POLB Regulates Proliferation and Apoptosis of Bovine Primary Myocytes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sequencing
2.2. Selection Signature Analysis
2.3. RNA-Seq
2.4. Prioritization of the Candidate Genes
2.5. Cell Culture
2.6. Vector Construction, shRNAs, and Transfection
2.7. Cell Proliferation Assay
2.8. Cell Apoptosis and Cell Cycle Analysis
2.9. Statistical Analysis
3. Results
3.1. Candidate Gene Selection
3.2. Overexpression of POLB Gene Promotes Apoptosis in Bovine Primary Myocytes
3.3. Knockdown of POLB Gene Does Not Inhibit Apoptosis in Bovine Primary Myocytes
3.4. Overexpression of POLB Gene Affects Expression of Apoptosis-Related Gene CASP9
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Xia, X.; Zhang, S.; Zhang, H.; Zhang, Z.; Chen, N.; Li, Z.; Sun, H.; Liu, X.; Lyu, S.; Wang, X.; et al. Assessing genomic diversity and signatures of selection in Jiaxian Red cattle using whole-genome sequencing data. BMC Genom. 2021, 22, 43. [Google Scholar] [CrossRef] [PubMed]
- Albrecht, E.; Teuscher, F.; Ender, K.; Wegner, J. Growth- and breed-related changes of muscle bundle structure in cattle. J. Anim. Sci. 2006, 84, 2959–2964. [Google Scholar] [CrossRef]
- Lyu, S.; Arends, D.; Nassar, M.K.; Weigend, A.; Weigend, S.; Wang, E.; Brockmann, G.A. High-density genotyping reveals candidate genomic regions for chicken body size in breeds of Asian origin. Poult. Sci. 2023, 102, 102303. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.G.; Fan, J.B.; Siao, C.J.; Berno, A.; Young, P.; Sapolsky, R.; Ghandour, G.; Perkins, N.; Winchester, E.; Spencer, J.; et al. Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome. Science 1998, 280, 1077–1082. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Yang, R.; Lu, X.; Liu, Y.; He, W.; Li, Y.; Yu, H.; Qin, L.; Cao, Y.; Zhao, Z.; et al. RNA-Seq Analysis Identifies Differentially Expressed Genes in the Longissimus dorsi of Wagyu and Chinese Red Steppe Cattle. Int. J. Mol. Sci. 2022, 24, 387. [Google Scholar] [CrossRef] [PubMed]
- Pareek, C.S.; Sachajko, M.; Jaskowski, J.M.; Herudzinska, M.; Skowronski, M.; Domagalski, K.; Szczepanek, J.; Czarnik, U.; Sobiech, P.; Wysocka, D.; et al. Comparative Analysis of the Liver Transcriptome among Cattle Breeds Using RNA-seq. Vet. Sci. 2019, 6, 36. [Google Scholar] [CrossRef]
- Song, C.; Huang, Y.; Yang, Z.; Ma, Y.; Chaogetu, B.; Zhuoma, Z.; Chen, H. RNA-Seq Analysis Identifies Differentially Expressed Genes Insubcutaneous Adipose Tissue in Qaidamford Cattle, Cattle-Yak, and Angus Cattle. Animals 2019, 9, 1077. [Google Scholar] [CrossRef]
- Snelling, W.M.; Allan, M.F.; Keele, J.W.; Kuehn, L.A.; McDaneld, T.; Smith, T.P.; Sonstegard, T.S.; Thallman, R.M.; Bennett, G.L. Genome-wide association study of growth in crossbred beef cattle. J. Anim. Sci. 2010, 88, 837–848. [Google Scholar] [CrossRef]
- Hu, Z.L.; Park, C.A.; Reecy, J.M. Building a livestock genetic and genomic information knowledgebase through integrative developments of Animal QTLdb and CorrDB. Nucleic Acids Res. 2019, 47, D701–D710. [Google Scholar] [CrossRef]
- Van Houten, B.; Kow, Y.W. DNA damage, mutations, cancer, and aging. American Association for Cancer Research Special Conference: Cellular Responses to Environmental DNA Damage, Banff, AB, Canada, December 1-6, 1991. New Biol. 1992, 4, 306–315. [Google Scholar]
- Chen, N.; Cai, Y.; Chen, Q.; Li, R.; Wang, K.; Huang, Y.; Hu, S.; Huang, S.; Zhang, H.; Zheng, Z.; et al. Whole-genome resequencing reveals world-wide ancestry and adaptive introgression events of domesticated cattle in East Asia. Nat. Commun. 2018, 9, 2337. [Google Scholar] [CrossRef]
- Danecek, P.; Auton, A.; Abecasis, G.; Albers, C.A.; Banks, E.; DePristo, M.A.; Handsaker, R.E.; Lunter, G.; Marth, G.T.; Sherry, S.T.; et al. The variant call format and VCFtools. Bioinformatics 2011, 27, 2156–2158. [Google Scholar] [CrossRef]
- Szpiech, Z.A.; Hernandez, R.D. selscan: An efficient multithreaded program to perform EHH-based scans for positive selection. Mol. Biol. Evol. 2014, 31, 2824–2827. [Google Scholar] [CrossRef]
- Liu, G.F.; Cheng, H.J.; You, W.; Song, E.L.; Liu, X.M.; Wan, F.C. Transcriptome profiling of muscle by RNA-Seq reveals significant differences in digital gene expression profiling between Angus and Luxi cattle. Anim. Prod. Sci. 2015, 55, 1172–1178. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [PubMed]
- Fu, W.; Wang, R.; Nanaei, H.A.; Wang, J.; Hu, D.; Jiang, Y. RGD v2.0: A major update of the ruminant functional and evolutionary genomics database. Nucleic Acids Res. 2022, 50, D1091–D1099. [Google Scholar] [CrossRef] [PubMed]
- Kemper, K.E.; Saxton, S.J.; Bolormaa, S.; Hayes, B.J.; Goddard, M.E. Selection for complex traits leaves little or no classic signatures of selection. BMC Genom. 2014, 15, 246. [Google Scholar] [CrossRef]
- Cui, M.S.; Zhao, R.; Wang, Q.; Zhang, Y.; Li, Q.S.; Huang Yang, M.D.; Sun, X.Q.; Li, J.T. Bulked Segregant Analysis and Association Analysis Identified the Polymorphisms Related to the Intermuscular Bones in Common Carp (Cyprinus carpio). Biology 2022, 11, 477. [Google Scholar] [CrossRef] [PubMed]
- Karim, L.; Takeda, H.; Lin, L.; Druet, T.; Arias, J.A.; Baurain, D.; Cambisano, N.; Davis, S.R.; Farnir, F.; Grisart, B.; et al. Variants modulating the expression of a chromosome domain encompassing PLAG1 influence bovine stature. Nat. Genet. 2011, 43, 405–413. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Huang, Y.; Xu, J.; Yue, B.; Wen, Y.; Wang, X.; Lei, C.; Chen, H. Pleomorphic adenoma gene 1 (PLAG1) promotes proliferation and inhibits apoptosis of bovine primary myoblasts through the PI3K-Akt signaling pathway. J. Anim. Sci. 2022, 100, skac098. [Google Scholar] [CrossRef] [PubMed]
- Baguma-Nibasheka, M.; Fracassi, A.; Costain, W.J.; Moreno, S.; Kablar, B. Role of skeletal muscle in motor neuron development. Histol. Histopathol. 2016, 31, 699–719. [Google Scholar] [CrossRef] [PubMed]
- Shah, A.M.; Conn, D.A.; Li, S.X.; Capaldi, A.; Jäger, J.; Sweasy, J.B. A DNA polymerase beta mutator mutant with reduced nucleotide discrimination and increased protein stability. Biochemistry 2001, 40, 11372–11381. [Google Scholar] [CrossRef] [PubMed]
- Sobol, R.W.; Wilson, S.H. Mammalian DNA beta-polymerase in base excision repair of alkylation damage. Prog. Nucleic Acid Res. Mol. Biol. 2001, 68, 57–74. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Prasad, R.; Beard, W.A.; Hou, E.W.; Horton, J.K.; McMurray, C.T.; Wilson, S.H. Coordination between polymerase beta and FEN1 can modulate CAG repeat expansion. J. Biol. Chem. 2009, 284, 28352–28366. [Google Scholar] [CrossRef]
- Wang, H.C.; Chan, L.P.; Wu, C.C.; Chang, S.J.; Moi, S.H.; Luo, C.W.; Pan, M.R. Silencing DNA Polymerase β Induces Aneuploidy as a Biomarker of Poor Prognosis in Oral Squamous Cell Cancer. Int. J. Mol. Sci. 2021, 22, 2402. [Google Scholar] [CrossRef] [PubMed]
- Qin, J.; Zhu, Y.; Ding, Y.; Niu, T.; Zhang, Y.; Wu, H.; Zhu, L.; Yuan, B.; Qiao, Y.; Lu, J.; et al. DNA polymerase β deficiency promotes the occurrence of esophageal precancerous lesions in mice. Neoplasia 2021, 23, 663–675. [Google Scholar] [CrossRef]
- Kuida, K. Caspase-9. Int. J. Biochem. Cell Biol. 2000, 32, 121–124. [Google Scholar] [CrossRef]
- Baechler, B.L.; Bloemberg, D.; Quadrilatero, J. Mitophagy regulates mitochondrial network signaling, oxidative stress, and apoptosis during myoblast differentiation. Autophagy 2019, 15, 1606–1619. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′ to 3′) | GeneBank ID | PCR Product (bp) |
---|---|---|---|
DNA polymerase beta (POLB) | Forward: AATCCGTCCCCTGGGTGTCA Reverse: GGATGGGCCTCACTCGCTTC | NM_001034764.1 | 127 |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | Forward: ATGGAGAAGGCTGGGGCTCA Reverse: GTTGGTGGTGCAGGAGGCAT | NM_001034034.2 | 153 |
Cytochrome C, somatic (CYCS) | Forward: TCAGAAGTGTGCCCAGTGCC Reverse: TCAGCGTCTCCTCTCCCCAG | NM_001046061.2 | 161 |
Fas cell surface death receptor (FAS) | Forward: GCTCTGCTCAGAGGGGAACG Reverse: GGTGTTGCTCGTTGGTGTGC | NM_174662.2 | 241 |
BCL2-associated X, apoptosis regulator (BAX) | Forward: CTCAAGGCCCTGTGCACCAA Reverse: GTCTGCCATGTGGGTGTCCC | NM_173894.1 | 152 |
Caspase-8 (CASP8) | Forward: GCCGGCCATGTCAGACTCTC Reverse: TTCAGGCACCTGCTTCCGTG | NM_001045970.2 | 142 |
Caspase-9 (CASP9) | Forward: TGGACGCTGGTTCTGGAGGA Reverse: CGCGGCAGAAGTTCACGTTG | NM_001205504.2 | 135 |
Tumor protein p53 (TP53) | Forward: CGGAGGTTGTGAGGCGTTGT Reverse: TCCGTCCCAGCAGGTTACCA | NM_174201.2 | 297 |
Chr 1 | Start (bp) | End (bp) | FST Value | XP-EHH Value | Gene in the Region | Overlap with QTLs Published in QTLdb 2 |
---|---|---|---|---|---|---|
10 | 27920001 | 27970000 | 0.46 | 2.57 | LOC510112 (OR4F13) | Weaning weight (68,115, 68,116) |
14 | 22700001 | 22750000 | 0.34 | 3.29 | XKR4 | Insulin-like growth factor 1 level (57,469, 57,478) |
14 | 22720001 | 22770000 | 0.35 | 3.16 | XKR4 | Insulin-like growth factor 1 level (71,532, 30,649) |
14 | 23000001 | 23050000 | 0.34 | 3.66 | TMEM68 | Insulin-like growth factor 1 level (71,518, 71,519, 71,527) |
14 | 23220001 | 23270000 | 0.34 | 4.15 | LYN | Metabolic body weight (131,341, 131,347, 131,348, 131,349) |
14 | 23240001 | 23290000 | 0.37 | 3.96 | RPS20; LYN | Metabolic body weight (131,341, 131,347, 131,348, 131,349, 131,351) |
14 | 23280001 | 23330000 | 0.34 | 3.53 | MOS; PLAG1 | Insulin-like growth factor 1 level (71,513, 71,514), carcass weight (122,423), longissimus muscle area (122,424), and metabolic body weight (131,351) |
27 | 37120001 | 37170000 | 0.35 | 2.68 | IKBKB | Body weight gain (69,373) |
27 | 37140001 | 37190000 | 0.36 | 2.92 | IKBKB | Body weight gain (69,373) |
27 | 37160001 | 37210000 | 0.39 | 3.00 | IKBKB; POLB | Body weight gain (69,373) |
Gene ID | Gene Name | Gene Position | FPKM in Jiaxian Red Cattle | FPKM in Angus Cattle | log2FC | p-Value | FDR |
---|---|---|---|---|---|---|---|
ENSBTAG00000003549 | OR4F13 | 10:27939007-27939951 | 0.00 | 0.00 | / | / | / |
ENSBTAG00000044050 | XKR4 | 14:22640221-22953771 | 0.02 | 0.00 | 10.06 | 0.01 | 0.03 |
ENSBTAG00000005893 | TMEM68 | 14:23034280-23070124 | 5.99 | 1.05 | 0.70 | 0.16 | 0.29 |
ENSBTAG00000020034 | LYN | 14:23134995-23244752 | 2.84 | 1.08 | 0.33 | 0.57 | 0.72 |
ENSBTAG00000019147 | RPS20 | 14:23278316-23279689 | 177.26 | 68.45 | 0.42 | 0.46 | 0.62 |
ENSBTAG00000019145 | MOS | 14:23299177-23300199 | 0.00 | 0.00 | / | / | / |
ENSBTAG00000004022 | PLAG1 | 14:23330541-23375751 | 0.19 | 0.18 | −1.00 | 0.28 | 0.43 |
ENSBTAG00000007599 | IKBKB | 27:37127811-37180362 | 3.40 | 1.17 | 0.57 | 0.15 | 0.27 |
ENSBTAG00000000225 | POLB | 27:37192520-37217387 | 15.57 | 2.81 | 1.50 | <0.01 | <0.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, G.; Wang, J.; Li, Y.; Zhang, Z.; Wang, X.; Chen, F.; Shi, Q.; Huang, Y.; Wang, E.; Lyu, S. POLB Regulates Proliferation and Apoptosis of Bovine Primary Myocytes. Animals 2024, 14, 1323. https://doi.org/10.3390/ani14091323
Zhang G, Wang J, Li Y, Zhang Z, Wang X, Chen F, Shi Q, Huang Y, Wang E, Lyu S. POLB Regulates Proliferation and Apoptosis of Bovine Primary Myocytes. Animals. 2024; 14(9):1323. https://doi.org/10.3390/ani14091323
Chicago/Turabian StyleZhang, Geyang, Jiamei Wang, Yulong Li, Zijing Zhang, Xiangnan Wang, Fuying Chen, Qiaoting Shi, Yongzhen Huang, Eryao Wang, and Shijie Lyu. 2024. "POLB Regulates Proliferation and Apoptosis of Bovine Primary Myocytes" Animals 14, no. 9: 1323. https://doi.org/10.3390/ani14091323