Comparative Genome Analysis of Two Streptococcus suis Serotype 8 Strains Identifies Two New Virulence-Associated Genes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Cultural Conditions
2.2. DNA Extraction
2.3. Sequencing, Assembly, and Annotation of the Genome Sequencing
2.4. Comparative Genomics
2.5. Analysis of Mobile Genetic Elements (MGEs) and Confirmation of Transposition Mechanism
2.6. Construction of Deletion Mutants
2.7. Mice Infections
3. Results
3.1. Features of Strains 2018WUSS151 and WUSS030 Genomes
3.2. Comparative Genomic Analysis of Strains 2018WUSS151 and WUSS030
3.3. Transposons Carry Genes Unique to Strain 2018WUSS151
3.4. The New Virulence-Associated Genes Discovered in Strain 2018WUSS151
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Vötsch, D.; Willenborg, M.; Weldearegay, Y.B.; Valentin-Weigand, P. Streptococcus suis—The “Two Faces” of a Pathobiont in the Porcine Respiratory Tract. Front. Microbiol. 2018, 9, 480. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.; Wang, C.; Feng, Y.; Yang, W.; Song, H.; Chen, Z.; Yu, H.; Pan, X.; Zhou, X.; Wang, H.; et al. Streptococcal Toxic Shock Syndrome Caused by Streptococcus suis Serotype 2. PLoS Med. 2006, 3, e151. [Google Scholar] [CrossRef]
- Liu, P.; Zhang, Y.; Tang, H.; Wang, Y.; Sun, X. Prevalence of Streptococcus suis in Pigs in China during 2000–2021: A Systematic Review and Meta-Analysis. One Health 2023, 16, 100513. [Google Scholar] [CrossRef] [PubMed]
- Okura, M.; Osaki, M.; Nomoto, R.; Arai, S.; Osawa, R.; Sekizaki, T.; Takamatsu, D. Current Taxonomical Situation of Streptococcus suis. Pathogens 2016, 5, 45. [Google Scholar] [CrossRef] [PubMed]
- Pan, Z.; Ma, J.; Dong, W.; Song, W.; Wang, K.; Lu, C.; Yao, H. Novel Variant Serotype of Streptococcus suis Isolated from Piglets with Meningitis. Appl. Environ. Microbiol. 2015, 81, 976–985. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Ji, S.; Liu, Z.; Lan, R.; Huang, Y.; Bai, X.; Gottschalk, M.; Xu, J. Eight Novel Capsular Polysaccharide Synthesis Gene Loci Identified in Nontypeable Streptococcus suis Isolates. Appl. Environ. Microbiol. 2015, 81, 4111–4119. [Google Scholar] [CrossRef] [PubMed]
- Qiu, X.; Bai, X.; Lan, R.; Zheng, H.; Xu, J. Novel Capsular Polysaccharide Loci and New Diagnostic Tools for High-Throughput Capsular Gene Typing in Streptococcus suis. Appl. Environ. Microbiol. 2016, 82, 7102–7112. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Qiu, X.; Roy, D.; Segura, M.; Du, P.; Xu, J.; Gottschalk, M. Genotyping and Investigating Capsular Polysaccharide Synthesis Gene Loci of Non-Serotypeable Streptococcus suis Isolated from Diseased Pigs in Canada. Vet. Res. 2017, 48, 10. [Google Scholar] [CrossRef]
- Huang, J.; Liu, X.; Chen, H.; Chen, L.; Gao, X.; Pan, Z.; Wang, J.; Lu, C.; Yao, H.; Wang, L.; et al. Identification of Six Novel Capsular Polysaccharide Loci (NCL) from Streptococcus suis Multidrug Resistant Non-Typeable Strains and the Pathogenic Characteristic of Strains Carrying New NCLs. Transbound. Emerg. Dis. 2019, 66, 995–1003. [Google Scholar] [CrossRef]
- Bojarska, A.; Janas, K.; Pejsak, Z.; Otulak-Kozieł, K.; Garbaczewska, G.; Hryniewicz, W.; Sadowy, E. Diversity of Serotypes and New Cps Loci Variants among Streptococcus suis Isolates from Pigs in Poland and Belarus. Vet. Microbiol. 2020, 240, 108534. [Google Scholar] [CrossRef]
- Goyette-Desjardins, G.; Auger, J.-P.; Xu, J.; Segura, M.; Gottschalk, M. Streptococcus suis, an Important Pig Pathogen and Emerging Zoonotic Agent-an Update on the Worldwide Distribution Based on Serotyping and Sequence Typing. Emerg. Microbes Infect. 2014, 3, e45. [Google Scholar] [CrossRef]
- Liang, P.; Wang, M.; Gottschalk, M.; Vela, A.I.; Estrada, A.A.; Wang, J.; Du, P.; Luo, M.; Zheng, H.; Wu, Z. Genomic and Pathogenic Investigations of Streptococcus suis Serotype 7 Population Derived from a Human Patient and Pigs. Emerg. Microbes Infect. 2021, 10, 1960–1974. [Google Scholar] [CrossRef]
- Segura, M.; Aragon, V.; Brockmeier, S.L.; Gebhart, C.; de Greeff, A.; Kerdsin, A.; O’Dea, M.A.; Okura, M.; Saléry, M.; Schultsz, C.; et al. Update on Streptococcus suis Research and Prevention in the Era of Antimicrobial Restriction: 4th International Workshop on S. suis. Pathogens 2020, 9, 374. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Du, P.; Qiu, X.; Kerdsin, A.; Roy, D.; Bai, X.; Xu, J.; Vela, A.I.; Gottschalk, M. Genomic Comparisons of Streptococcus suis Serotype 9 Strains Recovered from Diseased Pigs in Spain and Canada. Vet. Res. 2018, 49, 1. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Sun, J.; Bian, C.; Wang, J.; Liang, Z.; Shen, Y.; Yao, H.; Huang, J.; Wang, L.; Zheng, H.; et al. The Population Structure, Antimicrobial Resistance, and Pathogenicity of Staphylococcus suis cps31. Vet. Microbiol. 2021, 259, 109149. [Google Scholar] [CrossRef]
- Huang, J.; Liang, Y.; Guo, D.; Shang, K.; Ge, L.; Kashif, J.; Wang, L. Comparative Genomic Analysis of the ICESa2603 Family ICEs and Spread of erm(B)- and tet(O)-Carrying Transferable 89K-Subtype ICEs in Swine and Bovine Isolates in China. Front. Microbiol. 2016, 7, 55. [Google Scholar] [CrossRef] [PubMed]
- Goyette-Desjardins, G.; Vinogradov, E.; Okura, M.; Takamatsu, D.; Gottschalk, M.; Segura, M. Structure Determination of Streptococcus suis Serotypes 7 and 8 Capsular Polysaccharides and Assignment of Functions of the cps Locus Genes Involved in Their Biosynthesis. Carbohydr. Res. 2019, 473, 36–45. [Google Scholar] [CrossRef] [PubMed]
- Tarradas, C.; Perea, A.; Vela, A.I.; Goyache, J.; Dominguez, L.; Fernández-Garaizabal, J.F.; Borge, C.; Huerta, B.; Luque, I. Distribution of Serotypes of Streptococcus suis Isolated from Diseased Pigs in Spain. Vet. Rec. 2004, 154, 665–666. [Google Scholar] [CrossRef] [PubMed]
- Fittipaldi, N.; Fuller, T.E.; Teel, J.F.; Wilson, T.L.; Wolfram, T.J.; Lowery, D.E.; Gottschalk, M. Serotype Distribution and Production of Muramidase-Released Protein, Extracellular Factor and Suilysin by Field Strains of Streptococcus suis Isolated in the United States. Vet. Microbiol. 2009, 139, 310–317. [Google Scholar] [CrossRef] [PubMed]
- Gottschalk, M.; Lacouture, S.; Bonifait, L.; Roy, D.; Fittipaldi, N.; Grenier, D. Characterization of Streptococcus suis Isolates Recovered between 2008 and 2011 from Diseased Pigs in Québec, Canada. Vet Microbiol 2013, 162, 819–825. [Google Scholar] [CrossRef]
- Okura, M.; Maruyama, F.; Ota, A.; Tanaka, T.; Matoba, Y.; Osawa, A.; Sadaat, S.M.; Osaki, M.; Toyoda, A.; Ogura, Y.; et al. Genotypic Diversity of Streptococcus suis and the S. suis-like Bacterium Streptococcus ruminantium in Ruminants. Vet. Res. 2019, 50, 94. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Xu, Q.; Liang, P.; Peng, Z.; Yao, H.; Zheng, H.; Wu, Z. The Characteristics of Population Structure and Antimicrobial Resistance of Streptococcus suis Serotype 8, a Non-negligible Pathotype. Transbounding Emerging Dis. 2022, 69, e2495–e2505. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Wang, W.; Tang, M.; Shao, J.; Dai, C.; Zhang, W.; Fan, H.; Yao, H.; Zong, J.; Chen, D.; et al. Comparative Genomic Analysis Shows That Streptococcus suis Meningitis Isolate SC070731 Contains a Unique 105K Genomic Island. Gene 2014, 535, 156–164. [Google Scholar] [CrossRef] [PubMed]
- Ardui, S.; Ameur, A.; Vermeesch, J.R.; Hestand, M.S. Single Molecule Real-Time (SMRT) Sequencing Comes of Age: Applications and Utilities for Medical Diagnostics. Nucleic Acids Res. 2018, 46, 2159–2168. [Google Scholar] [CrossRef] [PubMed]
- Reiner, J.; Pisani, L.; Qiao, W.; Singh, R.; Yang, Y.; Shi, L.; Khan, W.A.; Sebra, R.; Cohen, N.; Babu, A.; et al. Cytogenomic Identification and Long-Read Single Molecule Real-Time (SMRT) Sequencing of a Bardet-Biedl Syndrome 9 (BBS9) Deletion. NPJ Genom. Med. 2018, 3, 3. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.-H.; Liao, Y.-C. CISA: Contig Integrator for Sequence Assembly of Bacterial Genomes. PLoS ONE 2013, 8, e60843. [Google Scholar] [CrossRef] [PubMed]
- Besemer, J.; Lomsadze, A.; Borodovsky, M. GeneMarkS: A Self-Training Method for Prediction of Gene Starts in Microbial Genomes. Implications for Finding Sequence Motifs in Regulatory Regions. Nucleic Acids Res. 2001, 29, 2607–2618. [Google Scholar] [CrossRef]
- Li, W.; Jaroszewski, L.; Godzik, A. Tolerating Some Redundancy Significantly Speeds up Clustering of Large Protein Databases. Bioinformatics 2002, 18, 77–82. [Google Scholar] [CrossRef]
- Lowe, T.M.; Eddy, S.R. tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence. Nucleic Acids Res. 1997, 25, 955–964. [Google Scholar] [CrossRef]
- Lagesen, K.; Hallin, P.; Rødland, E.A.; Staerfeldt, H.-H.; Rognes, T.; Ussery, D.W. RNAmmer: Consistent and Rapid Annotation of Ribosomal RNA Genes. Nucleic Acids Res. 2007, 35, 3100–3108. [Google Scholar] [CrossRef]
- Lee, I.; Ouk Kim, Y.; Park, S.-C.; Chun, J. OrthoANI: An Improved Algorithm and Software for Calculating Average Nucleotide Identity. Int. J. Syst. Evol. Microbiol. 2016, 66, 1100–1103. [Google Scholar] [CrossRef] [PubMed]
- Darling, A.C.E.; Mau, B.; Blattner, F.R.; Perna, N.T. Mauve: Multiple Alignment of Conserved Genomic Sequence with Rearrangements. Genome Res. 2004, 14, 1394–1403. [Google Scholar] [CrossRef] [PubMed]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An Information Aesthetic for Comparative Genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [PubMed]
- Hsiao, W.; Wan, I.; Jones, S.J.; Brinkman, F.S.L. IslandPath: Aiding Detection of Genomic Islands in Prokaryotes. Bioinformatics 2003, 19, 418–420. [Google Scholar] [CrossRef] [PubMed]
- Arndt, D.; Grant, J.R.; Marcu, A.; Sajed, T.; Pon, A.; Liang, Y.; Wishart, D.S. PHASTER: A Better, Faster Version of the PHAST Phage Search Tool. Nucleic Acids Res. 2016, 44, W16–W21. [Google Scholar] [CrossRef] [PubMed]
- Siguier, P.; Perochon, J.; Lestrade, L.; Mahillon, J.; Chandler, M. ISfinder: The Reference Centre for Bacterial Insertion Sequences. Nucleic Acids Res. 2006, 34, D32–D36. [Google Scholar] [CrossRef] [PubMed]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Dong, W.; Ma, J.; Zhang, Y.; Pan, Z.; Yao, H. Utilization of the ComRS System for the Rapid Markerless Deletion of Chromosomal Genes in Streptococcus suis. Future Microbiol. 2019, 14, 207–222. [Google Scholar] [CrossRef]
- Tang, F.; Bossers, A.; Harders, F.; Lu, C.; Smith, H. Comparative Genomic Analysis of Twelve Streptococcus suis (pro)Phages. Genomics 2013, 101, 336–344. [Google Scholar] [CrossRef]
- Dai, J.; Lai, L.; Tang, H.; Wang, W.; Wang, S.; Lu, C.; Yao, H.; Fan, H.; Wu, Z. Streptococcus suis Synthesizes Deoxyadenosine and Adenosine by 5′-Nucleotidase to Dampen Host Immune Responses. Virulence 2018, 9, 1509–1520. [Google Scholar] [CrossRef]
- Okura, M.; Auger, J.-P.; Shibahara, T.; Goyette-Desjardins, G.; Van Calsteren, M.-R.; Maruyama, F.; Kawai, M.; Osaki, M.; Segura, M.; Gottschalk, M.; et al. Capsular Polysaccharide Switching in Streptococcus suis Modulates Host Cell Interactions and Virulence. Sci. Rep. 2021, 11, 6513. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, G.; Fouchet, D.; Danesh, G.; Godeux, A.-S.; Laaberki, M.-H.; Pontier, D.; Charpentier, X.; Venner, S. Bacterial Transformation Buffers Environmental Fluctuations through the Reversible Integration of Mobile Genetic Elements. mBio 2020, 11, e02443-19. [Google Scholar] [CrossRef] [PubMed]
- Weisberg, A.J.; Chang, J.H. Mobile Genetic Element Flexibility as an Underlying Principle to Bacterial Evolution. Annu. Rev. Microbiol. 2023, 77, 603–624. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.; Chao, Y.; Yang, Z.; Rui, Z.; Wei, Z.; Fischetti, V.A.; Wang, X.; Ye, F.; Li, J. The Global Emergence of a Novel Streptococcus suis Clade Associated with Human Infections. EMBO Mol. Med. 2021, 13, e13810. [Google Scholar] [CrossRef] [PubMed]
- Siguier, P.; Gourbeyre, E.; Varani, A.; Ton-Hoang, B.; Chandler, M. Everyman’s Guide to Bacterial Insertion Sequences. Microbiol. Spectr. 2015, 3, MDNA3-0030–2014. [Google Scholar] [CrossRef] [PubMed]
- Horne, T.; Orr, V.T.; Hall, J.P. How Do Interactions between Mobile Genetic Elements Affect Horizontal Gene Transfer? Curr. Opin. Microbiol. 2023, 73, 102282. [Google Scholar] [CrossRef] [PubMed]
- von Wintersdorff, C.J.H.; Penders, J.; van Niekerk, J.M.; Mills, N.D.; Majumder, S.; van Alphen, L.B.; Savelkoul, P.H.M.; Wolffs, P.F.G. Dissemination of Antimicrobial Resistance in Microbial Ecosystems through Horizontal Gene Transfer. Front. Microbiol. 2016, 7, 173. [Google Scholar] [CrossRef] [PubMed]
- Rasmussen, S.; Allentoft, M.E.; Nielsen, K.; Orlando, L.; Sikora, M.; Sjögren, K.-G.; Pedersen, A.G.; Schubert, M.; Van Dam, A.; Kapel, C.M.O.; et al. Early Divergent Strains of Yersinia pestis in Eurasia 5000 Years Ago. Cell 2015, 163, 571–582. [Google Scholar] [CrossRef] [PubMed]
- Loftie-Eaton, W.; Yano, H.; Burleigh, S.; Simmons, R.S.; Hughes, J.M.; Rogers, L.M.; Hunter, S.S.; Settles, M.L.; Forney, L.J.; Ponciano, J.M.; et al. Evolutionary Paths That Expand Plasmid Host-Range: Implications for Spread of Antibiotic Resistance. Mol. Biol. Evol. 2016, 33, 885–897. [Google Scholar] [CrossRef]
- Aminov, R.I. Horizontal Gene Exchange in Environmental Microbiota. Front. Microbiol. 2011, 2, 158. [Google Scholar] [CrossRef]
- Nevers, P.; Saedler, H. Transposable Genetic Elements as Agents of Gene Instability and Chromosomal Rearrangements. Nature 1977, 268, 109–115. [Google Scholar] [CrossRef] [PubMed]
- De Palmenaer, D.; Siguier, P.; Mahillon, J. IS4 Family Goes Genomic. BMC Evol. Biol. 2008, 8, 18. [Google Scholar] [CrossRef] [PubMed]
- Feiner, R.; Argov, T.; Rabinovich, L.; Sigal, N.; Borovok, I.; Herskovits, A.A. A New Perspective on Lysogeny: Prophages as Active Regulatory Switches of Bacteria. Nat. Rev. Microbiol. 2015, 13, 641–650. [Google Scholar] [CrossRef] [PubMed]
- De Silva, R.S.; Kovacikova, G.; Lin, W.; Taylor, R.K.; Skorupski, K.; Kull, F.J. Crystal Structure of the Virulence Gene Activator AphA from Vibrio cholerae Reveals It Is a Novel Member of the Winged Helix Transcription Factor Superfamily. J. Biol. Chem. 2005, 280, 13779–13783. [Google Scholar] [CrossRef] [PubMed]
- Agustiandari, H.; Lubelski, J.; van den Berg van Saparoea, H.B.; Kuipers, O.P.; Driessen, A.J.M. LmrR Is a Transcriptional Repressor of Expression of the Multidrug ABC Transporter LmrCD in Lactococcus lactis. J. Bacteriol. 2008, 190, 759–763. [Google Scholar] [CrossRef] [PubMed]
- Grove, A. MarR Family Transcription Factors. Curr. Biol. 2013, 23, R142–R143. [Google Scholar] [CrossRef] [PubMed]
- Kahya, H.F.; Andrew, P.W.; Yesilkaya, H. Deacetylation of Sialic Acid by Esterases Potentiates Pneumococcal Neuraminidase Activity for Mucin Utilization, Colonization and Virulence. PLoS Pathog. 2017, 13, e1006263. [Google Scholar] [CrossRef]
Strains | Origin | NCBI Accession |
---|---|---|
2018WUSS151 | Isolated from a diseased pig | NZ_CP101844.1 |
WUSS030 | Isolated from a healthy pig | NZ_CP110141.1 |
SC070731 | Isolated from a diseased pig | NC_020526.1 |
ΔpadR | This study | |
ΔmarR | This study | |
Δatpase | This study |
Primer. | Primer Sequence (5′–3′) | Comment |
---|---|---|
Verification the transposition mechanism of transposons | ||
I-P1 | TGGCAAATCTATCTCTGCAT | |
I-P2 | AACTACCACGCGAACTTATC | |
I-P3 | ATTCACCGAGTTGAAGATAC | |
I-P4 | ATCTAAAAGAGAACCTCCGAAC | |
II-P1 | GCCGATTTATCAGTAGCCCAT | |
II-P2 | TACTTCTATCTGATCTTC | |
II-P3 | GAATGCAAAAACTCCCTC | |
II-P4 | TACTGATTCCGCTAGCAGGAC | |
III-P1 | TCCGATATAGATTGGCAGGA | |
III-P2 | CAGCACAAGCAAATATCG | |
III-P3 | AACTCCTTCTCCATCGAC | |
III-P4 | CGTGCTATCGAACTCTACGG | |
Construction of deletion strains | ||
∆padR-A | AAATCGGAGAAACTAGACAG | Upstream of fusion fragment for ∆padR |
∆padR-B | AAGGAGTTTTCAGCATTATCCAAACTCACCTCTTTATCTTTA | |
∆padR-C | ATATTCATTCTAATTGGTAATCAGATTATGACACGCGCAGATTATTTG | Downstream of fusion fragment for ∆padR |
∆padR-D | ACTGATGTCCGTACTTGGTTT | |
sacB-F | GGATAATGCTGAAAACTCCTT | sacB-spc gene cassette |
spc-R | AATCTGATTACCAATTAGAATGAATAT | |
∆padR-E | TTTCCTGCTCTTCATCCAC | Detection of deletion of padR gene |
∆padR-F | TTCTTCAATCTTCGCCGTCA | |
∆padR-G | ATGTACTACCCCGTATCCTC | Detection of deletion of padR gene |
∆padR-H | AAGCTCCCTTCTATAATTCCG | |
∆marR-A | TAAAGGCCACAGTTGTACC | Upstream of fusion fragment for ∆marR |
∆marR-B | AAGGAGTTTTCAGCATTATCC TATCTACCTCTTTTGATTGAT | |
∆marR-C | ATATTCATTCTAATTGGTAATCAGATT TTTTTTGAGAGGAGACATTAT | Downstream of fusion fragment for ∆marR |
∆marR-D | TGTTGCCTACTACCAACCTG | |
∆marR-E | ATTTAATTGGCTCCATGCTT | Detection of deletion of marR gene |
∆marR-F | TGCCAGTCAAAATAATCTGGG | |
∆marR-G | ATTACTAAAAGATGCACCCCT | Detection of deletion of marR gene |
∆marR-H | AGGTAGATTTTGCAAGCCAA | |
∆atpase-A | TAAAGGCCACAGTTGTACC | Upstream of fusion fragment for ∆atpase |
∆atpase-B | AAGGAGTTTTCAGCATTATCC TATCTACCTCTTTTGATTGAT | |
∆atpase-C | ATATTCATTCTAATTGGTAATCAGATT TTTTTTGAGAGGAGACATTAT | Downstream of fusion fragment for ∆atpase |
∆atpase-D | TGTTGCCTACTACCAACCTG | |
∆atpase-E | ATTTAATTGGCTCCATGCTT | Detection of deletion of atpase gene |
∆atpase-F | TGCCAGTCAAAATAATCTGGG | |
∆atpase-G | ATTACTAAAAGATGCACCCCT | Detection of deletion of atpase gene |
∆atpase-H | AGGTAGATTTTGCAAGCCAA |
Strains | Size (bp) | G + C (%) | tRNA | rRNA | sRNA | GI | Prophage | IS |
---|---|---|---|---|---|---|---|---|
2018WUSS151 | 2,229,493 | 41.11 | 57 | 12 | 2 | 8 | 6 | 122 |
WUSS030 | 2,223,280 | 41.17 | 54 | 12 | 3 | 9 | 6 | 118 |
Families | DDE 1 | DEDD 2 | HUH 3 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Strains | IS3 | IS30 | ISL3 | IS4 | IS5 | IS630 | IS66 | ISAs1 | IS982 | IS110 | IS200/IS605 | |
2018WUSS151 | 5 | 1 | 13 | 28 | 3 | 4 | 3 | 1 | 8 | 51 | 4 | |
WUSS030 | 4 | 1 | 14 | 35 | 4 | 5 | 3 | 1 | 8 | 38 | 4 |
Number | Genes | Gene Locus | Gene Function |
---|---|---|---|
1 | padR | NOV99_06315 | PadR family transcriptional regulator |
2 | marR | NOV99_06345 | MarR family transcriptional regulator |
3 | atpase | NOV99_09615 | AAA family ATPase |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sheng, Q.; Xu, Q.; Lan, Z.; Wu, Z. Comparative Genome Analysis of Two Streptococcus suis Serotype 8 Strains Identifies Two New Virulence-Associated Genes. Animals 2024, 14, 572. https://doi.org/10.3390/ani14040572
Sheng Q, Xu Q, Lan Z, Wu Z. Comparative Genome Analysis of Two Streptococcus suis Serotype 8 Strains Identifies Two New Virulence-Associated Genes. Animals. 2024; 14(4):572. https://doi.org/10.3390/ani14040572
Chicago/Turabian StyleSheng, Qi, Qiuhua Xu, Zouran Lan, and Zongfu Wu. 2024. "Comparative Genome Analysis of Two Streptococcus suis Serotype 8 Strains Identifies Two New Virulence-Associated Genes" Animals 14, no. 4: 572. https://doi.org/10.3390/ani14040572