, 201–204. [Google Scholar] [CrossRef] [Green Version]
- Tejeda, J.F.; Gandemer, G.; Antequera, T.; Viau, M.; García, C. Lipid Traits of Muscles as Related to Genotype and Fattening Diet in Iberian Pigs: Total Intramuscular Lipids and Triacylglycerols. Meat Sci. 2002, 60, 357–363. [Google Scholar] [CrossRef]
- Cava, R.; Ruiz, J.; López-Bote, C.; Martín, L.; García, C.; Ventanas, J.; Antequera, T. Influence of Finishing Diet on Fatty Acid Profiles of Intramuscular Lipids, Triglycerides and Phospholipids in Muscles of the Iberian Pig. Meat Sci. 1997, 45, 263–270. [Google Scholar] [CrossRef]
- Ovilo, C.; Benitez, R.; Fernandez, A.; Isabel, B.; Nunez, Y.; Fernandez, A.I.; Rodríguez, C.; Daza, A.; Silió, L.; López-Bote, C. Dietary Energy Source Largely Affects Tissue Fatty Acid Composition but Has Minor Influence on Gene Transcription in Iberian Pigs. J. Anim. Sci. 2014, 92, 939–954. [Google Scholar] [CrossRef] [Green Version]
- Lopez-Bote, C.J. Sustained Utilization of the Iberian Pig Breed. Meat Sci. 1998, 49, S17–S27. [Google Scholar] [CrossRef]
- Daza, A.; Mateos, A.; Rey, A.I.; Ovejero, I.; López-Bote, C.J. Effect of Duration of Feeding under Free-Range Conditions on Production Results and Carcass and Fat Quality in Iberian Pigs. Meat Sci. 2007, 76, 411–416. [Google Scholar] [CrossRef]
- Benítez, R.; Fernández, A.; Isabel, B.; Núñez, Y.; De Mercado, E.; Gómez-Izquierdo, E.; García-Casco, J.; López-Bote, C.; Óvilo, C. Modulatory Effects of Breed, Feeding Status, and Diet on Adipogenic, Lipogenic, and Lipolytic Gene Expression in Growing Iberian and Duroc Pigs. Int. J. Mol. Sci. 2018, 19, 22. [Google Scholar] [CrossRef] [Green Version]
- Óvilo, C.; Benítez, R.; Fernández, A.; Núñez, Y.; Ayuso, M.; Fernández, A.I.; Rodríguez, C.; Isabel, B.; Rey, A.I.; López-Bote, C.; et al. Longissimus dorsi Transcriptome Analysis of Purebred and Crossbred Iberian Pigs Differing in Muscle Characteristics. BMC Genom. 2014, 15, 413. [Google Scholar] [CrossRef] [Green Version]
- Villaplana-Velasco, A.; Noguera, J.L.; Pena, R.N.; Ballester, M.; Muñoz, L.; González, E.; Tejeda, J.F.; Ibáñez-Escriche, N. Comparative Transcriptome Profile between Iberian Pig Varieties Provides New Insights into Their Distinct Fat Deposition and Fatty Acids Content. Animals 2021, 11, 627. [Google Scholar] [CrossRef] [PubMed]
- Folch, J.; Lees, M.; Sloane, S.G.H.; Folch, J.; Lees, M.; Sloane-Stanley, G. A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497. [Google Scholar] [CrossRef] [PubMed]
- García-Regueiro, J.A.; Rius, M.A.; Díaz, I. Evaluation of Boar Taint Compounds in Vapour Phase by Head Space Techniques Coupled to Capillary GC–MS. In Proceedings of the Meeting of the EAAP Working Group. Production and Utilisation of Meat from Entire Male Pigs, Milton Keynes, UK, 27–29 September 1995. [Google Scholar]
- Flowers, M.T.; Ntambi, J.M. Role of Stearoyl-Coenzyme A Desaturase in Regulating Lipid Metabolism. Curr. Opin. Lipidol. 2008, 19, 248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vidal, O.; Varona, L.; Oliver, M.A.; Noguera, J.L.; Sànchez, A.; Amills, M. Malic Enzyme 1 Genotype Is Associated with Backfat Thickness and Meat Quality Traits in Pigs. Anim. Genet. 2006, 37, 28–32. [Google Scholar] [CrossRef]
- Stachowiak, M.; Nowacka-Woszuk, J.; Szydlowski, M.; Switonski, M. The ACACA and SREBF1 Genes Are Promising Markers for Pig Carcass and Performance Traits, but Not for Fatty Acid Content in the Longissimus dorsi Muscle and Adipose Tissue. Meat Sci. 2013, 95, 64–71. [Google Scholar] [CrossRef]
- Grzes, M.; Sadkowski, S.; Rzewuska, K.; Szydlowski, M.; Switonski, M. Pig Fatness in Relation to FASN and INSIG2 Genes Polymorphism and Their Transcript Level. Mol. Biol. Rep. 2016, 43, 381–389. [Google Scholar] [CrossRef] [Green Version]
- Muñoz, M.; García-Casco, J.M.; Caraballo, C.; Fernández-Barroso, M.Á.; Sánchez-Esquiliche, F.; Gómez, F.; Rodríguez, M.d.C.; Silió, L. Identification of Candidate Genes and Regulatory Factors Underlying Intramuscular Fat Content Through Longissimus dorsi Transcriptome Analyses in Heavy Iberian Pigs. Front. Genet. 2018, 9, 608. [Google Scholar] [CrossRef]
- Boyle, K.B.; Hadaschik, D.; Virtue, S.; Cawthorn, W.P.; Ridley, S.H.; O’Rahilly, S.; Siddle, K. The Transcription Factors Egr1 and Egr2 Have Opposing Influences on Adipocyte Differentiation. Cell Death Differ. 2009, 16, 782–789. [Google Scholar] [CrossRef]
- Zuo, B.; Yang, H.; Wang, J.; Lei, M.G.; Xiong, Y.Z. Molecular Characterization, Sequence Variation and Association with Fat Deposition Traits of ACOX1 Gene in Pigs. J. Anim. Feed Sci. 2007, 16, 433–444. [Google Scholar] [CrossRef] [Green Version]
- Verschueren, K.H.G.; Blanchet, C.; Felix, J.; Dansercoer, A.; De Vos, D.; Bloch, Y.; Van Beeumen, J.; Svergun, D.; Gutsche, I.; Savvides, S.N.; et al. Structure of ATP Citrate Lyase and the Origin of Citrate Synthase in the Krebs Cycle. Nature 2019, 568, 571–575. [Google Scholar] [CrossRef]
- Sun, J.; Pan, C.Q.; Chew, T.W.; Liang, F.; Burmeister, M.; Low, B.C. BNIP-H Recruits the Cholinergic Machinery to Neurite Terminals to Promote Acetylcholine Signaling and Neuritogenesis. Dev. Cell 2015, 34, 555–568. [Google Scholar] [CrossRef] [Green Version]
- Estévez, M.; Morcuende, D.; Cava López, R. Physico-Chemical Characteristics of M. Longissimus dorsi from Three Lines of Free-Range Reared Iberian Pigs Slaughtered at 90 Kg Live-Weight and Commercial Pigs: A Comparative Study. Meat Sci. 2003, 64, 499–506. [Google Scholar] [CrossRef]
- Gilles, G. Dry Cured Ham Quality as Related to Lipid Quality of Raw Material and Lipid Changes during Processing: A Review. Grasas Aceites 2009, 60, 297–307. [Google Scholar] [CrossRef]
- Poklukar, K.; Čandek-Potokar, M.; Lukač, N.B.; Tomažin, U.; Škrlep, M. Lipid Deposition and Metabolism in Local and Modern Pig Breeds: A Review. Animals 2020, 10, 424. [Google Scholar] [CrossRef] [Green Version]
- Clemente, I.; Membrillo, A.; Azor, P.; Dorado, G.; Rodero Franganillo, A.; Molina Casanova, A. Algunas Consideraciones Sobre Las Diferentes Clasificaciones Del Tronco Porcino Ibérico: Una Propuesta Integradora. Solo Cerdo Ibér. 2006, 18, 7–23. [Google Scholar]
- Dieguez, E. La Raza Porcina Ibérica. Solo Cerdo Ibér. 2000, 5, 7–24. [Google Scholar]
- Ibáñez-Escriche, N.; Magallón, E.; Gonzalez, E.; Tejeda, J.F.; Noguera, J.L. Genetic Parameters and Crossbreeding Effects of Fat Deposition and Fatty Acid Profiles in Iberian Pig Lines. J. Anim. Sci. 2016, 94, 28–37. [Google Scholar] [CrossRef] [Green Version]
- Martins, J.M.; Neves, J.A.; Freitas, A.; Tirapicos, J.L. Rearing System and Oleic Acid Supplementation Effect on Carcass and Lipid Characteristics of Two Muscles from an Obese Pig Breed. Animal 2015, 9, 1721–1730. [Google Scholar] [CrossRef] [Green Version]
- Sellier, P. Genetics of Meat and Carcass Traits. In The Genetics of the Pig; CAB International: Wallingford, UK, 1998; pp. 463–510. [Google Scholar]
- Estévez, M.; Morcuende, D.; Cava, R. Oxidative and Colour Changes in Meat from Three Lines of Free-Range Reared Iberian Pigs Slaughtered at 90 Kg Live Weight and from Industrial Pig during Refrigerated Storage. Meat Sci. 2003, 65, 1139–1146. [Google Scholar] [CrossRef]
- Cava, R.; Estévez, M.; Ruiz, J.; Morcuende, D. Physicochemical Characteristics of Three Muscles from Free-Range Reared Iberian Pigs Slaughtered at 90 Kg Live Weight. Meat Sci. 2003, 63, 533–541. [Google Scholar] [CrossRef]
- Domínguez, R.; Lorenzo, J.M. Effect of Genotype on Fatty Acid Composition of Intramuscular and Subcutaneous Fat of Celta Pig Breed. Grasas Aceites 2014, 65, e037. [Google Scholar] [CrossRef] [Green Version]
- Ventanas, S.; Ventanas, J.; Jurado, Á.; Estévez, M. Quality Traits in Muscle Biceps Femoris and Back-Fat from Purebred Iberian and Reciprocal Iberian × Duroc Crossbred Pigs. Meat Sci. 2006, 73, 651–659. [Google Scholar] [CrossRef] [PubMed]
- Okuyama, H.; Ikemoto, A. Needs to Modify the Fatty Acids Composition of Meat for Human Health. In Proceedings of the 45th ICoMST, Yokohama, Japan, 1–6 August 1999; Volume 2, pp. 638–640. [Google Scholar]
- Ruiz, J.; Cava, R.; Antequera, T.; Martín, L.; Ventanas, J.; López-Bote, C.J. Prediction of the Feeding Background of Iberian Pigs Using the Fatty Acid Profile of Subcutaneous, Muscle and Hepatic Fat. Meat Sci. 1998, 49, 155–163. [Google Scholar] [CrossRef] [PubMed]
- Cava, R.; Ruiz, J.; Ventanas, J.; Antequera, T. Effect of α—Tocopheryl Acetate Supplementation and the Extensive Feeding of Pigs on the Volatile Aldehydes during the Maturation of Iberian Ham. Food Sci. Technol. Int. 1999, 5, 235–241. [Google Scholar] [CrossRef]
- Flores, J.; Biron, C.; Izquierdo, L.; Nieto, P. Characterization of Green Hams from Iberian Pigs by Fast Analysis of Subcutaneous Fat. Meat Sci. 1988, 23, 253–262. [Google Scholar] [CrossRef]
- Díaz, I.; García Regueiro, J.A.; Casillas, M.; De Pedro, E. Triglyceride Composition of Fresh Ham Fat from Iberian Pigs Produced with Different Systems of Animal Nutrition. Food Chem. 1996, 55, 383–387. [Google Scholar] [CrossRef]
- Simopoulos, A.P. Omega-6/Omega-3 Essential Fatty Acid Ratio and Chronic Diseases. Food Rev. Int. 2004, 20, 77–90. [Google Scholar] [CrossRef]
- Lopez, S.; Bermudez, B.; Montserrat-De La Paz, S.; Jaramillo, S.; Varela, L.M.; Ortega-Gomez, A.; Abia, R.; Muriana, F.J.G. Membrane Composition and Dynamics: A Target of Bioactive Virgin Olive Oil Constituents. Biochim. Biophys. Acta-Biomembr. 2014, 1838, 1638–1656. [Google Scholar] [CrossRef] [Green Version]
- Estany, J.; Ros-Freixedes, R.; Tor, M.; Pena, R.N. A Functional Variant in the Stearoyl-CoA Desaturase Gene Promoter Enhances Fatty Acid Desaturation in Pork. PLoS ONE 2014, 9, e86177. [Google Scholar] [CrossRef] [Green Version]
- Fernández, A.I.; Óvilo, C.; Barragán, C.; Carmen Rodríguez, M.; Silió, L.; Folch, J.M.; Fernández, A. Validating Porcine SCD Haplotype Effects on Fatty Acid Desaturation and Fat Deposition in Different Genetic Backgrounds. Livest. Sci. 2017, 205, 98–105. [Google Scholar] [CrossRef]
- Doran, O.; Moule, S.K.; Teye, G.A.; Whittington, F.M.; Hallett, K.G.; Wood, J.D. A Reduced Protein Diet Induces Stearoyl-CoA Desaturase Protein Expression in Pig Muscle but Not in Subcutaneous Adipose Tissue: Relationship with Intramuscular Lipid Formation. Br. J. Nutr. 2006, 95, 609–617. [Google Scholar] [CrossRef] [Green Version]
- Freire, J.P.B.; Mourot, J.; Cunha, L.F.; Almeida, J.A.A.; Aumaitre, A. Effect of the Source of Dietary Fat on Postweaning Lipogenesis in Lean and Fat Pigs. Ann. Nutr. Metab. 1998, 42, 90–95. [Google Scholar] [CrossRef]
- Palma-Granados, P.; Seiquer, I.; Benítez, R.; Óvilo, C.; Nieto, R. Effects of Lysine Deficiency on Carcass Composition and Activity and Gene Expression of Lipogenic Enzymes in Muscles and Backfat Adipose Tissue of Fatty and Lean Piglets. Animal 2019, 13, 2406–2418. [Google Scholar] [CrossRef]
- Albuquerque, A.; Óvilo, C.; Núñez, Y.; Benítez, R.; López-Garcia, A.; García, F.; Félix, M.d.R.; Laranjo, M.; Charneca, R.; Martins, J.M. Comparative Transcriptomic Analysis of Subcutaneous Adipose Tissue from Local Pig Breeds. Genes 2020, 11, 422. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Ma, C.; Sun, Y.; Li, Y.; Kang, L.; Jiang, Y. Dynamic Transcriptome and DNA Methylome Analyses on Longissimus dorsi to Identify Genes Underlying Intramuscular Fat Content in Pigs. BMC Genom. 2017, 18, 780. [Google Scholar] [CrossRef] [Green Version]
- Tejeda, J.F.; Hernández-Matamoros, A.; Paniagua, M.; González, E. Effect of Free-Range and Low-Protein Concentrated Diets on Growth Performance, Carcass Traits, and Meat Composition of Iberian Pig. Animals 2020, 10, 273. [Google Scholar] [CrossRef] [Green Version]
- Benítez, R.; Trakooljul, N.; Núñez, Y.; Isabel, B.; Murani, E.; De Mercado, E.; Gómez-Izquierdo, E.; García-Casco, J.; López-Bote, C.; Wimmers, K.; et al. Breed, Diet, and Interaction Effects on Adipose Tissue Transcriptome in Iberian and Duroc Pigs Fed Different Energy Sources. Genes 2019, 10, 589. [Google Scholar] [CrossRef] [Green Version]
- Zulkifli, R.M.; Parr, T.; Salter, A.M.; Brameld, J.M. Regulation of Ovine and Porcine Stearoyl Coenzyme A Desaturase Gene Promoters by Fatty Acids and Sterols. J. Anim. Sci. 2010, 88, 2565–2575. [Google Scholar] [CrossRef] [Green Version]
- Diéguez, C.; Vazquez, M.J.; Romero, A.; López, M.; Nogueiras, R. Hypothalamic Control of Lipid Metabolism: Focus on Leptin, Ghrelin and Melanocortins. Neuroendocrinology 2011, 94, 1–11. [Google Scholar] [CrossRef]
Gene | Protein Synthesised | Function |
---|---|---|
SCD | Stearoyl-Coenzyme A Desaturase | De novo synthesis of MUFA, oleic and palmitoleic acid synthesis [27]. |
ME1 | Malic Enzyme | Oxidative decarboxylation of L-malate to pyruvate. NADP–NADPH reduction [28]. |
ACACA | Acetyl-CoA Carboxylase α | Carboxylation of acetyl-CoA to malonyl-CoA. β-oxidation of mitochondrial fatty acid [29]. |
FASN | Fatty Acid Synthase | Synthesis of palmitate from acetyl-CoA and malonyl-CoA. Synthesis of long-chain saturated fatty acids [30]. De novo synthesis of palmitic |
EGR1 | Early Growth Response Gene-1 | Adipocyte differentiation, myogenesis and adipogenesis [31,32]. |
ACOX | Acyl CoA Oxidase 1 | Desaturation of acyl-CoA to 2-trans-enoyl-CoAs. Degradation of long fatty acid chain [33]. |
ACLY | ATP Citrate Lyase | Synthesis of cytosolic acetyl-CoA. Biosynthesis of fatty acids, cholesterol, and acetylcholine Conversion of citrate to oxaloacetate in Krebs cycle [34,35]. |
Gene | Forward Primer Sequence | Reverse Primer Sequence |
---|---|---|
SCD | TCCCGACGTGGCTTTTTCTTCTC | CTTCACCCCAGCAATACCAG |
ME1 | GCCGGCTTTATCCTCCTCT | TCAAGTTTGGTCTGTATTTTCTGG |
ACACA | CTGAGAGCTCGTTTTGAAGGAATA | TTTACTAGGTGCAAGCCAGACAT |
FASN | AGTAAGCCCAAGTACAGCGG | CTCACGGAGGAGAAGATCACG |
EGR1 | GAGGGCAGCGGCGGTAACAG | GGGAAAAGACTCTGCGGTCAGGTG |
ACOX | TGGCGGGCACGGCTATTCT | TGGCTGGGCAGGTCATTCA |
ACLY | ATCCGGACCATCGCCATCATC | ATCCCGCCGGTGTTTCCAATCT |
TBP | GATGGACGTTCGGTTTAGG | AGCAGCACAGTACGAGCAA |
B2M | TTCACACCGCTCCAGTAG | CCAGATACATAGCAGTTCAGG |
Trait | Unit | L | T | R | CF | MF | MSE | Gen. | F.S. | Int. |
---|---|---|---|---|---|---|---|---|---|---|
Ham | % | 0.222 ab | 0.225 a | 0.218 b | 0.224 | 0.218 | 0.000 | 0.009 | 0.001 | NS |
Foreleg | % | 0.157 a | 0.165 | 0.166 | 0.163 | 0.162 | 0.000 | 0.002 | 0.534 | NS |
L. thoracis | % | 0.025 | 0.027 a | 0.024 | 0.027 | 0.024 | 0.000 | <0.0001 | <0.0001 | NS |
Prime Cuts | % | 0.404 | 0.417 a | 0.407 | 0.415 | 0.404 | 0.000 | 0.002 | 0.001 | NS |
TSAT | cm | 8.76 ab | 8.19 b | 8.87 a | 8.14 | 9.07 | 0.857 | 0.037 | 0.001 | NS |
ISAT | cm | 2.42 ab | 2.21 b | 2.43 a | 2.14 | 2.57 | 0.343 | 0.097 | 0.000 | NS |
MSAT | cm | 4.89 | 4.25 a | 5.13 | 4.59 | 4.92 | 0.634 | 0.000 | 0.092 | * |
OSAT | cm | 1.45 | 1.72 a | 1.31 | 1.41 | 1.57 | 0.240 | <0.0001 | 0.033 | ** |
IMF | % | 3.980 | 4.140 | 6.310 * | 4.670 | 4.960 | 1.796 | 0.079 | 0.449 | NS |
Fatty Acid Composition and Ratios | |||||||||
---|---|---|---|---|---|---|---|---|---|
Genotype | Feeding System | p-Value | |||||||
Trait | L | T | R | CF | MF | MSE | Gen. | F.S. | Int |
C12:0 | 0.054 | 0.052 | 0.054 | 0.054 | 0.053 | 0.005 | 0.1507 | 0.3542 | NS |
C14:0 | 1.200 | 1.136 a | 1.196 | 1.197 | 1.158 | 0.079 | 0.0141 | 0.0485 | NS |
C16:0 | 21.670 a | 20.740 | 20.262 | 21.688 | 20.094 | 0.916 | <0.0001 | <0.0001 | NS |
C16:1 | 1.449 | 1.224 a | 1.435 | 1.511 | 1.227 | 0.211 | 0.001 | <0.0001 | NS |
C17:0 | 0.431 a | 0.325 | 0.341 | 0.425 | 0.307 | 0.048 | <0.0001 | <0.0001 | ** |
C17:1 | 0.488 a | 0.422 | 0.413 | 0.516 | 0.366 | 0.079 | 0.006 | <0.0001 | ** |
C18:0 | 11.041 a | 10.805 ab | 10.490 b | 11.542 | 10.015 | 0.614 | 0.085 | <0.0001 | * |
C18:1 | 49.908 c | 51.763 b | 52.585 a | 49.991 | 52.846 | 1.964 | <0.0001 | <0.0001 | NS |
C18:2 | 10.509 a | 10.128 | 9.889 | 9.875 | 10.476 | 0.217 | 0.000 | <0.0001 | ** |
C18:3 | 1.235 | 1.161 a | 1.228 | 0.972 | 1.444 | 0.017 | 0.129 | <0.0001 | NS |
C20:0 | 1.340 a | 1.499 | 1.450 | 1.501 | 1.359 | 0.140 | 0.0018 | 0.0001 | NS |
C20:1 | 0.674 | 0.713 a | 0.665 | 0.717 | 0.651 | 0.060 | 0.025 | <0.0001 | NS |
SFA | 35.738 a | 34.569 b | 33.783 c | 36.420 | 32.974 | 2.281 | 0.001 | <0.0001 | NS |
MUFA | 52.519 c | 54.142 b | 55.100 a | 52.734 | 55.107 | 2.202 | <0.0001 | <0.0001 | NS |
PUFA | 11.744 a | 11.289 | 11.116 | 10.847 | 11.919 | 0.294 | 0.001 | <0.0001 | * |
AI | 0.414 a | 0.388 | 0.380 | 0.418 | 0.370 | 0.025 | 0.0001 | <0.0001 | NS |
TI | 0.964 a | 0.918 | 0.885 | 1.004 | 0.841 | 0.066 | 0.001 | <0.0001 | NS |
Ratio n6/n3 | 8.869 | 9.123 | 8.332 a | 10.237 | 7.312 | 0.531 | 0.003 | <0.0001 | ** |
Relative Gene Expression | |||||||||
---|---|---|---|---|---|---|---|---|---|
Genotype | Feeding System | p-Value | |||||||
Gene | L | T | R | CF | MF | MSE | Gen. | F.S. | Int |
SCD | 0.267 | 0.268 | 0.559 a | 0.347 | 0.382 | 0.027 | <0.0001 | 0.412 | NS |
ME1 | 0.570 a | 0.466 b | 0.510 ab | 0.558 | 0.472 | 0.010 | 0.008 | 0.001 | NS |
ACACA | 0.395 | 0.436 | 0.447 | 0.463 | 0.389 | 0.013 | 0.335 | 0.012 | ** |
FASN | 0.089 | 0.118 | 0.337 a | 0.243 | 0.119 | 0.025 | <0.0001 | 0.002 | ** |
EGR1 | 0.169 | 0.176 | 0.260 | 0.239 | 0.164 | 0.040 | 0.255 | 0.133 | NS |
ACOX | 0.645 | 0.684 | 0.650 | 0.697 | 0.622 | 0.010 | 0.390 | 0.004 | NS |
ACLY | 0.305 | 0.336 | 0.430 a | 0.422 | 0.292 | 0.005 | <0.0001 | <0.0001 | ** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Garrido, N.; Izquierdo, M.; Hernández-García, F.I.; Núñez, Y.; García-Torres, S.; Benítez, R.; Padilla, J.Á.; Óvilo, C. Differences in Muscle Lipogenic Gene Expression, Carcass Traits and Fat Deposition among Three Iberian Pig Strains Finished in Two Different Feeding Systems. Animals 2023, 13, 1138. https://doi.org/10.3390/ani13071138
Garrido N, Izquierdo M, Hernández-García FI, Núñez Y, García-Torres S, Benítez R, Padilla JÁ, Óvilo C. Differences in Muscle Lipogenic Gene Expression, Carcass Traits and Fat Deposition among Three Iberian Pig Strains Finished in Two Different Feeding Systems. Animals. 2023; 13(7):1138. https://doi.org/10.3390/ani13071138
Chicago/Turabian StyleGarrido, Nicolás, Mercedes Izquierdo, Francisco I. Hernández-García, Yolanda Núñez, Susana García-Torres, Rita Benítez, José Á. Padilla, and Cristina Óvilo. 2023. "Differences in Muscle Lipogenic Gene Expression, Carcass Traits and Fat Deposition among Three Iberian Pig Strains Finished in Two Different Feeding Systems" Animals 13, no. 7: 1138. https://doi.org/10.3390/ani13071138