Responses of Intestinal Antioxidant Capacity, Morphology, Barrier Function, Immunity, and Microbial Diversity to Chlorogenic Acid in Late-Peak Laying Hens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatment Schedule
2.2. Sample Collections
2.3. Intestinal Antioxidant Capacity and Immune Factor Assays
2.4. Histomorphology Studies
2.5. Microbial Diversity Measurement
2.6. Total RNA Extraction and qRT-PCR Analysis
2.7. Data Analysis
3. Results
3.1. Effects of CGA on Intestinal Antioxidant Capacity
3.2. Effects of CGA on Intestinal Morphology
3.3. Effects of CGA on the Intestinal Barrier
3.4. Effects of CGA on Aryl Hydrocarbon Receptor (AHR) Pathway in Intestine
3.5. Effects of CGA on Immunity
3.6. Effects of CGA on Expression of Intestinal Immune-Related Genes
3.7. Effects of CGA on Cecal Microbiota
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dal Pont, G.C.; Belote, B.L.; Lee, A.; Bortoluzzi, C.; Eyng, C.; Sevastiyanova, M.; Khadem, A.; Santin, E.; Farnell, Y.Z.; Gougoulias, C.; et al. Novel models for chronic intestinal inflammation in chickens: Intestinal inflammation pattern and biomarkers. Front. Immunol. 2021, 12, 676628. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Xiong, K.; Fang, R.; Li, M. Weaning stress and intestinal health of piglets: A review. Front. Immunol. 2022, 13, 1042778. [Google Scholar] [CrossRef] [PubMed]
- Pabst, R.; Russell, M.W.; Brandtzaeg, P. Tissue distribution of lymphocytes and plasma cells and the role of the gut. Trends Immunol. 2008, 29, 206–208; author reply 209–210. [Google Scholar] [CrossRef] [PubMed]
- Caricilli, A.M.; Castoldi, A.; Camara, N.O. Intestinal barrier: A gentlemen’s agreement between microbiota and immunity. World J. Gastrointest. Pathophysiol. 2014, 5, 18–32. [Google Scholar] [CrossRef] [PubMed]
- Rooks, M.G.; Garrett, W.S. Gut microbiota, metabolites and host immunity. Nat. Rev. Immunol. 2016, 16, 341–352. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, L.; Sun, X.; Wan, X.; Sun, G.; Jiang, R.; Li, W.; Tian, Y.; Liu, X.; Kang, X. Characteristics of the fecal microbiota of high- and low-yield hens and effects of fecal microbiota transplantation on egg production performance. Res. Vet. Sci. 2020, 129, 164–173. [Google Scholar] [CrossRef]
- Nii, T. Relationship between mucosal barrier function of the oviduct and intestine in the productivity of laying hens. J. Poult. Sci. 2022, 59, 105–113. [Google Scholar] [CrossRef]
- Wang, W.W.; Wang, J.; Zhang, H.J.; Wu, S.G.; Qi, G.H. Transcriptome analysis reveals mechanism underlying the differential intestinal functionality of laying hens in the late phase and peak phase of production. BMC Genom. 2019, 20, 970. [Google Scholar] [CrossRef]
- Upadhyay, R.; Mohan Rao, L.J. An outlook on chlorogenic acids-occurrence, chemistry, technology, and biological activities. Crit. Rev. Food Sci. Nutr. 2013, 53, 968–984. [Google Scholar] [CrossRef]
- Uranishi, R.; Aedla, R.; Alsaadi, D.H.M.; Wang, D.; Kusakari, K.; Osaki, H.; Sugimura, K.; Watanabe, T. Evaluation of environmental factor effects on the polyphenol and flavonoid content in the leaves of chrysanthemum indicum l. And its habitat suitability prediction mapping. Molecules 2024, 29, 927. [Google Scholar] [CrossRef]
- Ding, Y.; Cao, Z.; Cao, L.; Ding, G.; Wang, Z.; Xiao, W. Antiviral activity of chlorogenic acid against influenza a (h1n1/h3n2) virus and its inhibition of neuraminidase. Sci. Rep. 2017, 7, 45723. [Google Scholar] [CrossRef] [PubMed]
- Naveed, M.; Hejazi, V.; Abbas, M.; Kamboh, A.A.; Khan, G.J.; Shumzaid, M.; Ahmad, F.; Babazadeh, D.; FangFang, X.; Modarresi-Ghazani, F.; et al. Chlorogenic acid (cga): A pharmacological review and call for further research. Biomed. Pharmacother. 2018, 97, 67–74. [Google Scholar] [CrossRef] [PubMed]
- La Rosa, G.; Sozio, C.; Pipicelli, L.; Raia, M.; Palmiero, A.; Santillo, M.; Damiano, S. Antioxidant, anti-inflammatory and pro-differentiative effects of chlorogenic acid on m03-13 human oligodendrocyte-like cells. Int. J. Mol. Sci. 2023, 24, 16731. [Google Scholar] [CrossRef] [PubMed]
- Ramdani, D.; Yuniarti, E.; Jayanegara, A.; Chaudhry, A.S. Roles of essential oils, polyphenols, and saponins of medicinal plants as natural additives and anthelmintics in ruminant diets: A systematic review. Animals 2023, 13, 767. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.; Moore, R.J.; Stanley, D.; Chousalkar, K.K. The gut microbiota of laying hens and its manipulation with prebiotics and probiotics to enhance gut health and food safety. Appl. Environ. Microbiol. 2020, 86, e00600-20. [Google Scholar] [CrossRef]
- Lafay, S.; Gil-Izquierdo, A.; Manach, C.; Morand, C.; Besson, C.; Scalbert, A. Chlorogenic acid is absorbed in its intact form in the stomach of rats. J. Nutr. 2006, 136, 1192–1197. [Google Scholar] [CrossRef]
- Gonthier, M.P.; Verny, M.A.; Besson, C.; Remesy, C.; Scalbert, A. Chlorogenic acid bioavailability largely depends on its metabolism by the gut microflora in rats. J. Nutr. 2003, 133, 1853–1859. [Google Scholar] [CrossRef]
- Santana-Galvez, J.; Cisneros-Zevallos, L.; Jacobo-Velazquez, D.A. Chlorogenic acid: Recent advances on its dual role as a food additive and a nutraceutical against metabolic syndrome. Molecules 2017, 22, 358. [Google Scholar] [CrossRef]
- Lou, Z.; Wang, H.; Zhu, S.; Ma, C.; Wang, Z. Antibacterial activity and mechanism of action of chlorogenic acid. J. Food Sci. 2011, 76, M398–M403. [Google Scholar] [CrossRef]
- Bajko, E.; Kalinowska, M.; Borowski, P.; Siergiejczyk, L.; Lewandowski, W. 5-o-caffeoylquinic acid: A spectroscopic study and biological screening for antimicrobial activity. LWT-Food Sci. Technol. 2016, 65, 471–479. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, Y.; Chen, D.; Yu, B.; Zheng, P.; Mao, X.; Luo, Y.; Li, Y.; He, J. Dietary chlorogenic acid supplementation affects gut morphology, antioxidant capacity and intestinal selected bacterial populations in weaned piglets. Food Funct. 2018, 9, 4968–4978. [Google Scholar] [CrossRef]
- Chen, F.; Zhang, H.; Zhao, N.; Yang, X.; Du, E.; Huang, S.; Guo, W.; Zhang, W.; Wei, J. Effect of chlorogenic acid on intestinal inflammation, antioxidant status, and microbial community of young hens challenged with acute heat stress. Anim. Sci. J. 2021, 92, e13619. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.Q.; Zhang, Y.; Bai, D.Y.; Liu, Y.H.; He, X.L.; Ito, K.; Liu, K.X.; Tan, H.Q.; Zhen, W.R.; Zhang, C.; et al. Effects of dietary chlorogenic acid on ileal intestinal morphology, barrier function, immune factors and gut microbiota of broilers under high stocking density stress. Front. Physiol. 2023, 14, 1169375. [Google Scholar] [CrossRef]
- Liu, H.; Li, X.; Shi, S.; Zhou, Y.; Zhang, K.; Wang, Y.; Zhao, J. Chlorogenic acid improves growth performance and intestinal health through autophagy-mediated nuclear factor erythroid 2-related factor 2 pathway in oxidatively stressed broilers induced by dexamethasone. Poult. Sci. 2022, 101, 102036. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.Y.; Duan, Y.L.; Zhu, Y.; Wang, J.H.; Hu, Q.B.; Guo, S.S.; Ding, B.Y.; Zhang, Z.F.; Li, L.L. Responses of intestinal morphology, immunity, antioxidant status and cecal microbiota to the mixture of glycerol monolaurate and cinnamaldehyde in laying hens. Poult. Sci. 2024, 103, 103645. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Li, X.; Liu, Y.; Wang, S.; Cheng, D. Protection mechanisms underlying oral administration of chlorogenic acid against cadmium-induced hepatorenal injury related to regulating intestinal flora balance. J. Agric. Food Chem. 2021, 69, 1675–1683. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Lauridsen, C. From oxidative stress to inflammation: Redox balance and immune system. Poult. Sci. 2019, 98, 4240–4246. [Google Scholar] [CrossRef]
- John, L.J.; Fromm, M.; Schulzke, J.D. Epithelial barriers in intestinal inflammation. Antioxid. Redox Signal 2011, 15, 1255–1270. [Google Scholar] [CrossRef]
- Martemucci, G.; Portincasa, P.; Centonze, V.; Mariano, M.; Khalil, M.; D’Alessandro, A.G. Prevention of oxidative stress and diseases by antioxidant supplementation. Med. Chem. 2023, 19, 509–537. [Google Scholar] [CrossRef]
- Limon-Pacheco, J.; Gonsebatt, M.E. The role of antioxidants and antioxidant-related enzymes in protective responses to environmentally induced oxidative stress. Mutat. Res. 2009, 674, 137–147. [Google Scholar] [CrossRef] [PubMed]
- Liang, N.; Kitts, D.D. Role of chlorogenic acids in controlling oxidative and inflammatory stress conditions. Nutrients 2015, 8, 16. [Google Scholar] [CrossRef] [PubMed]
- Gopinger, E.; Xavier, E.G.; Elias, M.C.; Catalan, A.A.; Castro, M.L.; Nunes, A.P.; Roll, V.F. The effect of different dietary levels of canola meal on growth performance, nutrient digestibility, and gut morphology of broiler chickens. Poult. Sci. 2014, 93, 1130–1136. [Google Scholar] [CrossRef] [PubMed]
- Viveros, A.; Chamorro, S.; Pizarro, M.; Arija, I.; Centeno, C.; Brenes, A. Effects of dietary polyphenol-rich grape products on intestinal microflora and gut morphology in broiler chicks. Poult. Sci. 2011, 90, 566–578. [Google Scholar] [CrossRef] [PubMed]
- Munyaka, P.M.; Echeverry, H.; Yitbarek, A.; Camelo-Jaimes, G.; Sharif, S.; Guenter, W.; House, J.D.; Rodriguez-Lecompte, J.C. Local and systemic innate immunity in broiler chickens supplemented with yeast-derived carbohydrates. Poult. Sci. 2012, 91, 2164–2172. [Google Scholar] [CrossRef]
- Gao, C.; Koko, M.Y.; Hong, W.; Gankhuyag, J.; Hui, M.; Gantumur, M.A.; Dong, N. Protective properties of intestinal alkaline phosphatase supplementation on the intestinal barrier: Interactions and effects. J. Agric. Food Chem. 2024, 72, 27–45. [Google Scholar] [CrossRef]
- Ballard, S.T.; Hunter, J.H.; Taylor, A.E. Regulation of tight-junction permeability during nutrient absorption across the intestinal epithelium. Annu. Rev. Nutr. 1995, 15, 35–55. [Google Scholar] [CrossRef]
- Duangnumsawang, Y.; Zentek, J.; Goodarzi Boroojeni, F. Development and functional properties of intestinal mucus layer in poultry. Front. Immunol. 2021, 12, 745849. [Google Scholar] [CrossRef]
- Chen, J.; Yu, B.; Chen, D.; Zheng, P.; Luo, Y.; Huang, Z.; Luo, J.; Mao, X.; Yu, J.; He, J. Changes of porcine gut microbiota in response to dietary chlorogenic acid supplementation. Appl. Microbiol. Biotechnol. 2019, 103, 8157–8168. [Google Scholar] [CrossRef]
- Gronke, K.; Hernandez, P.P.; Zimmermann, J.; Klose, C.S.N.; Kofoed-Branzk, M.; Guendel, F.; Witkowski, M.; Tizian, C.; Amann, L.; Schumacher, F.; et al. Interleukin-22 protects intestinal stem cells against genotoxic stress. Nature 2019, 566, 249–253. [Google Scholar] [CrossRef]
- Geng, S.; Cheng, S.; Li, Y.; Wen, Z.; Ma, X.; Jiang, X.; Wang, Y.; Han, X. Faecal microbiota transplantation reduces susceptibility to epithelial injury and modulates tryptophan metabolism of the microbial community in a piglet model. J. Crohns Colitis 2018, 12, 1359–1374. [Google Scholar] [CrossRef] [PubMed]
- Lindemans, C.A.; Calafiore, M.; Mertelsmann, A.M.; O’Connor, M.H.; Dudakov, J.A.; Jenq, R.R.; Velardi, E.; Young, L.F.; Smith, O.M.; Lawrence, G.; et al. Interleukin-22 promotes intestinal-stem-cell-mediated epithelial regeneration. Nature 2015, 528, 560–564. [Google Scholar] [CrossRef] [PubMed]
- Hou, Q.; Ye, L.; Liu, H.; Huang, L.; Yang, Q.; Turner, J.R.; Yu, Q. Lactobacillus accelerates iscs regeneration to protect the integrity of intestinal mucosa through activation of stat3 signaling pathway induced by lpls secretion of il-22. Cell Death Differ. 2018, 25, 1657–1670. [Google Scholar] [CrossRef] [PubMed]
- Prigent, L.; Robineau, M.; Jouneau, S.; Morzadec, C.; Louarn, L.; Vernhet, L.; Fardel, O.; Sparfel, L. The aryl hydrocarbon receptor is functionally upregulated early in the course of human t-cell activation. Eur. J. Immunol. 2014, 44, 1330–1340. [Google Scholar] [CrossRef] [PubMed]
- Pernomian, L.; Duarte-Silva, M.; de Barros Cardoso, C.R. The aryl hydrocarbon receptor (ahr) as a potential target for the control of intestinal inflammation: Insights from an immune and bacteria sensor receptor. Clin. Rev. Allergy Immunol. 2020, 59, 382–390. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Zeng, F.; Han, P.; Zhang, L.; Yang, L.; Zhou, F.; Liu, Q.; Ruan, Z. Dietary chlorogenic acid alleviates high-fat diet-induced steatotic liver disease by regulating metabolites and gut microbiota. Int. J. Food Sci. Nutr. 2024, 75, 369–384. [Google Scholar] [CrossRef] [PubMed]
- Chaplin, D.D. Overview of the immune response. J. Allergy Clin. Immunol. 2010, 125, S3–S23. [Google Scholar] [CrossRef] [PubMed]
- Mantis, N.J.; Rol, N.; Corthesy, B. Secretory iga’s complex roles in immunity and mucosal homeostasis in the gut. Mucosal Immunol. 2011, 4, 603–611. [Google Scholar] [CrossRef]
- Adoga, M.P.; Pennap, G.R.; John, P.A.; Shawulu, P.T.; Kaba, S.V.; Forbi, J.C.; Agwale, S.M. Cd4- and cd3-t lymphocyte reference values of immunocompetent urban and rural subjects in an african nation. Scand. J. Immunol. 2012, 76, 33–38. [Google Scholar] [CrossRef] [PubMed]
- Koskinen, R.; Salomonsen, J.; Tregaskes, C.A.; Young, J.R.; Goodchild, M.; Bumstead, N.; Vainio, O. The chicken cd4 gene has remained conserved in evolution. Immunogenetics 2002, 54, 520–525. [Google Scholar] [CrossRef] [PubMed]
- Doucey, M.A.; Goffin, L.; Naeher, D.; Michielin, O.; Baumgartner, P.; Guillaume, P.; Palmer, E.; Luescher, I.F. Cd3 delta establishes a functional link between the t cell receptor and cd8. J. Biol. Chem. 2003, 278, 3257–3264. [Google Scholar] [CrossRef] [PubMed]
- Rashidi, R.; Rezaee, R.; Shakeri, A.; Hayes, A.W.; Karimi, G. A review of the protective effects of chlorogenic acid against different chemicals. J. Food Biochem. 2022, 46, e14254. [Google Scholar] [CrossRef] [PubMed]
- Zhao, T.; Huang, H.; Li, J.; Shen, J.; Zhou, C.; Xiao, R.; Ma, W. Association between erythrocyte membrane fatty acids and gut bacteria in obesity-related cognitive dysfunction. AMB Express 2023, 13, 148. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Zhao, M.; Zhang, Y.; Fu, Z.; Jin, T.; Song, J.; Huang, Y.; Zhao, C.; Wang, M. Bile acids metabolism involved in the beneficial effects of danggui shaoyao san via gut microbiota in the treatment of ccl(4) induced hepatic fibrosis. J. Ethnopharmacol. 2024, 319, 117383. [Google Scholar] [CrossRef]
- Martin-Gallausiaux, C.; Marinelli, L.; Blottiere, H.M.; Larraufie, P.; Lapaque, N. Scfa: Mechanisms and functional importance in the gut. Proc. Nutr. Soc. 2021, 80, 37–49. [Google Scholar] [CrossRef]
- Barcenilla, A.; Pryde, S.E.; Martin, J.C.; Duncan, S.H.; Stewart, C.S.; Henderson, C.; Flint, H.J. Phylogenetic relationships of butyrate-producing bacteria from the human gut. Appl. Environ. Microbiol. 2000, 66, 1654–1661. [Google Scholar] [CrossRef]
- Van den Abbeele, P.; Belzer, C.; Goossens, M.; Kleerebezem, M.; De Vos, W.M.; Thas, O.; De Weirdt, R.; Kerckhof, F.M.; Van de Wiele, T. Butyrate-producing clostridium cluster xiva species specifically colonize mucins in an in vitro gut model. ISME J. 2013, 7, 949–961. [Google Scholar] [CrossRef]
- Vacca, M.; Celano, G.; Calabrese, F.M.; Portincasa, P.; Gobbetti, M.; De Angelis, M. The controversial role of human gut lachnospiraceae. Microorganisms 2020, 8, 573. [Google Scholar] [CrossRef]
- Appert, O.; Garcia, A.R.; Frei, R.; Roduit, C.; Constancias, F.; Neuzil-Bunesova, V.; Ferstl, R.; Zhang, J.; Akdis, C.; Lauener, R.; et al. Initial butyrate producers during infant gut microbiota development are endospore formers. Environ. Microbiol. 2020, 22, 3909–3921. [Google Scholar] [CrossRef]
- Bui, T.P.; Ritari, J.; Boeren, S.; de Waard, P.; Plugge, C.M.; de Vos, W.M. Production of butyrate from lysine and the amadori product fructoselysine by a human gut commensal. Nat. Commun. 2015, 6, 10062. [Google Scholar] [CrossRef]
- Gophna, U.; Konikoff, T.; Nielsen, H.B. Oscillospira and related bacteria—From metagenomic species to metabolic features. Environ. Microbiol. 2017, 19, 835–841. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Li, Y.; Wen, Z.; Liu, W.; Meng, L.; Huang, H. Oscillospira—A candidate for the next-generation probiotics. Gut Microbes 2021, 13, 1987783. [Google Scholar] [CrossRef] [PubMed]
- Geissinger, O.; Herlemann, D.P.; Morschel, E.; Maier, U.G.; Brune, A. The ultramicrobacterium “elusimicrobium minutum” gen. Nov., sp. Nov., the first cultivated representative of the termite group 1 phylum. Appl. Environ. Microbiol. 2009, 75, 2831–2840. [Google Scholar] [CrossRef] [PubMed]
- Carlier, J.P.; Bedora-Faure, M.; K’Ouas, G.; Alauzet, C.; Mory, F. Proposal to unify clostridium orbiscindens winter et al. 1991 and eubacterium plautii (seguin 1928) hofstad and aasjord 1982, with description of flavonifractor plautii gen. Nov., comb. Nov., and reassignment of bacteroides capillosus to pseudoflavonifractor capillosus gen. Nov., comb. Nov. Int. J. Syst. Evol. Microbiol. 2010, 60, 585–590. [Google Scholar] [PubMed]
- Sakamoto, M.; Iino, T.; Yuki, M.; Ohkuma, M. Lawsonibacter asaccharolyticus gen. Nov., sp. Nov., a butyrate-producing bacterium isolated from human faeces. Int. J. Syst. Evol. Microbiol. 2018, 68, 2074–2081. [Google Scholar] [CrossRef]
- Elshaghabee, F.M.F.; Rokana, N.; Gulhane, R.D.; Sharma, C.; Panwar, H. Bacillus as potential probiotics: Status, concerns, and future perspectives. Front. Microbiol. 2017, 8, 1490. [Google Scholar] [CrossRef] [PubMed]
- Martin, R.; Chamignon, C.; Mhedbi-Hajri, N.; Chain, F.; Derrien, M.; Escribano-Vazquez, U.; Garault, P.; Cotillard, A.; Pham, H.P.; Chervaux, C.; et al. The potential probiotic lactobacillus rhamnosus cncm i-3690 strain protects the intestinal barrier by stimulating both mucus production and cytoprotective response. Sci. Rep. 2019, 9, 5398. [Google Scholar] [CrossRef]
- Mingmongkolchai, S.; Panbangred, W. Bacillus probiotics: An alternative to antibiotics for livestock production. J. Appl. Microbiol. 2018, 124, 1334–1346. [Google Scholar] [CrossRef]
- Gadde, U.; Oh, S.T.; Lee, Y.S.; Davis, E.; Zimmerman, N.; Rehberger, T.; Lillehoj, H.S. The effects of direct-fed microbial supplementation, as an alternative to antibiotics, on growth performance, intestinal immune status, and epithelial barrier gene expression in broiler chickens. Probiotics Antimicrob. Proteins 2017, 9, 397–405. [Google Scholar] [CrossRef]
- Du, W.; Xu, H.; Mei, X.; Cao, X.; Gong, L.; Wu, Y.; Li, Y.; Yu, D.; Liu, S.; Wang, Y.; et al. Probiotic bacillus enhance the intestinal epithelial cell barrier and immune function of piglets. Benef. Microbes 2018, 9, 743–754. [Google Scholar] [CrossRef]
- Dempsey, E.; Corr, S.C. Lactobacillus spp. For gastrointestinal health: Current and future perspectives. Front. Immunol. 2022, 13, 840245. [Google Scholar] [CrossRef] [PubMed]
- Zelante, T.; Iannitti, R.G.; Cunha, C.; De Luca, A.; Giovannini, G.; Pieraccini, G.; Zecchi, R.; D’Angelo, C.; Massi-Benedetti, C.; Fallarino, F.; et al. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39, 372–385. [Google Scholar] [CrossRef] [PubMed]
- Cristofori, F.; Dargenio, V.N.; Dargenio, C.; Miniello, V.L.; Barone, M.; Francavilla, R. Anti-inflammatory and immunomodulatory effects of probiotics in gut inflammation: A door to the body. Front. Immunol. 2021, 12, 578386. [Google Scholar] [CrossRef] [PubMed]
- Shin, N.R.; Lee, J.C.; Lee, H.Y.; Kim, M.S.; Whon, T.W.; Lee, M.S.; Bae, J.W. An increase in the akkermansia spp. Population induced by metformin treatment improves glucose homeostasis in diet-induced obese mice. Gut 2014, 63, 727–735. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Lu, X.; Liu, L.; Voglmeir, J.; Zhong, X.; Yu, Q. Akkermansia muciniphila protects intestinal mucosa from damage caused by s. Pullorum by initiating proliferation of intestinal epithelium. Vet. Res. 2020, 51, 34. [Google Scholar] [CrossRef]
Items | Value (%) | Nutrient Content § | Value |
---|---|---|---|
Corn | 61.85 | Metabolism energy, MJ/Kg | 11.07 |
Soybean meal (43% CP) | 25.00 | Crude protein, % | 16.33 |
Fish meal (67% CP) | 0.50 | Ether extract, % | 3.23 |
Soybean oil | 0.50 | Lysine, % | 0.84 |
Limestone | 7.00 | Methionine, % | 0.36 |
DL-Met (99.8%) | 0.10 | Methionine + cystine, % | 0.68 |
L-Cys (99.0%) | 0.05 | Available phosphorus, % | 0.32 |
Premix † | 5.00 | Calcium, % | 3.53 |
Total | 100.00 |
Target Gene | Primer | Primer Sequence (5′-3′) | Accession No. | Product Size (bp) |
---|---|---|---|---|
β-actin | Forward | TCCCTGGAGAAGAGCTATGAA | NM_205518.1 | 113 |
Reverse | CAGGACTCCATACCCAAGAAAG | |||
ZO-1 | Forward | GATCTCCCTAAAGGCGAAGAAG | XM_046925209.1 | 415 |
Reverse | GAACAGGCTGAGCAGAAAGA | |||
Claudin-1 | Forward | GCTCACCAAAGAGGGAAGAA | NM_001013611.2 | 446 |
Reverse | GTACAGGTCAGCATCAGATCAA | |||
Occludin | Forward | CTCTGCCTCATCTGCTTCTT | NM_205128.1 | 418 |
Reverse | CATACTGGGACTCATCCAACTC | |||
Mucin-2 | Forward | TTCATGATGCCTGCTCTTGTG | XM_040673077.2 | 93 |
Reverse | CCTGAGCCTTGGTACATTCTTGT | |||
TLR4 | Forward | GGAGTTGAGAGTGCTTCGTATT | NM_001030693.2 | 276 |
Reverse | GGGTAGGTGCCATGATGAATTA | |||
Myd88 | Forward | TCTGGTGACTGTGGAGCAAGGAA | NM_001030962.5 | 207 |
Reverse | CCGCTTGTAGGAAGGCACTAATGG | |||
IL-1β | Forward | CTCTACATGTCGTGTGTGATGAG | NM_204524.2 | 249 |
Reverse | CTTGTAGGTGGCGATGTTGA | |||
CD3D | Forward | TGCATCACTGGGCAAGATAA | NM_205512.2 | 250 |
Reverse | CAGCAGCAAGTTCACAACAC | |||
CD4 | Forward | CATTCCCAGCCCTTCAGTTT | NM_204649.2 | 218 |
Reverse | CCAAGTACAGGTCCCATCTTTC | |||
NF-κB | Forward | CTCCTCAACCTCACTTCCTTAC | NM_001396396.1 | 205 |
Reverse | GCTGTGTGCTTTACCTCTTTG | |||
IgA | Forward | ACCACGGCTCTGACTGTACC | S40610.1 | 100 |
Reverse | CGATGGTCTCCTTCACATCA | |||
INF-γ | Forward | AAAGCCGCACATCAAACACA | NM_205149.2 | 64 |
Reverse | GCCATCAGGAAGGTTGTTTTTC | |||
IL-22 | Forward | CTGCTGTTGTTGCTGTTTCC | NM_001199614.1 | 231 |
Reverse | CGGTTGTTCTCCCTGATGTT | |||
AHR | Forward | CTCATCTGGGTTTCTGGCTATG | XM_046910172.1 | 348 |
Reverse | CTCTCACCCGTCTTCATCATTC | |||
STAT3 | Forward | CACCACTGCTTTCCCTATTCT | NM_001398323.1 | 390 |
Reverse | CTTCCTTTGTCCACCCTTCTT |
Items | CGA 2 (mg/kg) | p-Value | |||
---|---|---|---|---|---|
0 (Control) | 400 | 600 | 800 | ||
MDA 2, mmol/mgprot | 5.36 ± 0.47 a | 2.71 ± 0.39 b | 3.40 ± 0.57 b | 2.07 ± 0.27 b | 0.001 |
GSH-Px 2, U/mgprot | 278.44 ± 12.32 b | 246.08 ± 19.44 b | 377.90 ± 18.18 a | 251.26 ± 29.61 b | 0.001 |
T-SOD 2, U/mgprot | 561.74 ± 23.05 | 536.25 ± 31.68 | 555.75 ± 47.70 | 542.92 ± 36.29 | 0.956 |
CAT 2, U/mgprot | 12.82 ± 0.56 | 12.68 ± 1.24 | 12.50 ± 0.84 | 10.88 ± 0.74 | 0.387 |
H2O2 2, mmol/gprot | 7.50 ± 0.32 a | 5.18 ± 0.34 b | 5.14 ± 0.54 b | 5.59 ± 0.59 b | 0.005 |
Items | CGA 2 (mg/kg) | p-Value | |||
---|---|---|---|---|---|
0 (Control) | 400 | 600 | 800 | ||
Duodenum | |||||
VH 2, μm | 1373.22 ± 44.48 c | 1551.08 ± 37.75 b | 1527.68 ± 15.78 b | 1716.70 ± 37.19 a | <0.001 |
CD 2, μm | 103.21 ± 5.60 | 88.53 ± 2.32 | 104.57 ± 4.60 | 97.01 ± 8.90 | 0.313 |
VH/CD 2 | 13.89 ± 1.10 b | 17.65 ± 0.80 ab | 14.82 ± 0.72 ab | 19.05 ± 1.68 a | 0.013 |
Jejunum | |||||
VH, μm | 1317.14 ± 38.59 b | 1217.49 ± 52.24 b | 1515.14 ± 16.57 a | 1198.42 ± 44.23 b | <0.001 |
CD, μm | 121.62 ± 6.89 a | 77.94 ± 5.74 b | 92.56 ± 4.04 b | 94.11 ± 5.05 b | <0.001 |
VH/CD | 11.04 ± 0.52 b | 16.49 ± 1.38 a | 16.62 ± 0.74 a | 13.20 ± 3.45 ab | 0.001 |
Ileum | |||||
VH, μm | 686.38 ± 22.33 c | 1027.15 ± 31.78 b | 1141.39 ± 30.23 a | 969.74 ± 28.72 b | <0.001 |
CD, μm | 99.56 ± 6.94 | 107.29 ± 4.20 | 93.73 ± 4.81 | 96.58 ± 4.59 | 0.311 |
VH/CD | 7.23 ± 0.60 c | 9.76 ± 0.59 b | 12.50 ± 0.77 a | 10.73 ± 1.47 ab | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, Y.; Li, Z.; Yan, M.; Zhao, H.; He, Z.; Zhu, M. Responses of Intestinal Antioxidant Capacity, Morphology, Barrier Function, Immunity, and Microbial Diversity to Chlorogenic Acid in Late-Peak Laying Hens. Animals 2024, 14, 2957. https://doi.org/10.3390/ani14202957
Sun Y, Li Z, Yan M, Zhao H, He Z, Zhu M. Responses of Intestinal Antioxidant Capacity, Morphology, Barrier Function, Immunity, and Microbial Diversity to Chlorogenic Acid in Late-Peak Laying Hens. Animals. 2024; 14(20):2957. https://doi.org/10.3390/ani14202957
Chicago/Turabian StyleSun, Yue, Zhuang Li, Ming Yan, Haitong Zhao, Zhengxing He, and Mingkun Zhu. 2024. "Responses of Intestinal Antioxidant Capacity, Morphology, Barrier Function, Immunity, and Microbial Diversity to Chlorogenic Acid in Late-Peak Laying Hens" Animals 14, no. 20: 2957. https://doi.org/10.3390/ani14202957
APA StyleSun, Y., Li, Z., Yan, M., Zhao, H., He, Z., & Zhu, M. (2024). Responses of Intestinal Antioxidant Capacity, Morphology, Barrier Function, Immunity, and Microbial Diversity to Chlorogenic Acid in Late-Peak Laying Hens. Animals, 14(20), 2957. https://doi.org/10.3390/ani14202957