Effects of Vitamin C on the Gonad Growth, Texture Traits, Collagen Content and Synthesis Related Gene Expression of Sea Urchin (Mesocentrotus nudus)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Experimental Diets
2.3. Feeding Experiment
2.4. Sampling Collection
2.5. Feed Composition Analysis
2.6. Gonad Moisture Content Analysis
2.7. Determination of Gonad Collagen
2.8. Microscopic Analysis of Collagen in the Gonad
2.9. Texture Analysis
2.10. Real-Time Quantitative PCR (RT-PCR)
2.11. Statistical Analysis
3. Results
3.1. The Impact of VC Supplementation on the GSI of M. nudus
3.2. The Impact of VC Supplementation on Gonad Structure Characteristics of M. nudus
3.3. The Impact of VC Supplementation on Collagen Content in the Gonads of M. nudus
3.4. The Impact of VC Supplementation on the Gonad Texture Quality in the Gonads of M. nudus
3.5. The Impact of VC Supplementation on the Moisture Content in the Gonads of M. nudus
3.6. The Impact of VC Supplementation on the Expression of Collagen Related Genes in the Gonads of M. nudus
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stefánsson, G.; Kristinsson, H.; Ziemer, N.; Hannon, C.; James, P. Markets for sea urchins: A review of global supply and markets. Skýrsla Matís 2017, 45, 10–17. [Google Scholar] [CrossRef]
- Rocha, F.; Baião, L.F.; Moutinho, S.; Reis, B.; Oliveira, A.; Arenas, F.; Maia, M.R.; Fonseca, A.J.; Pintado, M.; Valente, L.M. The effect of sex, season and gametogenic cycle on gonad yield, biochemical composition and quality traits of Paracentrotus lividus along the North Atlantic coast of Portugal. Sci. Rep. 2019, 9, 2994. [Google Scholar] [CrossRef] [PubMed]
- Bertocci, I.; Dominguez, R.; Machado, I.; Freitas, C.; Godino, J.D.; Sousa-Pinto, I.; Gonçalves, M.; Gaspar, M.B. Multiple efects of harvesting on populations of the purple sea urchin Paracentrotus lividus in north Portugal. Fish. Res. 2014, 150, 60–65. [Google Scholar] [CrossRef]
- Yeruham, E.; Rilov, G.; Shpigel, M.; Abelson, A. Collapse of the echinoid paracentrotus lividus populations in the eastern mediterranean-result of climate change? Sci. Rep. 2014, 5, 13479. [Google Scholar] [CrossRef] [PubMed]
- Chu, T.W.; Chu, Y.; Sun, W.T.; Pan, C.Y.; Pan, C.H.; Ding, D.S. Nutrient enrichment and probiotics for sea urchin Anthocidaris crassipina larvae in captivity to promote large-scale aquaculture. J. Anim. Physiol. Anim. Nutr. 2024, 108, 869–882. [Google Scholar] [CrossRef]
- Agatsuma, Y.; Sakai, Y.; Tajima, K. Recent advances in Sea Urchin aquaculture in Japan. Bull. Aquac. Assoc. Can. 2010, 108, 4–9. [Google Scholar]
- Cuesta-Gomez, D.M.; Lazo, J.P.; Sánchez-Saavedra, M.D.P. Effects of dietary fish oil and soya bean lecithin on gonad index, colour and biochemical composition of the purple sea urchin, Strongylocentrotus purpuratus (Stimpson 1857). Aquac. Res. 2020, 51, 3384–3402. [Google Scholar] [CrossRef]
- Cuesta-Gomez, D.M.; Sánchez-Saavedra, M.D.P. Effects of protein and carbohydrate levels on survival, consumption and gonad index in adult sea urchin Strongylocentrotus purpuratus (Stimpson 1857) from Baja California, Mexico. Aquac. Res. 2017, 48, 1596–1607. [Google Scholar] [CrossRef]
- Lourenço, S.; Valente, L.M.P.; Andrade, C. Meta-analysis on nutrition studies modulating sea urchin roe growth, colour and taste. Rev. Aquac. 2019, 11, 766–781. [Google Scholar] [CrossRef]
- Wei, Z.; Deng, K.; Zhang, W.; Mai, K. Interactions of dietary vitamin C and proline on growth performance, anti-oxidative capacity and muscle quality of large yellow croaker Larimichthys crocea. Aquaculture 2020, 528, 735558. [Google Scholar] [CrossRef]
- Dolmatov, I.Y.; Nizhnichenko, V.A. Extracellular Matrix of Echinoderms. Mar. Drugs 2023, 21, 417. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.T.; Xu, X.Y.; Li, X.Q.; Pan, W.Q.; Leng, X.J. Effects of dietary geniposidic acid on growth performance, flesh quality and collagen gene expression of grass carp, Ctenopharyngodon idella. Aquac. Nutr. 2018, 24, 1112–1121. [Google Scholar] [CrossRef]
- Torgersen, J.S.; Koppang, E.O.; Stien, L.H.; Kohler, A.; Pedersen, M.E.; Mørkøre, T. Soft texture of Atlantic salmon fillets is associated with glycogen accumulation. PLoS ONE 2014, 9, e85551. [Google Scholar] [CrossRef] [PubMed]
- Hagen, O.; Solberg, C.; Sirnes, E.; Johnston, I.A. Biochemical and structural factors contributing to seasonal variation in the texture of farmed Atlantic halibut (Hippoglossus hippoglossus L.) flesh. J. Agric. Food Chem. 2007, 55, 5803–5808. [Google Scholar] [CrossRef]
- Song, D.; Yun, Y.; Mi, J.; Luo, J.; Jin, M.; Nie, G.; Zhou, Q. Effects of faba bean on growth performance and fillet texture of Yellow River carp, Cyprinus carpio haematopterus. Aquac. Rep. 2020, 17, 100379. [Google Scholar] [CrossRef]
- Castro, P.L.; Plasencia, S.; Zamorano, M.J.; Guerrero, L.; Claret, A.; Beltrán, J.A.; Calanche, J.; Ginés, R. Effect of L-Hyp supplementation on collagen muscle histology, gene expression, growth performance, body composition and fillet texture on big size European sea bass (Dicentrarchux labrax). Aquac. Rep. 2021, 21, 100787. [Google Scholar] [CrossRef]
- Guo, H.; Liu, X.; Tian, M.; Liu, G.; Yuan, Y.; Ye, X.; Zhang, H.; Xiao, L.; Wang, S.; Hong, Y.; et al. Effects of dietary collagen cofactors and hydroxyproline on the growth performance, textural properties and collagen deposition in swim bladder of Nibea coibor based on orthogonal array analysis. Aquac. Rep. 2022, 27, 101375. [Google Scholar] [CrossRef]
- Yan, L.J.; Sun, L.C.; Cao, K.Y.; Chen, Y.L.; Zhang, L.J.; Liu, G.M.; Jin, T.; Cao, M.J. Type I collagen from sea cucumber (Stichopus japonicus) and the role of matrix metalloproteinase-2 in autolysis. Food Biosci. 2021, 41, 100959. [Google Scholar] [CrossRef]
- Zhu, C.B.; Ren, H.C.; Wu, Y.J.; Yang, S.; Fei, H. Benefits and applications of vitamin C in farmed aquatic animals: An updated review. Aquac. Int. 2024, 32, 1295–1315. [Google Scholar] [CrossRef]
- Archile-Contreras, A.; Purslow, P. Oxidative stress may affect meat quality by interfering with collagen turnover by muscle fibroblasts. Food Res. Int. 2011, 44, 582–588. [Google Scholar] [CrossRef]
- Yan, Y.; Zeng, W.; Song, S.; Zhang, F.; He, W.; Liang, W.; Niu, Z. Vitamin C induces periodontal ligament progenitor cell differentiation via activation of ERK pathway mediated by PELP1. Protein Cell 2013, 4, 620–627. [Google Scholar] [CrossRef]
- Shahkar, E.; Yun, H.; Kim, D.J.; Kim, S.K.; Lee, B.I.; Bai, S.C. Effects of dietary vitamin C levels on tissue ascorbic acid concentration, hematology, non-specific immune response and gonad histology in broodstock Japanese eel, Anguilla japonica. Aquaculture 2015, 438, 115–121. [Google Scholar] [CrossRef]
- Doseděl, M.; Jirkovský, E.; Macáková, K.; Krčmová, L.K.; Javorská, L.; Pourová, J.; Mercolini, L.; Remião, F.; Nováková, L.; Mladěnka, P.; et al. Vitamin C—Sources, Physiological Role, Kinetics, Deficiency, Use, Toxicity, and Determination. Nutrients 2021, 13, 615. [Google Scholar] [CrossRef]
- Kietzmann, T. Vitamin C: From nutrition to oxygen sensing and epigenetics. Redox Biol. 2023, 63, 102753. [Google Scholar] [CrossRef]
- Li, X.Q.; Hu, B.; Leng, X.J.; Li, J.L.; Wen, H. Effects of supplemental vitamin C on growth, meat quality and serum non-specific immunity of adult grass carp, Ctenopharyngodon idellus. J. Shanghai Ocean. Univ. 2010, 19, 787–791. [Google Scholar]
- Zhao, T.T.; Chen, C.; Shao, Y.X.; Zhang, Q.W.; Liu, L. Vitamin C requirement of juvenile Centropristis striata. Chin. J. Anim. Nutr. 2018, 30, 5062–5074. [Google Scholar] [CrossRef]
- Huang, T.; Guo, B.; Zheng, J.; Li, M.; Chen, Y.; Li, X.; Leng, X. Combined supplementation of hydroxyproline and vitamin C improved the growth and flesh quality of Pacific white shrimp (Litopenaeus vanname) cultured in low salinity water. Aquac. Fish. 2024. [Google Scholar] [CrossRef]
- Xu, F.; Liu, C.; Zhou, D.; Zhang, L. TGF-β/SMAD pathway and its regulation in hepatic fibrosis. J. Histochem. Cytochem. 2016, 64, 157–167. [Google Scholar] [CrossRef]
- Yu, E.M.; Ma, L.L.; Ji, H.; Li, Z.F.; Wang, G.J.; Xie, J.; Gong, W.B. Smad4-dependent regulation of type I collagen expression in the muscle of grass carp fed with faba bean. Gene 2019, 685, 32–41. [Google Scholar] [CrossRef]
- Rong, H.; Lin, F.; Limbu, S.M.; Lin, Z.; Bi, B.; Dou, T.; Wen, X. Effects of dietary proline on swim bladder collagen synthesis and its possible regulation by the TGF-β/Smad pathway in spotted drum, Nibea diacanthus. Aquac. Nutr. 2020, 26, 1792–1805. [Google Scholar] [CrossRef]
- Tariq, S.; Koloko, B.L.; Malik, A.; Rehman, S.; Ijaz, B.; Shahid, A.A. Tectona grandis leaf extract ameliorates hepatic fibrosis: Modulation of TGF-β/Smad signaling pathway and upregulating MMP3/TIMP1 ratio. J. Ethnopharmacol. 2021, 272, 113938. [Google Scholar] [CrossRef]
- Wu, Z.P.; Ruan, R.; Chen, H.; Chu, Z.P.; Li, Y.; Yang, W.J. Effects of dietary vitamin C supplemental level on growth performance, muscle quality and antioxidant indices of juvenile hybrid sturgeon (Acipenser schrenckii × Acipenser baeri). Chin. J. Anim. Nutr. 2020, 32, 455–462. [Google Scholar]
- Takagi, S.; Murata, Y.; Inomata, E.; Endo, H.; Aoki, M.N.; Agatsuma, Y. Improvement of gonad quality of the sea urchin Mesocentrotus nudus fed the kelp Saccharina japonica during offshore cage culture. Aquaculture 2017, 477, 50–61. [Google Scholar] [CrossRef]
- Yang, J.; Song, W.; Li, C.; Fang, C.; Zhang, Y.; Wang, Q.; Zhang, M.; Qian, G. Comparative studyof collagen distribution in the dermis of the embryoniccarapace of soft- and hard-shelled cryptodiran turtles. Joumal Morphol. 2021, 282, 543–552. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Song, W.; Wu, J.; Lu, M.; Zhao, Q.; Fang, C.; Wang, W.; Park, Y.D.; Qian, G.Y. Thermal stable characteristics of acid- and pepsin-soluble collagens from the carapace tissue of Chinese soft-shelled turtle (Pelodiscus sinensis). Tissue Cell. 2020, 67, 101424. [Google Scholar] [CrossRef] [PubMed]
- Martinez, O.; Salmeron, J.; Guillen, M.D.; Casas, C. Texture profle analysis of meat products treated with commercial liquid smoke favourings. Food Control 2004, 15, 457–461. [Google Scholar] [CrossRef]
- Ning, Y.C.; Zhang, F.; Tang, L.; Song, J.; Ding, J.; Chang, Y.Q.; Zuo, R.T. Effects of dietary lipid sources on the growth, gonad development, nutritional and organoleptic quality, transcription of fatty acid synthesis related genes and antioxidant capacity during cold storage in adult sea urchin (Strongylocentrotus intermedius). Aquaculture 2022, 548, 737688. [Google Scholar] [CrossRef]
- Unuma, T.; Yamamoto, T.; Akiyama, T.; Shiraishi, M.; Ohta, H. Quantitative changes in yolk protein and other components in the ovary and testis of the sea urchin Pseudocentrotus depressus. J. Exp. Biol. 2003, 206, 365–372. [Google Scholar] [CrossRef]
- Unuma, T. Gonadal growth and its relationship to aquaculture in sea urchins. In Sea Urchin Basic Biology to Aquaculture; Swets & Zeitlinger: Lisse, The Netherlands, 2002; pp. 115–127. [Google Scholar]
- Shao, L.; Han, D.; Yang, Y.; Jin, J.; Liu, H.; Zhu, X.; Xie, S. Efects of dietary vitamin C on growth, gonad development and antioxidant ability of on-growing gibel carp (Carassius auratus gibelio var. CAS III). Aquac. Res. 2018, 49, 1242–1249. [Google Scholar] [CrossRef]
- James, R.; Vasudhevan, I. Effect of dietary vitamin C on growth, reproduction and leucocyte counts in the gold fish, Carassius auratus (Linnaeus, 1758). Indian J. Fish. 2011, 58, 65–71. [Google Scholar]
- Phillips, K.; Hamid, N.; Silcock, P.; Delahunty, C.; Barker, M.; Bremer, P. Effect of season on the sensory quality of sea urchin (Evechinus chloroticus) roe. J. Food Sci. 2010, 75, S20–S30. [Google Scholar] [CrossRef]
- Aussanasuwannakul, A.; Kenney, P.B.; Weber, G.M.; Yao, J.; Slider, S.D.; Manor, M.L.; Salem, M. Effect of sexual maturation on growth, fillet composition, and texture of female rainbow trout (Oncorhynchus mykiss) on a high nutritional plane. Aquaculture. 2011, 317, 79–88. [Google Scholar] [CrossRef]
- Ram, R.; Chand, R.V.; Forrest, A.; Southgate, P.C. Effect of processing method on quality, texture, collagen and amino acid composition of sandfsh (Holothuria scabra). LWT Food Sci. Technol. 2017, 86, 261–269. [Google Scholar] [CrossRef]
- Li, Y.; Schellhorn, H.E. New developments and novel therapeutic perspectives for vitamin C. J. Nutr. 2007, 137, 2171–2184. [Google Scholar] [CrossRef]
- Grosso, L.; Rakaj, A.; Fianchini, A.; Tancioni, L.; Vizzini, S.; Boudouresque, C.F.; Scardi, M. Trophic requirements of the sea urchin Paracentrotus lividus varies at different life stages: Comprehension of species ecology and implications for effective feeding formulations. Front. Mar. Sci. 2022, 9, 865450. [Google Scholar] [CrossRef]
- Takagi, S.; Murata, Y.; Inomata, E.; Aoki, M.N.; Agatsuma, Y. Production of high quality gonads in the sea urchin Mesocentrotus nudus (A. Agassiz, 1864) from a barren by feeding on the kelp Saccharina japonica at the late sporophyte stage. J. Appl. Phycol. 2019, 31, 4037–4048. [Google Scholar] [CrossRef]
- Li, X.; Bickerdike, R.; Nickell, D.; Campbell, P.; Dingwall, A.; Johnston, I.A. Investigations on the effects of growth rate and dietary vitamin C on skeletal muscle collagen and hydroxylysyl pyridinoline cross-link concentration in farmed Atlantic salmon (Salmo salar). J. Agric. Food Chem. 2007, 55, 510–515. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Wang, C.; Cai, Q.F.; Zhang, Q.; Weng, L.; Liu, G.M.; Su, W.J.; Cao, M.J. Matrix metalloproteinase 2 (MMP-2) plays a critical role in the softening of common carp muscle during chilled storage by degradation of type I and V collagens. J. Agric. Food Chem. 2015, 63, 10948–10956. [Google Scholar] [CrossRef]
- Mitra, D.; Yasui, O.W.; Harvestine, J.N.; Link, J.M.; Hu, J.C.; Athanasiou, K.A.; Leach, J.K. Exogenous lysyl oxidase-like 2 and perfusion culture induce collagen crosslink formation in osteogenic grafts. Biotechnol. J. 2019, 14, 1700763. [Google Scholar] [CrossRef]
- Myllyharju, J. Prolyl 4-hydroxylases, key enzymes in the synthesis of collagens and regulation of the response to hypoxia, and their roles as treatment targets. Ann. Med. 2008, 40, 402–417. [Google Scholar] [CrossRef]
Formulated Feeds with Varying Concentrations of Vitamin C | |||
---|---|---|---|
Ingredients (%) | C0 | C3000 | C6000 |
Casein vitamins free 1 | 15.00 | 15.00 | 15.00 |
Gelatin 2 | 2.00 | 2.00 | 2.00 |
Wheat meal 3 | 20.00 | 20.00 | 20.00 |
Kelp meal 4 | 15.00 | 15.00 | 15.00 |
Microcrystalline cellulose | 19.31 | 19.01 | 18.71 |
Braised corn flour 5 | 20.00 | 20.00 | 20.00 |
Vitamin C 6 | 0 | 0.3 | 0.6 |
Vitamin premix 7 | 2 | 2 | 2 |
Mineral premix 8 | 2 | 2 | 2 |
Calcium propionate | 0.18 | 0.18 | 0.18 |
Choline chloride | 0.1 | 0.1 | 0.1 |
Ethoxyquin | 0.01 | 0.01 | 0.01 |
Soybean lecithin | 1 | 1 | 1 |
Fish oil (FO) | 2.4 | 2.4 | 2.4 |
Ca (H2PO4)2 | 1 | 1 | 1 |
Proximate composition | |||
Crude protein | 19.26 | 19.25 | 19.23 |
Crude lipid | 4.32 | 4.30 | 4.31 |
VC actual contents | 0.0001 | 0.2907 | 0.5868 |
Gene Abbreviation | Primer | Annealing Temperature (°C) | Amplicon Size (bp) | Amplification Efficiency (%) | Sequence Number |
---|---|---|---|---|---|
colp1α 1 | F: TCAGTTCAGTGTCAGCGGATGTC R: ATGTTGCCTTCCAAGATGCCAATG | 56 | 112 | 99 | NM_214510.1 |
colp2α 2 | F: GCACAGGTTCTTCTAAGCACAAGTC R: GTCATCACGCACGATACAAGCATAC | 58 | 140 | 97 | NM_214510.1 |
colp3α 3 | F: CAGGCAGCAACAGGAAACGATAC R: ATGATGGTGGCGGTGATGATGG | 59 | 141 | 98 | NM_214466.1 |
snip1 4 | F: GATAGGAGAGGCAATAGGCAGGAAC R: ACCTTCGTCTTCATCGTTTGTTTGG | 58 | 138 | 105 | XM_030995288.1 |
tgfβr1 5 | F: AAGGTGATGAAGGAGTGCTGGTATC R: TGCGAGGCGTCACAGGTATTC | 59 | 149 | 96 | XM_793363.5 |
tgfβr2 6 | F: GGTCATCGTCGTCTGTTCCGTAG R: ATGCTCGTGCTCTCCGTGTTG | 56 | 150 | 97 | XM_030972891.1 |
mmp14 7 | F: CAGTGAGACTATGGCGATGATGAAC R: GGTCCTGTTGATGATCCTATAAGTGAG | 59 | 145 | 102 | NM_001033651.1 |
p4hβ 8 | F: ATGGAGGAGGATGAGGAGATTGAC R: AGACTTGGGATGGACGCAGAC | 59 | 141 | 101 | NM_214532.1 |
loxl2 9 | F: TCTTGTTGTCCTTCTTCCAGTTCTTC R: CAGTTCTCCTCAGCAGCACATTG | 58 | 120 | 104 | NM_001079547.1 |
18s 10 | F: GTTCGAAGGCGATCAGATAC R: CTGTCAATCCTCACTGTGTC | 58 | 145 | 96 | D14365.1 |
Feeds Added with Different Concentrations of Vitamin C | Kelp | |||
---|---|---|---|---|
C0 | C3000 | C6000 | ||
Gonad Weight (g) | 1.30 ± 0.05 b | 1.47 ± 0.07 c | 1.16 ± 0.05 b | 0.35 ± 0.02 a |
Gonadosomatic Index (%) | 17.45 ± 0.45 b | 19.50 ± 0.50 c | 16.33 ± 0.47 b | 3.88 ± 0.20 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, H.; Gong, P.; Gou, D.; Cao, J.; Di, W.; Ding, J.; Chang, Y.; Zuo, R. Effects of Vitamin C on the Gonad Growth, Texture Traits, Collagen Content and Synthesis Related Gene Expression of Sea Urchin (Mesocentrotus nudus). Animals 2024, 14, 2564. https://doi.org/10.3390/ani14172564
Liu H, Gong P, Gou D, Cao J, Di W, Ding J, Chang Y, Zuo R. Effects of Vitamin C on the Gonad Growth, Texture Traits, Collagen Content and Synthesis Related Gene Expression of Sea Urchin (Mesocentrotus nudus). Animals. 2024; 14(17):2564. https://doi.org/10.3390/ani14172564
Chicago/Turabian StyleLiu, Haijing, Panke Gong, Dan Gou, Jiahao Cao, Weixiao Di, Jun Ding, Yaqing Chang, and Rantao Zuo. 2024. "Effects of Vitamin C on the Gonad Growth, Texture Traits, Collagen Content and Synthesis Related Gene Expression of Sea Urchin (Mesocentrotus nudus)" Animals 14, no. 17: 2564. https://doi.org/10.3390/ani14172564