Effects of Starvation and Refeeding on Growth, Digestion, Nonspecific Immunity and Lipid-Metabolism-Related Genes in Onychostoma macrolepis
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Fish Maintenance and Experimental Conditions
2.3. Sample Collection
2.4. Serum Parameters’ Analysis
2.5. Determination of Digestive Enzymes, Immune Activities and TG Contents in Tissues
2.6. Gene Expression Analysis
2.7. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum Parameters
3.3. Digestive Enzyme Activities
3.4. Immune Enzyme Activities
3.5. Antioxidant Indices
3.6. Lipid Metabolic Genes Expression and TG Contents in Hepatopancreas, Muscle and Intraperitoneal Fat
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- McCue, M.D. Starvation physiology: Reviewing the different strategies animals use to survive a common challenge. Comp. Physiol. A 2010, 156, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Wang, X.C.; Zhang, X.L.; Shi, Y.Y.; Li, W.M. Locomotor posture and swimming-intensity quantification in starvation-stress behavior detection of individual fish. Comput. Electron. Agric. 2022, 202, 107399. [Google Scholar] [CrossRef]
- Secor, S.M.; Carey, H.V. Integrative Physiology of Fasting. Comp. Physiol. 2016, 6, 773–825. [Google Scholar]
- He, W.P.; Li, P.P.; Yan, H.G.; Han, D. Long-term fasting leads to preferential catabolism of His, Arg, and branched-chain amino acids in the dorsal muscle of gibel carp (Carassius auratus gibelio): Potential preferential use of amino acids as energy substrates. Aquaculture 2022, 552, 737967. [Google Scholar]
- Yang, S.; He, K.; Yan, T.; Wu, H.; Zhou, J.; Zhao, L.; Wang, Y.; Gong, Q. Effect of starvation and refeeding on oxidative stress and antioxidant defenses in Yangtze sturgeon (Acipenser dabryanus). Fish Physiol. Biochem. 2019, 45, 987–995. [Google Scholar] [CrossRef]
- Hu, W.; Guo, Y.X.; Zhou, Q.; Liu, X.; Wen, Z.Y. Molecular cloning of crtc2 and its expression in response to different feeding status in largemouth bass (Micropterus salmoides). Aquac. Rep. 2022, 25, 101230. [Google Scholar] [CrossRef]
- Ali, M.; Nicieza, A.; Wootton, R.J. Compensatory growth in fishes: A response to growth depression. Fish Fish. 2003, 4, 147–190. [Google Scholar]
- Xiong, S.L.; Wang, W.; Kenzior, A.; Olsen, L.; Krishnan, J.; Persons, J.; Medley, K.; Peuß, R.; Wang, Y.; Chen, S.; et al. Enhanced lipogenesis through Pparγ helps cavefifish adapt to food scarcity. Curr. Biol. 2022, 32, 2272–2280. [Google Scholar]
- Bar, N. Physiological and hormonal changes during prolonged starvation in fish. Can. J. Fish. Aquat. Sci. 2014, 71, 1447–1458. [Google Scholar]
- Wu, W.Y.; Ji, H.; Yu, H.B.; Sun, J.; Zhou, J.S. Effect of refeeding dietary containing different protein and lipid levels on growth performance, body composition, digestive enzyme activities and metabolic related gene expression of grass carp (Ctenopharyngodon idellus) after overwinter starvation. Aquaculture 2020, 523, 735196. [Google Scholar]
- Azodi, M.; Ebrahimi, E.; Motaghi, E.; Morshedi, V. Metabolic responses to short starvation and re-feeding in rainbow trout (Oncorhynchus mykiss). Ichthyol. Res. 2015, 62, 177–183. [Google Scholar] [CrossRef]
- Sun, J.; Wu, W.Y.; Ji, H. Effect of overwintering on body composition, antioxidant enzyme activities, fatty acid composition, glucose and lipid-metabolic related gene expression of grass carp (Ctenopharyngodon idellus). Aquaculture 2021, 545, 737125. [Google Scholar] [CrossRef]
- Eslamloo, K.; Morshedi, V.; Azodi, M.; Akhavan, S.R. Effect of starvation on some immunological and biochemical parameters in tinfoil barb (Barbonymus schwanenfeldii). J. Appl. Anim. Res. 2017, 45, 173–178. [Google Scholar] [CrossRef] [Green Version]
- Li, H.Y.; Xu, W.J.; Jin, J.Y.; Yang, Y.X.; Zhu, X.M.; Han, D.; Liu, H.; Xie, S.Q. Effects of starvation on glucose and lipid metabolism in gibel carp (Carassius auratus gibelio var. CAS III). Aquaculture 2018, 496, 166–175. [Google Scholar] [CrossRef]
- Poursaeid, S.; Falahatkar, B. Starvation alters growth, stress metabolites and physiological responses in juvenile great sturgeon (Huso huso). Anim. Feed Sci. Technol. 2022, 294, 115429. [Google Scholar] [CrossRef]
- Arslan, G.; Bayır, M.; Yağanoğlu, A.M.; Bayır, A. Changes in fatty acids, blood biochemistry and mRNA expressions of genes involved in polyunsaturated fatty acid metabolism in brown trout (Salmo trutta) during starvation and refeeding. Aquac. Res. 2020, 52, 494–504. [Google Scholar] [CrossRef]
- Pal, P.K.; Maitra, S.K. Response of gastrointestinal melatonin, antioxidants, and digestive enzymes to altered feeding conditions in carp (Catla catla). Fish Physiol. Biochem. 2018, 44, 1061–1073. [Google Scholar] [CrossRef]
- Sakyi, M.E.; Jia, C.; Ampofo-Yeboah, A.; Anokyewaa, M.A.; Wang, Z.W.; Jian, J. Starvation and re-feeding influence the growth, immune response, and intestinal microbiota of nile tilapia (oreochromis niloticus). Aquaculture 2021, 543, 736959. [Google Scholar] [CrossRef]
- Liu, X.; Shi, H.; He, Q.; Lin, F.; Wang, Q.; Xiao, S.; Dai, Y.; Zhang, Y.; Yang, H.; Zhao, H. Effect of starvation and re-feeding on growth, gut microbiota and non-specific immunity in hybrid grouper (Epinephelus fuscoguttatus♀ × E. lanceolatus♂). Fish Shellfish Immunol. 2020, 97, 182–193. [Google Scholar] [CrossRef]
- Zhao, Z.; Zhang, X.; Zhao, F.; Zhou, Z.; Zhao, F.; Wang, J.; Liu, T.; Yang, X.; Zhang, X.; Li, Z. Stress responses of the intestinal digestion, antioxidant status, microbiota and non-specific immunity in Songpu mirror carp (Cyprinus carpio L.) under starvation. Fish Shellfish Immunol. 2022, 120, 411–420. [Google Scholar] [CrossRef]
- Fang, Z.; Tian, X.; Dong, S. Effects of starving and re-feeding strategies on the growth performance and physiological characteristics of the juvenile tongue sole (Cynoglossus semilaevis). J. Ocean Univ. China 2017, 16, 517–524. [Google Scholar] [CrossRef]
- Ensminger, D.C.; Salvador-Pascual, A.; Gabriela Arango, B.; Allen, K.N.; Vazquez-Medina, J.P. Fasting ameliorates oxidative stress: A review of physiological strategies across life history events in wild vertebrates. Comp. Biochem. Physiol. Part A 2021, 256, 110929. [Google Scholar] [CrossRef]
- Zengin, H. The effects of feeding and starvation on antioxidant defence, fatty acid composition and lipid peroxidation in reared Oncorhynchus mykiss Fry. Sci. Rep. 2021, 11, 16716. [Google Scholar] [CrossRef]
- Pan, Y.; Tao, J.; Zhou, J.; Cheng, J.; Chen, Y.; Xiang, J.; Bao, L.; Zhu, X.; Zhang, J.; Chu, W. Effect of starvation on the antioxidative pathway, autophagy, and mitochondrial function in the intestine of Chinese perch Siniperca chuatsi. Aquaculture 2022, 548, 737683. [Google Scholar] [CrossRef]
- Florescu, I.E.; Georgescu, S.E.; Dudu, A.; Balaș, M.; Voicu, S.; Grecu, I.; Dediu, L.; Dinischiotu, A.; Costache, M. Oxidative stress and antioxidant defense mechanisms in response to starvation and refeeding in the intestine of stellate sturgeon (Acipenser stellatus) juveniles from aquaculture. Animals 2021, 11, 76. [Google Scholar] [CrossRef]
- Bu, T.; Xu, L.; Cheng, J.; Li, Y.; Liu, L.; Bao, L.; Chu, W. Influence of short-term fasting on oxidative stress, antioxidant-related signaling molecules and autophagy in the intestine of adult Siniperca chuatsi. Aquac. Rep. 2021, 21, 100933. [Google Scholar] [CrossRef]
- Liu, X.; Hegab, I.M.M.; Su, J.H.; Du, X.H.; Fan, X.P.; Zhang, Q.; Gao, Y.; Wang, H.F. Effects of Different Durations of Fasting/Re-feeding Bouts on Growth, Biochemical and Histological Changes in the Digestive Tract of Ganus Golden Trout (Oncorhynchus mykiss). Czech J. Anim. Sci. 2018, 487, 389–398. [Google Scholar] [CrossRef]
- Tunçelli, G.; Pirhonen, J. Effects of weekend starvation and the duration of daily feeding on production parameters of rainbow trout Oncorhynchus mykiss. Aquaculture 2021, 543, 737028. [Google Scholar] [CrossRef]
- Hvas, M.; Nilsson, J.; Vågseth, T.; Nola, V.; Fjelldal, P.G.; Hansen, T.J.; Oppedal, F.; Stien, L.H.; Folkedal, O. Full compensatory growth before harvest and no impact on fish welfare in Atlantic salmon after an 8-week fasting period. Aquaculture 2022, 546, 737415. [Google Scholar] [CrossRef]
- Gou, N.N.; Ji, H.; Zhong, M.Z.; Chang, Z.G.; Deng, W. Effects of dietary fish oil replacements with three vegetable oils on growth, fatty acid composition, antioxidant capacity, serum parameters and expression of lipid metabolism related genes in juvenile Onychostoma macrolepis. Aquac. Nutr. 2020, 27, 163–175. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Sakyi, M.E.; Cai, J.; Tang, J.; Xia, L.; Li, P.; Abarike, E.D.; Kuebutornye, F.K.A.; Jian, J. Short term starvation and re-feeding in Nile tilapia (Oreochromis niloticus, Linnaeus 1758): Growth measurements and immune responses. Aquac. Rep. 2020, 16, 100261. [Google Scholar] [CrossRef]
- Sun, S.; Su, Y.; Yu, H.; Ge, X.; Su, Y.; Yu, H. Starvation affects the intestinal microbiota structure and the expression of inflammatory-related genes of the juvenile blunt snout bream, Megalobrama amblycephala. Aquaculture 2020, 517, 734764. [Google Scholar] [CrossRef]
- Zheng, Y.; Cheng, X.; Tang, H. Effects of starvation and Refeeding on digestive enzyme activity of Megalobrama pellegrini. Adv. J. Food Sci. Technol. 2015, 7, 230–234. [Google Scholar] [CrossRef]
- Goede, R.W.; Barton, B.A. Organismic indices and an autopsy-based assessment as indicators of health and condition of fish. Am. Fish. Soc. Symp. 1990, 8, 93–108. [Google Scholar]
- Bassam AL-Salahy, M.; Ibrahim, A.T. Hematological indices and oxidative stress biomarkers response to the starvation of Clarias gariepinus. Acta Ecol. Sin. 2018, 38, 61–66. [Google Scholar] [CrossRef]
- Li, C.; Sun, L.D.; Lin, H.Z.; Qin, Z.D.; Tu, J.G.; Li, J.; Chen, K.P.; Babu, V.S.; Lin, L. Glutamine starvation inhibits snakehead vesiculovirus replication via inducing autophagy associated with the disturbance of endogenous glutathione pool. Fish Shellfish Immunol. 2019, 86, 1044–1052. [Google Scholar] [CrossRef]
- Navarro, I.; Gutiérrez, J. Chapter 17 Fasting and starvation. In Biochemistry and Molecular Biology of Fishes; Elsevier: Amsterdam, The Netherlands, 1995; pp. 393–434. [Google Scholar]
- Gisbert, E.; Fernández, I.; Alvarez-González, C.A. Prolonged feed deprivation does not permanently compromise digestive function in migrating European glass eels Anguilla anguilla. J. Fish Biol. 2011, 78, 580–592. [Google Scholar] [CrossRef]
- Gonzalez-silvera, D.; Herrera, M.; Giraldez, I.; Esteban, M.A. Effects of the dietary tryptophan and aspartate on the immune response of meagre (Argyrosomus regius) after stress. Fishes 2018, 3, 6. [Google Scholar] [CrossRef] [Green Version]
- Abolfathi, M.; Hajimoradloo, A.; Ghorbani, R.; Zamani, A. Effect of starvation and refeeding on digestive enzyme activities in juvenile roach, Rutilus rutilus caspicus. Comp. Biochem. Physiol. Part A 2012, 161, 166–173. [Google Scholar] [CrossRef]
- Holm, C. Molecular mechanisms regulating hormone-sensitive lipase and lipolysis. Biochem. Soc. Trans. 2003, 31, 1120–1124. [Google Scholar] [CrossRef] [PubMed]
- He, A.Y.; Ning, L.J.; Chen, L.Q.; Chen, Y.L.; Xing, Q.; Li, J.M.; Qiao, F.; Li, D.L.; Zhang, M.L.; Du, Z.Y. Systemic adaptation of lipid metabolism in response to low- and high-fat diet in Nile tilapia (Oreochromis niloticus). Physiol. Rep. 2015, 3, e12485.44.45. [Google Scholar] [CrossRef]
- Zheng, J.L.; Luo, Z.; Zhu, Q.L.; Tan, X.Y.; Chen, Q.L.; Sun, L.D.; Hu, W. Molecular cloning and expression pattern of 11 genes involved in lipid metabolism in yellow catfish Pelteobagrus fulvidraco. Gene 2013, 531, 53–63. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.L.; Luo, Z.; Huang, C.; Zheng, J.L.; Pan, Y.X.; Song, Y.F.; Hu, W. Molecular cloning and tissue mRNA levels of 15 genes involved in lipid metabolism in Synechogobius hasta. Eur. J. Lipid Sci. Technol. 2015, 117, 471–482. [Google Scholar] [CrossRef]
Component | Quantity |
---|---|
Crude protein | ≥35% |
Crude fat | ≥6% |
Crude fiber | ≤9% |
Crude ash | ≤15% |
Calcium | 0.5–3.5% |
Total phosphorus | 0.8–2.0% |
Lysine | ≥1.6% |
Moisture | ≤10% |
Genes | Sequence (5′–3′) | Accession No. | Amplicon Size (bp) | Amplification Efficiency (%) |
---|---|---|---|---|
HSL A | F:GCTTCACCATCCAGACTGCTCAC | MG735215.1 | 109 | 98.4 |
R:CTGGCTGCACTGACTGACAACTC | ||||
CPT-1A B | F:CTCAGACGGTGTTCAGTGCCATC | MH553647 | 105 | 97.1 |
R:TCCAGCCGTGATAGGACAAGAGG | ||||
SREBP1 C | F:GGCGACAAGAACCTCACTGATGG | MG735210.1 | 177 | 95.0 |
R:GACAACCGACGACCACCACTTC | ||||
FAS D | F:ATCCACAGAGCCACCATCCTACC | MG735211.1 | 145 | 97.8 |
R:CAAGTCCAGCATCCTCCAAGACAC | ||||
β-Actin | F:TGACCCACACTGTACCCATC | JN254630.1 | 154 | 97.3 |
R:CGGACAATTTCACTCTCGGC |
Starvation Period | Refeeding Period | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
(p Value) | (p Value) | ||||||||||||
Control | Starved/Refed | Control vs. Starved/Refed | Feeding Condition | Time | Interaction | Control | Starved/Refed | Control vs. Starved/Refed | Feeding Condition | Time | Interaction | ||
IW (g) | 2.50 ± 0.14 | 2.51 ± 0.17 | ns | ns | ns | ns | |||||||
BW (g) | <0.001 | <0.001 | <0.001 | BW (g) | <0.001 | <0.001 | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 3.61 ± 0.14 c | 2.10 ± 0.08 a | ** | 4 | 6.67 ± 0.22 c | 2.86±0.10 c | ** | ||||||
2 | 4.57 ± 0.35 b | 1.72 ± 0.09 ab | ** | 5 | 7.80 ± 0.15 b | 4.40 ± 0.21 b | ** | ||||||
3 | 5.72 ± 0.09 a | 1.44 ± 0.07 b | ** | 6 | 8.95 ± 0.39 a | 5.49 ± 0.13 a | ** | ||||||
CF (%) | <0.001 | ns | <0.01 | CF (%) | <0.001 | <0.001 | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 1.67 ± 0.07 | 1.47 ± 0.08 a | * | 4 | 1.89 ± 0.07 c | 1.37 ± 0.05 c | ** | ||||||
2 | 1.72 ± 0.10 | 1.3 ± 0.05 ab | ** | 5 | 1.98 ± 0.04 b | 1.55 ± 0.04 b | ** | ||||||
3 | 1.85 ± 0.15 | 1.17 ± 0.02 b | ** | 6 | 2.09 ± 0.06 a | 1.63 ± 0.08 a | ** | ||||||
VSI d (%) | <0.001 | ns | <0.001 | VSI d (%) | <0.001 | <0.01 | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 5.64 ± 0.11 c | 4.91 ± 0.06 a | ** | 4 | 6.94 ± 0.39 c | 4.65 ± 0.41 c | ** | ||||||
2 | 5.98 ± 0.05 b | 4.26 ± 0.06 b | ** | 5 | 7.69 ± 0.52 ab | 5.15 ± 0.13 ab | ** | ||||||
3 | 6.35 ± 0.10 a | 3.96 ± 0.18 c | ** | 6 | 8.02 ± 0.46 a | 5.52 ± 0.17 a | ** | ||||||
HSI e (%) | <0.001 | <0.001 | <0.001 | HSI e (%) | <0.001 | <0.001 | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 1.81 ± 0.10 b | 1.58 ± 0.05 a | * | 4 | 2.13 ± 0.03 c | 1.16 ± 0.03 c | ** | ||||||
2 | 1.95 ± 0.04 ab | 1.37 ± 0.07 b | ** | 5 | 2.25 ± 0.04 ab | 1.28 ± 0.08 ab | ** | ||||||
3 | 2.04 ± 0.04 a | 0.93 ± 0.08 c | ** | 6 | 2.33 ± 0.05 a | 1.34 ± 0.03 a | ** | ||||||
IPFI f (%) | <0.001 | <0.001 | <0.001 | IPFI f (%) | <0.001 | <0.001 | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 1.75 ± 0.07b | 1.43 ± 0.05 a | ** | 4 | 2.05 ± 0.05 c | 0.81 ± 0.02 c | ** | ||||||
2 | 1.83 ± 0.09 ab | 1.16 ± 0.06 b | ** | 5 | 2.12 ± 0.03 b | 0.90 ± 0.09 b | ** | ||||||
3 | 1.92 ± 0.05 a | 0.70 ± 0.03 c | ** | 6 | 2.19 ± 0.04 a | 1.03 ± 0.04 a | ** |
Starvation Period | Refeeding Period | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Control | Starved/Refed | Control vs. Starved/Refed | (p Value) | Control | Starved/Refed | Control vs. Starved/Refed | (p Value) | ||||||
Feeding Condition | Time | Interaction | Feeding Condition | Time | Interaction | ||||||||
TG (mmol/L) | <0.001 | <0.001 | <0.001 | TG (mmol/L) | <0.001 | <0.001 | <0.001 | ||||||
Weeks | Weeks | ||||||||||||
1 | 1.67 ± 0.05 | 1.46±0.07 a | * | 4 | 1.68 ± 0.02 | 1.19 ± 0.04 c | ** | ||||||
2 | 1.65 ± 0.12 | 1.10 ± 0.11 b | ** | 5 | 1.69 ± 0.09 | 1.41 ± 0.05 b | ** | ||||||
3 | 1.69 ± 0.05 | 0.83 ± 0.05 c | ** | 6 | 1.73 ± 0.07 | 1.67 ± 0.06 a | ns | ||||||
T-CHOL (mmol/L) | <0.001 | <0.01 | <0.01 | T-CHOL (mmol/L) | <0.001 | <0.001 | <0.001 | ||||||
Weeks | Weeks | ||||||||||||
1 | 1.85 ± 0.08 | 1.63 ± 0.05 a | * | 4 | 1.87 ± 0.05 | 1.49 ± 0.06 c | ** | ||||||
2 | 1.87 ± 0.04 | 1.39 ± 0.07 b | ** | 5 | 1.88 ± 0.07 | 1.74 ± 0.04 ab | * | ||||||
3 | 1.86 ± 0.06 | 1.15 ± 0.14 c | ** | 6 | 1.89 ± 0.06 | 1.86 ± 0.05 a | ns | ||||||
HDL (mmol/L) | <0.001 | ns | ns | HDL (mmol/L) | <0.01 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 1.68 ± 0.10 | 1.35 ± 0.05 | ** | 4 | 1.64 ± 0.10 | 1.41 ± 0.07 | * | ||||||
2 | 1.65 ± 0.14 | 1.28 ± 0.11 | ** | 5 | 1.66 ± 0.10 | 1.54 ± 0.05 | * | ||||||
3 | 1.62 ± 0.06 | 1.13 ± 0.12 | ** | 6 | 1.67 ± 0.08 | 1.57 ± 0.08 | * | ||||||
LDL d (mmol/L) | <0.001 | <0.05 | ns | LDL d (mmol/L) | <0.01 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 0.67 ± 0.06 | 0.57 ± 0.03 a | ** | 4 | 0.66 ± 0.09 | 0.49 ± 0.05 | * | ||||||
2 | 0.65 ± 0.03 | 0.47 ± 0.06 ab | ** | 5 | 0.62 ± 0.05 | 0.54 ± 0.04 | * | ||||||
3 | 0.63 ± 0.07 | 0.46 ± 0.05 b | ** | 6 | 0.61 ± 0.09 | 0.58 ± 0.03 | * |
Starvation Period | Refeeding Period | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Control | Starved/Refed | Control vs. Starved/ Refed | (p Value) | Control | Starved/ Refed | Control vs. Starved/Refed | (p Value) | ||||||
Feeding Condition | Time | Interaction | Feeding Condition | Time | Interaction | ||||||||
Amylase (U/mgprot) | <0.001 | <0.001 | ns | Amylase (U/mgprot) | <0.01 | ns | <0.05 | ||||||
Weeks | Weeks | ||||||||||||
1 | 0.34 ± 0.05 | 0.21 ± 0.02 a | ** | 4 | 0.32 ± 0.09 | 0.15 ± 0.01 b | * | ||||||
2 | 0.38 ± 0.06 | 0.17 ± 0.02 ab | ** | 5 | 0.22 ± 0.06 | 0.18 ± 0.01 b | ns | ||||||
3 | 0.24 ± 0.06 | 0.09 ± 0.01 c | ** | 6 | 0.28 ± 0.03 | 0.26 ± 0.03 a | ns | ||||||
Lipase (U/mgprot) | <0.01 | <0.001 | <0.001 | Lipase (U/mgprot) | <0.001 | <0.001 | <0.01 | ||||||
Weeks | Weeks | ||||||||||||
1 | 27.32 ± 1.71 | 33.70 ± 2.81 a | * | 4 | 31.41 ± 2.05 | 20.34 ± 2.04 c | ** | ||||||
2 | 28.98 ± 1.02 | 24.85 ± 1.15 b | * | 5 | 32.50 ± 1.95 | 25.90 ± 1.33 b | * | ||||||
3 | 29.64 ± 2.32 | 17.87 ± 1.82 c | ** | 6 | 33.31 ± 1.72 | 31.94 ± 0.92 a | ns | ||||||
Protease (U/mgprot) | <0.001 | ns | <0.05 | Protease (U/mgprot) | <0.05 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 11.01 ± 1.07 b | 10.23 ± 0.56 | ns | 4 | 13.05 ± 1.00 | 9.72 ± 1.53 | * | ||||||
2 | 13.42 ± 1.49 a | 9.53 ± 0.47 | * | 5 | 12.48 ± 1.77 | 10.87 ± 1.03 | * | ||||||
3 | 13.54 ± 1.30 a | 8.71 ± 0.56 | * | 6 | 12.91 ± 1.64 | 13.36 ± 1.04 | * |
Starvation Period | Re-Feeding Period | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Control | Starved/Refed | Control vs. Starved/Refed | (p Value) | Control | Starved/Refed | Control vs. Starved/Refed | (p Value) | ||||||
Feeding Condition | Time | Interaction | Feeding Condition | Time | Interaction | ||||||||
LYZ (U/mL) | <0.001 | ns | <0.01 | LYZ (U/mL) | <0.05 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 0.75 ± 0.04 | 0.88 ± 0.05 b | * | 4 | 0.71 ± 0.07 | 0.89 ± 0.03 | * | ||||||
2 | 0.70 ± 0.05 | 1.09 ± 0.08 a | ** | 5 | 0.75 ± 0.09 | 0.85 ± 0.14 | * | ||||||
3 | 0.75 ± 0.04 | 0.96 ± 0.04 b | ** | 6 | 0.75 ± 0.12 | 0.79 ± 0.07 | * | ||||||
ACP (U/mgprot) | <0.001 | <0.01 | <0.001 | ACP (U/mgprot) | ns | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 0.85 ± 0.04 | 0.92 ± 0.03 b | ns | 4 | 0.86 ± 0.08 | 0.90 ± 0.04 | ns | ||||||
2 | 0.82 ± 0.07 | 1.17 ± 0.06 a | ** | 5 | 0.87 ± 0.04 | 0.91 ± 0.04 | ns | ||||||
3 | 0.85 ± 0.03 | 0.96 ± 0.02 b | * | 6 | 0.84 ± 0.05 | 0.90 ± 0.04 | ns | ||||||
ALP (U/mgprot) | <0.001 | <0.01 | ns | ALP (U/mgprot) | ns | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 0.61 ± 0.04 | 0.72 ± 0.05 b | ** | 4 | 0.66 ± 0.06 | 0.69 ± 0.05 | ns | ||||||
2 | 0.66 ± 0.05 | 0.85 ± 0.05 a | ** | 5 | 0.67 ± 0.04 | 0.65 ± 0.05 | ns | ||||||
3 | 0.65 ± 0.05 | 0.75 ± 0.03 ab | ** | 6 | 0.71 ± 0.05 | 0.66 ± 0.04 | ns |
Starvation Period | Re-Feeding Period | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Control | Starved/Refed | Control vs. Starved/Refed | (p Value) | Control | Starved/Refed | Control vs. Starved/Refed | (p Value) | ||||||
Feeding Condition | Time | Interaction | Feeding Condition | Time | Interaction | ||||||||
LYZ (U/mL) | <0.001 | <0.001 | <0.01 | LYZ (U/mL) | <0.01 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 0.54 ± 0.01 | 0.66 ± 0.04 b | ** | 4 | 0.55 ± 0.04 | 0.61 ± 0.01 | * | ||||||
2 | 0.52 ± 0.03 | 0.63 ± 0.02 b | ** | 5 | 0.53 ± 0.09 | 0.64 ± 0.04 | * | ||||||
3 | 0.56 ± 0.03 | 0.82 ± 0.03 a | ** | 6 | 0.52 ± 0.09 | 0.63 ± 0.02 | * | ||||||
ACP (U/mgprot) | <0.01 | ns | ns | ACP (U/mgprot) | <0.01 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 0.67 ± 0.12 | 0.77 ± 0.03 | * | 4 | 0.61 ± 0.06 | 0.71 ± 0.04 | * | ||||||
2 | 0.64 ± 0.08 | 0.73 ± 0.03 | * | 5 | 0.62 ± 0.10 | 0.72 ± 0.05 | * | ||||||
3 | 0.66 ± 0.04 | 0.83 ± 0.03 | * | 6 | 0.64 ± 0.07 | 0.74 ± 0.07 | * | ||||||
ALP (U/mgprot) | <0.001 | <0.05 | ns | ALP (U/mgprot) | ns | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 0.45 ± 0.09 | 0.56 ± 0.02 ab | ** | 4 | 0.52 ± 0.02 | 0.59 ± 0.11 | ns | ||||||
2 | 0.43 ± 0.02 | 0.52 ± 0.02 b | ** | 5 | 0.52 ± 0.01 | 0.53 ± 0.04 | ns | ||||||
3 | 0.45 ± 0.02 | 0.63 ± 0.02 a | ** | 6 | 0.52 ± 0.01 | 0.50 ± 0.03 | ns |
Starvation Period | Re-Feeding Period | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Control | Starved/Refed | Control vs. Starved/Refed | (p Value) | Control | Starved/Refed | Control vs. Starved/Refed | (p Value) | ||||||
Feeding Condition | Time | Interaction | Feeding Condition | Time | Interaction | ||||||||
SOD (U/mgprot) | <0.001 | <0.05 | <0.01 | SOD (U/mgprot) | <0.001 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 84.15 ± 2.14 | 97.42 ± 2.03 b | * | 4 | 79.25 ± 5.89 | 100.64 ± 4.86 | ** | ||||||
2 | 81.04 ± 5.24 | 112.09 ± 2.90 a | ** | 5 | 78.64 ± 3.47 | 94.73 ± 1.61 | ** | ||||||
3 | 76.46 ± 4.55 | 104.11 ± 3.68 ab | ** | 6 | 74.4 ± 4.37 | 90.59 ± 6.64 | ** | ||||||
CAT (U/mgprot) | <0.001 | <0.01 | <0.01 | CAT (U/mgprot) | <0.001 | <0.001 | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 39.43 ± 1.88 | 47.32 ± 2.60 b | * | 4 | 35.55 ± 2.06 | 45.47 ± 2.41 a | ** | ||||||
2 | 37.82 ± 1.08 | 59.53 ± 1.68 a | ** | 5 | 33.22 ± 2.06 | 40.13 ± 1.97 b | ** | ||||||
3 | 36.37 ± 2.56 | 54.28 ± 3.76 a | ** | 6 | 31.97 ± 1.07 | 36.27 ± 1.12 b | ** | ||||||
GSH-PX (U/mgprot) | <0.001 | <0.001 | <0.01 | GSH-PX (U/mgprot) | <0.001 | ns | <0.05 | ||||||
Weeks | Weeks | ||||||||||||
1 | 63.13 ± 1.01 | 78.36 ± 1.92 c | ** | 4 | 71.84 ± 1.82 | 83.99 ± 2.64 a | ** | ||||||
2 | 64.53 ± 2.84 | 88.47 ± 1.86 a | ** | 5 | 72.62 ± 1.36 | 80.52 ± 1.91 ab | * | ||||||
3 | 66.63 ± 1.44 | 82.87 ± 1.16 b | ** | 6 | 73.50 ± 2.12 | 77.77 ± 3.44 b | * | ||||||
MDA d (U/mgprot) | <0.001 | <0.001 | <0.001 | MDA d (U/mgprot) | <0.001 | <0.05 | <0.01 | ||||||
Weeks | Weeks | ||||||||||||
1 | 4.74 ± 0.17 | 2.89 ± 0.28 a | ** | 4 | 4.51 ± 0.29 | 1.37 ± 0.09 b | ** | ||||||
2 | 4.67 ± 0.13 | 1.74 ± 0.21 b | ** | 5 | 4.65 ± 0.17 | 1.53 ± 0.19 b | ** | ||||||
3 | 4.45 ± 0.21 | 0.70 ± 0.18 c | ** | 6 | 4.35 ± 0.21 | 2.53 ± 0.39 a | ** |
Starvation Period | Refeeding Period | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
(p Value) | (p Value) | ||||||||||||
Control | Starved/Refed | Control vs. Starved/Refed | Feeding Condition | Time | Interaction | Control | Starved/Refed | Control vs. Starved/Refed | Feeding Condition | Time | Interaction | ||
SOD (U/mgprot) | <0.001 | <0.05 | <0.01 | SOD (U/mgprot) | <0.001 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 40.34 ± 2.04 | 53.71 ± 1.80 b | ** | 4 | 40.74 ± 1.4 | 55.13 ± 1.35 | ** | ||||||
2 | 41.39 ± 2.15 | 53.31 ± 2.96 b | ** | 5 | 41.60 ± 2.21 | 51.21 ± 1.90 | ** | ||||||
3 | 40.51 ± 2.13 | 61.18 ± 1.59 a | ** | 6 | 41.09 ± 1.11 | 50.45 ± 2.28 | ** | ||||||
CAT (U/mgprot) | <0.001 | <0.01 | <0.01 | CAT (U/mgprot) | <0.001 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 10.81 ± 1.05 | 15.92 ± 1.06 b | ** | 4 | 10.48 ± 1.63 | 20.79 ± 1.78 | ** | ||||||
2 | 10.75 ± 1.40 | 18.77 ± 1.12 b | ** | 5 | 10.67 ± 1.98 | 16.90 ± 1.33 | ** | ||||||
3 | 10.07 ± 1.59 | 22.65 ± 1.42 a | ** | 6 | 10.62 ± 1.22 | 16.23 ± 1.72 | ** | ||||||
GSH-PX (U/mgprot) | <0.001 | <0.01 | <0.001 | GSH-PX (U/mgprot) | <0.001 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 26.60 ± 1.57 | 30.22 ± 1.61 b | * | 4 | 26.44 ± 1.63 | 36.08 ± 1.23 | ** | ||||||
2 | 26.30 ± 1.01 | 40.71 ± 2.42 a | ** | 5 | 27.13 ± 2.97 | 32.16 ± 3.44 | ** | ||||||
3 | 26.73 ± 1.29 | 40.23 ± 2.60 a | ** | 6 | 26.30 ± 2.58 | 28.66 ± 2.34 | ** | ||||||
MDA d (U/mgprot) | <0.001 | <0.01 | <0.05 | MDA d (U/mgprot) | <0.001 | ns | ns | ||||||
Weeks | Weeks | ||||||||||||
1 | 6.70 ± 0.35 | 4.4 ± 0.48 a | * | 4 | 6.33 ± 1.11 | 3.17 ± 0.25 | ** | ||||||
2 | 6.43 ± 1.08 | 2.56 ± 0.56 b | ** | 5 | 6.45 ± 0.56 | 3.14 ± 0.64 | ** | ||||||
3 | 6.39 ± 0.69 | 1.58 ± 0.31 bc | ** | 6 | 6.67 ± 1.32 | 2.97 ± 0.84 | ** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gou, N.; Wang, K.; Jin, T.; Yang, B. Effects of Starvation and Refeeding on Growth, Digestion, Nonspecific Immunity and Lipid-Metabolism-Related Genes in Onychostoma macrolepis. Animals 2023, 13, 1168. https://doi.org/10.3390/ani13071168
Gou N, Wang K, Jin T, Yang B. Effects of Starvation and Refeeding on Growth, Digestion, Nonspecific Immunity and Lipid-Metabolism-Related Genes in Onychostoma macrolepis. Animals. 2023; 13(7):1168. https://doi.org/10.3390/ani13071168
Chicago/Turabian StyleGou, Nina, Kaifeng Wang, Tiezhi Jin, and Bin Yang. 2023. "Effects of Starvation and Refeeding on Growth, Digestion, Nonspecific Immunity and Lipid-Metabolism-Related Genes in Onychostoma macrolepis" Animals 13, no. 7: 1168. https://doi.org/10.3390/ani13071168