A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection and In Vitro Maturation of Bovine Cumulus–Oocyte Complexes
2.2. Total RNA Isolation and cDNA Synthesis
2.3. Primer Design, Library Preparation, and Targeted Messenger RNA-Sequencing
2.4. Data and Statistical Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
AMPK | AMP-activated protein kinase |
ARHGAP31 | Rho GTPase activating protein 31 |
ARHGAP6 | Rho GTPase activating protein 6 |
BANP | BTG3 associated nuclear protein |
BDKRB1 | Bradykinin receptor B1 |
CAV1 | Caveolin 1 |
CCDC25 | Coiled-coil domain containing 25 |
CCDC80 | Coiled-coil domain containing 80 |
COC | Cumulus–oocyte complex |
CPM | Counts per million |
CTSB | Cathepsin B |
DEGs | Differentially expressed genes |
ESR2 | Estrogen receptor 2 |
ERK | Extracellular signal-regulated kinase |
ETFA | Electron transfer flavoprotein subunit alpha |
FDX1 | Ferredoxin 1 |
FDXR | Ferredoxin reductase |
FGR | FGR proto-oncogene, Src family tyrosine kinase |
FSHR | Follicle stimulating hormone receptor |
FYN | FYN proto-oncogene, Src family tyrosine kinase |
GVBD | Germinal vesicle breakdown |
h | Hour(s) |
HEAT | Higher estrus-associated temperature |
hIVM | Hours of in vitro maturation |
HS | Heat shock |
HSD3B7 | Hydroxy-delta-5-steroid dehydrogenase, 3-beta- and steroid delta-isomerase 7 |
HSP90AB1 | Heat shock protein 90 alpha family class B member 1 |
HSP90B1 | Heat shock protein 90 beta family member 1 |
HTATIP2 | HIV-1 Tat interactive protein 2 |
IL6R | Interleukin 6 receptor |
INHBB | Inhibin subunit beta B |
LCK | LCK proto-oncogene, Src family tyrosine kinase |
LH | Luetinizing hormone |
LYN | LYN proto-oncogene, Src family tyrosine kinase |
MAPK3 | Mitogen-activated protein kinase 3 |
MCM6 | Minichromosome maintenance complex component 6 |
MDM2 | MDM2 proto-oncogene |
MMP9 | Matrix metallopeptidase 9 |
NR5A1 | Nuclear receptor subfamily 5 group A member 1 |
PAK2 | p21 (RAC1) activated kinase 2 |
PEAK1 | Pseudopodium enriched atypical kinase 1 |
PGRMC2 | Progesterone receptor membrane component 2 |
PRDX2 | Peroxiredoxin 2 |
PRKAA1 | Protein kinase AMP-activated catalytic subunit alpha 1 |
RAI14 | Retinoic acid induced 14 |
RBM3 | RNA binding motif protein 3 |
SCN7A | Sodium voltage-gated channel alpha subunit 7 |
SF1 | Splicing factor 1 |
SLC26A2 | Solute carrier family 26 member 2 |
SNAP91 | Synaptosome associated protein 91 |
SNX22 | Sorting nexin 22 |
SRC | SRC proto-oncogene, non-receptor tyrosine kinase |
TANC1 | Tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 |
TFRC | Transferrin receptor |
TN | Thermoneutral |
TNIK | TRAF2 and NCK interacting kinase |
TP53 | Tumor protein p53 |
TTYH1 | Tweety family member 1 |
YES1 | YES proto-oncogene 1, Src family tyrosine kinase |
References
- Mills, M.D.; Pollock, A.B.; Batey, I.E.; O’Neil, M.A.; Schrick, F.N.; Payton, R.R.; Moorey, S.E.; Fioravanti, P.; Hipsher, W.; Zoca, S.M.; et al. Magnitude and persistence of higher estrus-associated temperatures in beef heifers and suckled cows. J. Anim. Sci. 2024, 102, skae079. [Google Scholar] [CrossRef]
- Higaki, S.; Miura, R.; Suda, T.; Andersson, L.M.; Okada, H.; Zhang, Y.; Itoh, T.; Miwakeichi, F.; Yoshioka, K. Estrous detection by continuous measurements of vaginal temperature and conductivity with supervised machine learning in cattle. Theriogenology 2019, 123, 90–99. [Google Scholar] [CrossRef]
- Rajamahendran, R.; Robinson, J.; Desbottes, S.; Walton, J.S. Temporal relationships among estrus, body temperature, milk yield, progesterone and luteinizing hormone levels, and ovulation in dairy cows. Theriogenology 1989, 31, 1173–1182. [Google Scholar] [CrossRef] [PubMed]
- Rajamahendran, R.; Taylor, C. Follicular dynamics and temporal relationships among body temperature, oestrus, the surge of luteinizing hormone and ovulation in Holstein heifers treated with norgestomet. J. Reprod. Fertil. 1991, 92, 461–467. [Google Scholar] [CrossRef]
- Giordano, J.O.; Edwards, J.L.; Di Croce, F.A.; Roper, D.; Rohrbach, N.R.; Saxton, A.M.; Schuenemann, G.M.; Prado, T.M.; Schrick, F.N. Ovulatory follicle dysfunction in lactating dairy cows after treatment with Folltropin-V at the onset of luteolysis. Theriogenology 2013, 79, 1210–1217. [Google Scholar] [CrossRef] [PubMed]
- Saumande, J.; Humblot, P. The variability in the interval between estrus and ovulation in cattle and its determinants. Anim. Reprod. Sci. 2005, 85, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Constable, P.D.; Hinchcliff, K.W.; Done, S.H.; Grünberg, W. Clinical Examination and Making a Diagnosis. In Veterinary Medicine, 11th ed.; Constable, P.D., Hinchcliff, K.W., Done, S.H., Grünberg, W., Eds.; W.B. Saunders: Philadelphia, PA, USA, 2017; pp. 1–28. [Google Scholar]
- Fallon, G.R. Body temperature and fertilization in the cow. J. Reprod. Fertil. 1962, 3, 116–123. [Google Scholar] [CrossRef] [PubMed]
- Liles, H.L.; Schneider, L.G.; Pohler, K.G.; Oliveira Filho, R.V.; Schrick, F.N.; Payton, R.R.; Rhinehart, J.D.; Thompson, K.W.; McLean, K.; Edwards, J.L. Positive relationship of rectal temperature at fixed timed artificial insemination on pregnancy outcomes in beef cattle. J. Anim. Sci. 2022, 100, skac100. [Google Scholar] [CrossRef]
- El-Sheikh Ali, H.; Kitahara, G.; Tamura, Y.; Kobayashi, I.; Hemmi, K.; Torisu, S.; Sameshima, H.; Horii, Y.; Zaabel, S.; Kamimura, S. Presence of a temperature gradient among genital tract portions and the thermal changes within these portions over the estrous cycle in beef cows. J. Reprod. Dev. 2013, 59, 59–65. [Google Scholar] [CrossRef] [PubMed]
- Hunter, R.H.; Bogh, I.B.; Einer-Jensen, N.; Muller, S.; Greve, T. Pre-ovulatory graafian follicles are cooler than neighbouring stroma in pig ovaries. Hum. Reprod. 2000, 15, 273–283. [Google Scholar] [CrossRef]
- Hooper, L.M.; Payton, R.R.; Rispoli, L.A.; Saxton, A.M.; Edwards, J.L. Impact of heat stress on germinal vesicle breakdown and lipolytic changes during in vitro maturation of bovine oocytes. J. Reprod. Dev. 2015, 61, 459–464. [Google Scholar] [CrossRef] [PubMed]
- Campen, K.A.; Abbott, C.R.; Rispoli, L.A.; Payton, R.R.; Saxton, A.M.; Edwards, J.L. Heat stress impairs gap junction communication and cumulus function of bovine oocytes. J. Reprod. Dev. 2018, 64, 385–392. [Google Scholar] [CrossRef] [PubMed]
- Rispoli, L.A.; Payton, R.R.; Gondro, C.; Saxton, A.M.; Nagle, K.A.; Jenkins, B.W.; Schrick, F.N.; Edwards, J.L. Heat stress effects on the cumulus cells surrounding the bovine oocyte during maturation: Altered matrix metallopeptidase 9 and progesterone production. Reproduction 2013, 146, 193–207. [Google Scholar] [CrossRef] [PubMed]
- Rowinski, J.R.; Rispoli, L.A.; Payton, R.R.; Schneider, L.G.; Schrick, F.N.; McLean, K.J.; Edwards, J.L. Impact of an acute heat shock during in vitro maturation on interleukin 6 and its associated receptor component transcripts in bovine cumulus-oocyte complexes. Anim. Reprod. 2020, 17, e20200221. [Google Scholar] [CrossRef]
- Siqueira, L.C.; Barreta, M.H.; Gasperin, B.; Bohrer, R.; Santos, J.T.; Buratini, J., Jr.; Oliveira, J.F.; Goncalves, P.B. Angiotensin II, progesterone, and prostaglandins are sequential steps in the pathway to bovine oocyte nuclear maturation. Theriogenology 2012, 77, 1779–1787. [Google Scholar] [CrossRef]
- Sirotkin, A.V. Involvement of steroid hormones in bovine oocytes maturation in vitro. J. Steroid Biochem. Mol. Biol. 1992, 41, 855–858. [Google Scholar] [CrossRef]
- Rispoli, L.A.; Edwards, J.L.; Pohler, K.G.; Russell, S.; Somiari, R.I.; Payton, R.R.; Schrick, F.N. Heat-induced hyperthermia impacts the follicular fluid proteome of the periovulatory follicle in lactating dairy cows. PLoS ONE 2019, 14, e0227095. [Google Scholar] [CrossRef]
- Yoshimura, Y.; Espey, L.; Hosoi, Y.; Adachi, T.; Atlas, S.J.; Ghodgaonkar, R.B.; Dubin, N.H.; Wallach, E.E. The effects of bradykinin on ovulation and prostaglandin production by the perfused rabbit ovary. Endocrinology 1988, 122, 2540–2546. [Google Scholar] [CrossRef] [PubMed]
- Hellberg, P.; Larson, L.; Olofsson, J.; Hedin, L.; Brännström, M. Stimulatory effects of bradykinin on the ovulatory process in the in vitro-perfused rat ovary. Biol. Reprod. 1991, 44, 269–274. [Google Scholar] [CrossRef]
- Liu, Z.; de Matos, D.G.; Fan, H.Y.; Shimada, M.; Palmer, S.; Richards, J.S. Interleukin-6: An autocrine regulator of the mouse cumulus cell-oocyte complex expansion process. Endocrinology 2009, 150, 3360–3368. [Google Scholar] [CrossRef]
- Bromfield, J.J.; Sheldon, I.M. Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology 2011, 152, 5029–5040. [Google Scholar] [CrossRef]
- Klabnik, J.L.; Christenson, L.K.; Gunewardena, S.S.; Pohler, K.G.; Rispoli, L.A.; Payton, R.R.; Moorey, S.E.; Schrick, F.N.; Edwards, J.L. Heat-induced increases in body temperature in lactating dairy cows: Impact on the cumulus and granulosa cell transcriptome of the periovulatory follicle. J. Anim. Sci. 2022, 100, skac121. [Google Scholar] [CrossRef]
- Lawrence, J.L.; Payton, R.R.; Godkin, J.D.; Saxton, A.M.; Schrick, F.N.; Edwards, J.L. Retinol improves development of bovine oocytes compromised by heat stress during maturation. J. Dairy. Sci. 2004, 87, 2449–2454. [Google Scholar] [CrossRef] [PubMed]
- Rispoli, L.A.; Lawrence, J.L.; Payton, R.R.; Saxton, A.M.; Schrock, G.E.; Schrick, F.N.; Middlebrooks, B.W.; Dunlap, J.R.; Parrish, J.J.; Edwards, J.L. Disparate consequences of heat stress exposure during meiotic maturation: Embryo development after chemical activation vs fertilization of bovine oocytes. Reproduction 2011, 142, 831–843. [Google Scholar] [CrossRef] [PubMed]
- Edwards, J.L.; Saxton, A.M.; Lawrence, J.L.; Payton, R.R.; Dunlap, J.R. Exposure to a physiologically relevant elevated temperature hastens in vitro maturation in bovine oocytes. J. Dairy. Sci. 2005, 88, 4326–4333. [Google Scholar] [CrossRef] [PubMed]
- Payton, R.R.; Rispoli, L.A.; Nagle, K.A.; Gondro, C.; Saxton, A.M.; Voy, B.H.; Edwards, J.L. Mitochondrial-related consequences of heat stress exposure during bovine oocyte maturation persist in early embryo development. J. Reprod. Dev. 2018, 64, 243–251. [Google Scholar] [CrossRef]
- You, F.M.; Huo, N.; Gu, Y.Q.; Luo, M.-C.; Ma, Y.; Hane, D.; Lazo, G.R.; Dvorak, J.; Anderson, O.D. BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinform. 2008, 9, 253. [Google Scholar] [CrossRef]
- Mihelic, R.; Winter, H.; Powers, J.B.; Das, S.; Lamour, K.; Campagna, S.R.; Voy, B.H. Genes controlling polyunsaturated fatty acid synthesis are developmentally regulated in broiler chicks. Br. Poult. Sci. 2020, 61, 508–517. [Google Scholar] [CrossRef] [PubMed]
- Clements, J.; Lamour, K.; Frost, K.; Dwyer, J.; Huseth, A.; Groves, R.L. Targeted RNA sequencing reveals differential patterns of transcript expression in geographically discrete, insecticide resistant populations of Leptinotarsa decemlineata. Pest Manag. Sci. 2021, 77, 3436–3444. [Google Scholar] [CrossRef] [PubMed]
- Nguyen-Dumont, T.; Pope, B.J.; Hammet, F.; Southey, M.C.; Park, D.J. A high-plex PCR approach for massively parallel sequencing. BioTechniques 2013, 55, 69–74. [Google Scholar] [CrossRef] [PubMed]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 5 May 2022).
- Sturm, M.; Schroeder, C.; Bauer, P. SeqPurge: Highly-sensitive adapter trimming for paired-end NGS data. BMC Bioinform. 2016, 17, 208. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef]
- Chen, Y.; Lun, A.T.; Smyth, G.K. From reads to genes to pathways: Differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline. F1000Research 2016, 5, 1438. [Google Scholar] [PubMed]
- McCarthy, D.J.; Chen, Y.; Smyth, G.K. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res. 2012, 40, 4288–4297. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2009, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Risso, D.; Ngai, J.; Speed, T.P.; Dudoit, S. Normalization of RNA-seq data using factor analysis of control genes or samples. Nat. Biotechnol. 2014, 32, 896–902. [Google Scholar] [CrossRef] [PubMed]
- Su, S.; Law, C.W.; Ah-Cann, C.; Asselin-Labat, M.-L.; Blewitt, M.E.; Ritchie, M.E. Glimma: Interactive graphics for gene expression analysis. Bioinformatics 2017, 33, 2050–2052. [Google Scholar] [CrossRef]
- Foster, G.C.; Lane, D.; Scott, D.; Hebl, M.; Guerra, R.; Osherson, D.; Zimmer, H. An Introduction to Psychological Statistics; University of Missouri: St. Louis, MO, USA, 2018. [Google Scholar]
- Meier, U. A note on the power of Fisher’s least significant difference procedure. Pharm. Stat. 2006, 5, 253–263. [Google Scholar] [CrossRef]
- Senbon, S.; Hirao, Y.; Miyano, T. Interactions between the oocyte and surrounding somatic cells in follicular development: Lessons from in vitro culture. J. Reprod. Dev. 2003, 49, 259–269. [Google Scholar] [CrossRef] [PubMed]
- Kidder, G.M.; Vanderhyden, B.C. Bidirectional communication between oocytes and follicle cells: Ensuring oocyte developmental competence. Can. J. Physiol. Pharmacol. 2010, 88, 399–413. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Jiang, S.; Wozniak, P.J.; Yang, X.; Godke, R.A. Cumulus cell function during bovine oocyte maturation, fertilization, and embryo development in vitro. Mol. Reprod. Dev. 1995, 40, 338–344. [Google Scholar] [CrossRef] [PubMed]
- Geshi, M.; Takenouchi, N.; Yamauchi, N.; Nagai, T. Effects of sodium pyruvate in nonserum maturation medium on maturation, fertilization, and subsequent development of bovine oocytes with or without cumulus cells. Biol. Reprod. 2000, 63, 1730–1734. [Google Scholar] [CrossRef] [PubMed]
- Hyttel, P.; Xu, K.P.; Smith, S.; Greve, T. Ultrastructure of in-vitro oocyte maturation in cattle. Reproduction 1986, 78, 615–625. [Google Scholar] [CrossRef] [PubMed]
- Regassa, A.; Rings, F.; Hoelker, M.; Cinar, U.; Tholen, E.; Looft, C.; Schellander, K.; Tesfaye, D. Transcriptome dynamics and molecular cross-talk between bovine oocyte and its companion cumulus cells. BMC Genom. 2011, 12, 57. [Google Scholar] [CrossRef]
- Schoenfelder, M.; Schams, D.; Einspanier, R. Steroidogenesis during in vitro maturation of bovine cumulus oocyte complexes and possible effects of tri-butyltin on granulosa cells. J. Steroid Biochem. Mol. Biol. 2003, 84, 291–300. [Google Scholar] [CrossRef] [PubMed]
- Tosca, L.; Uzbekova, S.; Chabrolle, C.; Dupont, J. Possible role of 5′AMP-activated protein kinase in the metformin-mediated arrest of bovine oocytes at the germinal vesicle stage during in vitro maturation. Biol. Reprod. 2007, 77, 452–465. [Google Scholar] [CrossRef]
- Hyttel, P.; Fair, T.; Callesen, H.; Greve, T. Oocyte growth, capacitation and final maturation in cattle. Theriogenology 1997, 47, 23–32. [Google Scholar] [CrossRef]
- Sirard, M.-A. Factors affecting oocyte and embryo transcriptomes. Reprod. Domest. Anim. 2012, 47, 148–155. [Google Scholar] [CrossRef]
- Krischek, C.; Meinecke, B. In vitro maturation of bovine oocytes requires polyadenylation of mRNAs coding proteins for chromatin condensation, spindle assembly, MPF and MAP kinase activation. Anim. Reprod. Sci. 2002, 73, 129–140. [Google Scholar] [CrossRef]
- Báez, F.; Camargo, Á.; Reyes, A.L.; Márquez, A.; Paula-Lopes, F.; Viñoles, C. Time-dependent effects of heat shock on the zona pellucida ultrastructure and in vitro developmental competence of bovine oocytes. Reprod. Biol. 2019, 19, 195–203. [Google Scholar] [CrossRef] [PubMed]
- Ju, J.C.; Parks, J.E.; Yang, X. Thermotolerance of IVM-derived bovine oocytes and embryos after short-term heat shock. Mol. Reprod. Dev. 1999, 53, 336–340. [Google Scholar] [CrossRef]
- Stein, P.L.; Vogel, H.; Soriano, P. Combined deficiencies of Src, Fyn, and Yes tyrosine kinases in mutant mice. Genes Dev. 1994, 8, 1999–2007. [Google Scholar] [CrossRef] [PubMed]
- Levi, M.; Maro, B.; Shalgi, R. The involvement of Fyn kinase in resumption of the first meiotic division in mouse oocytes. Cell Cycle 2010, 9, 1577–1589. [Google Scholar] [CrossRef] [PubMed]
- Zheng, K.G.; Meng, X.Q.; Yang, Y.; Yu, Y.S.; Liu, D.C.; Li, Y.L. Requirements of Src family kinase during meiotic maturation in mouse oocyte. Mol. Reprod. Dev. 2007, 74, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Kheilova, K.; Petr, J.; Zalmanova, T.; Kucerova-Chrpova, V.; Rehak, D. Src family kinases are involved in the meiotic maturation of porcine oocytes. Reprod. Fertil. Dev. 2015, 27, 1097–1105. [Google Scholar] [CrossRef] [PubMed]
- Boonyaratanakornkit, V.; Scott, M.P.; Ribon, V.; Sherman, L.; Anderson, S.M.; Maller, J.L.; Miller, W.T.; Edwards, D.P. Progesterone receptor contains a proline-rich motif that directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Mol. Cell 2001, 8, 269–280. [Google Scholar] [CrossRef]
- Grossman, H.; Har-Paz, E.; Gindi, N.; Levi, M.; Miller, I.; Nevo, N.; Galiani, D.; Dekel, N.; Shalgi, R. Regulation of GVBD in mouse oocytes by miR-125a-3p and Fyn kinase through modulation of actin filaments. Sci. Rep. 2017, 7, 2238. [Google Scholar] [CrossRef] [PubMed]
- Goodwin, M.R.; Rispoli, L.A.; Payton, R.R.; Saxton, A.M.; Edwards, J.L. Developmental consequences of supplementing with matrix metallopeptidase-9 during in vitro maturation of heat-stressed bovine oocytes. J. Reprod. Dev. 2016, 62, 553–560. [Google Scholar] [CrossRef] [PubMed]
- Miller, W.L. Steroidogenesis: Unanswered questions. Trends Endocrinol. Metab. 2017, 28, 771–793. [Google Scholar] [CrossRef]
- Pratt, W.B. The role of the hsp90-based chaperone system in signal transduction by nuclear receptors and receptors signaling via MAP kinase. Annu. Rev. Pharmacol. Toxicol. 1997, 37, 297–326. [Google Scholar] [CrossRef]
- Duffy, D.M.; Ko, C.; Jo, M.; Brannstrom, M.; Curry, T.E., Jr. Ovulation: Parallels with inflammatory processes. Endocr. Rev. 2019, 40, 369–416. [Google Scholar] [CrossRef] [PubMed]
- Reed, C.B.; Meier, S.; Murray, L.A.; Burke, C.R.; Pitman, J.L. The microenvironment of ovarian follicles in fertile dairy cows is associated with high oocyte quality. Theriogenology 2022, 177, 195–205. [Google Scholar] [CrossRef]
- Imada, K.; Ito, A.; Sato, T.; Namiki, M.; Nagase, H.; Mori, Y. Hormonal regulation of matrix metalloproteinase 9/gelatinase B gene expression in rabbit uterine cervical fibroblasts. Biol. Reprod. 1997, 56, 575–580. [Google Scholar] [CrossRef] [PubMed]
- Shimonovitz, S.; Hurwitz, A.; Hochner-Celnikier, D.; Dushnik, M.; Anteby, E.; Yagel, S. Expression of gelatinase B by trophoblast cells: Down-regulation by progesterone. Am. J. Obstet. Gynecol. 1998, 178, 457–461. [Google Scholar] [CrossRef]
- Lee, D.-M.; Lee, T.-K.; Song, H.-B.; Kim, C.-H. The expression of matrix metalloproteinase-9 in human follicular fluid is associated with in vitro fertilisation pregnancy. BJOG 2005, 112, 946–951. [Google Scholar] [CrossRef] [PubMed]
- O’Leary, E.E.; Mazurkiewicz-Muñoz, A.M.; Argetsinger, L.S.; Maures, T.J.; Huynh, H.T.; Carter-Su, C. Identification of steroid-sensitive gene-1/Ccdc80 as a JAK2-binding protein. Mol. Endocrinol. 2013, 27, 619–634. [Google Scholar] [CrossRef]
- Marcantonio, D.; Chalifour, L.E.; Alaoui-Jamali, M.A.; Alpert, L.; Huynh, H.T. Cloning and characterization of a novel gene that is regulated by estrogen and is associated with mammary gland carcinogenesis. Endocrinology 2001, 142, 2409–2418. [Google Scholar] [CrossRef] [PubMed]
- Fortune, J.E.; Hansel, W. Concentrations of steroids and gonadotropins in follicular fluid from normal heifers and heifers primed for superovulation. Biol. Reprod. 1985, 32, 1069–1079. [Google Scholar] [CrossRef] [PubMed]
- Beker, A.R.C.L.; Colenbrander, B.; Bevers, M.M. Effect of 17β-estradiol on the in vitro maturation of bovine oocytes. Theriogenology 2002, 58, 1663–1673. [Google Scholar] [CrossRef] [PubMed]
- Shimada, M.; Hernandez-Gonzalez, I.; Gonzalez-Robayna, I.; Richards, J.S. Paracrine and autocrine regulation of epidermal growth factor-like factors in cumulus oocyte complexes and granulosa cells: Key roles for prostaglandin synthase 2 and progesterone receptor. Mol. Endocrinol. 2006, 20, 1352–1365. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.-Q.; Nyegaard, M.; Overgaard, M.T.; Qiao, J.; Giudice, L.C. Participation of mitogen-activated protein kinase in luteinizing hormone-induced differential regulation of steroidogenesis and steroidogenic gene expression in mural and cumulus granulosa cells of mouse preovulatory follicles. Biol. Reprod. 2006, 75, 859–867. [Google Scholar] [CrossRef]
- Norris, R.P.; Freudzon, M.; Mehlmann, L.M.; Cowan, A.E.; Simon, A.M.; Paul, D.L.; Lampe, P.D.; Jaffe, L.A. Luteinizing hormone causes MAP kinase-dependent phosphorylation and closure of connexin 43 gap junctions in mouse ovarian follicles: One of two paths to meiotic resumption. Development 2008, 135, 3229–3238. [Google Scholar] [CrossRef]
- Santiquet, N.; Sasseville, M.; Laforest, M.; Guillemette, C.; Gilchrist, R.B.; Richard, F.J. Activation of 5′ adenosine monophosphate-activated protein kinase blocks cumulus cell expansion through inhibition of protein synthesis during in vitro maturation in swine. Biol. Reprod. 2014, 91, 51. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Jung, J.I.; Park, K.Y.; Kim, S.A.; Kim, J. Synergistic inhibition effect of TNIK inhibitor KY-05009 and receptor tyrosine kinase inhibitor dovitinib on IL-6-induced proliferation and Wnt signaling pathway in human multiple myeloma cells. Oncotarget 2017, 8, 41091–41101. [Google Scholar] [CrossRef] [PubMed]
- Mahmoudi, T.; Li, V.S.W.; Ng, S.S.; Taouatas, N.; Vries, R.G.J.; Mohammed, S.; Heck, A.J.; Clevers, H. The kinase TNIK is an essential activator of Wnt target genes. EMBO J. 2009, 28, 3329–3340. [Google Scholar] [CrossRef] [PubMed]
- Shitashige, M.; Naishiro, Y.; Idogawa, M.; Honda, K.; Ono, M.; Hirohashi, S.; Yamada, T. Involvement of splicing factor-1 in beta-catenin/T-cell factor-4-mediated gene transactivation and pre-mRNA splicing. Gastroenterology 2007, 132, 1039–1054. [Google Scholar] [CrossRef] [PubMed]
- Sato, S.; Idogawa, M.; Honda, K.; Fujii, G.; Kawashima, H.; Takekuma, K.; Hoshika, A.; Hirohashi, S.; Yamada, T. Beta-catenin interacts with the FUS proto-oncogene product and regulates pre-mRNA splicing. Gastroenterology 2005, 129, 1225–1236. [Google Scholar] [CrossRef]
- Liu, W.; Xin, Q.; Wang, X.; Wang, S.; Wang, H.; Zhang, W.; Yang, Y.; Zhang, Y.; Zhang, Z.; Wang, C.; et al. Estrogen receptors in granulosa cells govern meiotic resumption of pre-ovulatory oocytes in mammals. Cell Death Dis. 2017, 8, e2662. [Google Scholar] [CrossRef] [PubMed]
- Vanderfiyden, B.C.; Telfer, E.E.; Eppig, J.J. Mouse oocytes promote proliferation of granulosa cells from preantral and antral follicles in vitro. Biol. Reprod. 1992, 46, 1196–1204. [Google Scholar] [CrossRef] [PubMed]
- Haraguchi, H.; Hirota, Y.; Saito-Fujita, T.; Tanaka, T.; Shimizu-Hirota, R.; Harada, M.; Akaeda, S.; Hiraoka, T.; Matsuo, M.; Matsumoto, L.; et al. Mdm2-p53-SF1 pathway in ovarian granulosa cells directs ovulation and fertilization by conditioning oocyte quality. FASEB J. 2019, 33, 2610–2620. [Google Scholar] [CrossRef]
- Kaul, R.; Mukherjee, S.; Ahmed, F.; Bhat, M.K.; Chhipa, R.; Galande, S.; Chattopadhyay, S. Direct interaction with and activation of p53 by SMAR1 retards cell-cycle progression at G2/M phase and delays tumor growth in mice. Int. J. Cancer 2003, 103, 606–615. [Google Scholar] [CrossRef]
- Cau, J.; Faure, S.; Vigneron, S.; Labbé, J.C.; Delsert, C.; Morin, N. Regulation of Xenopus p21-activated kinase (X-PAK2) by Cdc42 and maturation-promoting factor controls Xenopus oocyte maturation. J. Biol. Chem. 2000, 275, 2367–2375. [Google Scholar] [CrossRef] [PubMed]
- Sirotkin, A.V. Effect of two types of stress (heat shock/high temperature and malnutrition/serum deprivation) on porcine ovarian cell functions and their response to hormones. J. Exp. Biol. 2010, 213, 2125–2130. [Google Scholar] [CrossRef] [PubMed]
- Bustelo, X.R.; Sauzeau, V.; Berenjeno, I.M. GTP-binding proteins of the Rho/Rac family: Regulation, effectors and functions in vivo. BioEssays 2007, 29, 356–370. [Google Scholar] [CrossRef] [PubMed]
- Bochman, M.L.; Schwacha, A. The Mcm complex: Unwinding the mechanism of a replicative helicase. Microbiol. Mol. Biol. Rev. 2009, 73, 652–683. [Google Scholar] [CrossRef] [PubMed]
- Calder, M.D.; Caveney, A.N.; Smith, L.C.; Watson, A.J. Responsiveness of bovine cumulus-oocyte-complexes (COC) to porcine and recombinant human FSH, and the effect of COC quality on gonadotropin receptor and Cx43 marker gene mRNAs during maturation in vitro. Reprod. Biol. Endocrinol. 2003, 1, 14. [Google Scholar] [CrossRef]
- Dragovic, R.A.; Ritter, L.J.; Schulz, S.J.; Amato, F.; Thompson, J.G.; Armstrong, D.T.; Gilchrist, R.B. Oocyte-secreted factor activation of SMAD 2/3 signaling enables initiation of mouse cumulus cell expansion. Biol. Reprod. 2007, 76, 848–857. [Google Scholar] [CrossRef]
- Leal, C.L.V.; Mamo, S.; Fair, T.; Lonergan, P. Gene expression in bovine oocytes and cumulus cells after meiotic inhibition with the cyclin-dependent kinase inhibitor butyrolactone I. Reprod. Domest. Anim. 2012, 47, 615–624. [Google Scholar] [CrossRef]
- Jang, Y.-J.; Kim, J.-S.; Yun, P.-R.; Seo, Y.-W.; Lee, T.-H.; Park, J.-I.; Chun, S.-Y. Involvement of peroxiredoxin 2 in cumulus expansion and oocyte maturation in mice. Reprod. Fertil. Dev. 2020, 32, 783–791. [Google Scholar] [CrossRef]
- Camaioni, A.; Salustri, A.; Yanagishita, M.; Hascall, V.C. Proteoglycans and proteins in the extracellular matrix of mouse cumulus cell–oocyte complexes. Arch. Biochem. Biophys. 1996, 325, 190–198. [Google Scholar] [CrossRef]
- Lenz, R.; Ball, G.; Leibfried, M.; Ax, R.; First, N. In vitro maturation and fertilization of bovine oocytes are temperature-dependent processes. Biol. Reprod. 1983, 29, 173–179. [Google Scholar] [CrossRef]
- McKenzie, K.A.; Dias, J.A.; Cohen, B.D. Investigation of human follicle stimulating hormone residency in membrane microdomains. FASEB J. 2009, 23, 880.7. [Google Scholar] [CrossRef]
Official Gene Symbol | Gene Name | GenBank Accession Number | Amplicon Length (bp) | Forward Primer Sequence | Reverse Primer Sequence |
---|---|---|---|---|---|
ARHGAP31 | Rho GTPase activating protein 31 | NM_001205810.1 | 62 | CGGGAGTGTATTTGTGAGAGG | TTAGCTGGTCGGATGGTAGC |
ARHGAP6 | Rho GTPase activating protein 6 | NM_001191354.1 | 69 | TGGTGCAGAAAATGATCGAA | AGCACTTCATTCTGCAGATCC |
BANP | BTG3 associated nuclear protein | NM_001075620.1 | 67 | CAGGTCCAGATCCACCAGA | ACCTGGGCGATGTGTAGG |
BDKRB1 | Bradykinin receptor B1 | NM_001109999.1 | 74 | TCCCTTTCATTTTGCCTGAG | GGCTCTGGTTGAGAGTCTGG |
CAV1 | Caveolin 1 | NM_174004.3 | 79 | GTCTTCAACCAGCCACGAG | CGGATGGGAACAGTGTAGAGA |
CCDC25 | Coiled-coil domain containing 25 | XM_015472401.2 | 72 | CGGCTCATGTGTACCTTCG | CAGTCCATCAGCACCTCCTT |
CCDC80 | Coiled-coil domain containing 80 | NM_001098982.2 | 67 | CAGCTCTCTGCCCTCAGTG | AAAAGCTTCAGAACCGTTATGTG |
CTSB | Cathepsin B | NM_174031.2 | 78 | CTACAAAAATGGCCCAGTCG | GTGCTGGTACACCCCAGACT |
ESR2 | Estrogen receptor 2 | NM_174051.3 | 59 | GGACAGGGATGAAGGGAAAT | GCCAGGAGCATGTCAAAGAT |
ETFA | Electron transfer flavoprotein subunit α | NM_001075822.1 | 65 | CAGCATTTAGCTGGGATGAA | TGGAGCTTCTGGGTCTTTGT |
FDX1 | Ferredoxin 1 | NM_181011.2 | 66 | TTGATGGTTTTGGTGCATGT | TGCTGTTCAAAGATGAGGTGA |
FDXR | Ferredoxin reductase | NM_174691.1 | 68 | GATGTGCCAGGCCTCTACTG | CATGGTGGTGGTGATGACA |
FGR | FGR proto-oncogene, Src family tyrosine kinase | NM_001098991.1 | 76 | GGAGGGTCATGTTTTGAAGC | GCTCCATGTAGGCCATGC |
FSHR | Follicle stimulating hormone receptor | NM_174061.1 | 60 | ATGTTTTCCAGGGAGCCTCT | GAACGGATCCTGGTTCTTGA |
FYN | FYN proto-oncogene, Src family tyrosine kinase | NM_001077972.1 | 63 | CCAGGTTGATCGAGGACAAT | TCCACTTGATGGGGAACTTG |
HSD3B7 | Hydroxy-delta-5-steroid dehydrogenase, 3-beta- and steroid delta-isomerase 7 | NM_001034696.1 | 68 | CTAGCTGAGCAGCTCGTCCT | ACATGTCACTAGGGGCAACC |
HSP90AB1 | Heat shock protein 90 α family class B member 1 | NM_001079637.1 | 69 | AAGAAATTCTATGAGGCGTTCTC | GTCGCCGGTTAGTGGAGTC |
HSP90B1 | Heat shock protein 90 β family member 1 | NM_174700.2 | 77 | CACCCACTAATCAGAGACATGC | AACCACAGCAAGATCTGAAACA |
HTATIP2 | HIV-1 Tat interactive protein 2 | NM_001040563.1 | 71 | GGGAGCTGATAAGTCAAGCAA | AACTCTTCAACTCTAGCTTCCA |
IL6R | Interleukin 6 receptor | NM_001110785.3 | 62 | TCCAAAGATTCTGCAAAAACAA | GGGCAGTGGTACCGAAGTAG |
INHBB | Inhibin subunit β B | NM_176852.2 | 79 | CGTCTCCGAGATCATCAGC | CGTTGGAGATGAAGAAGTACAGG |
LCK | LCK proto-oncogene, Src family tyrosine kinase | NM_001034334.1 | 75 | TTGGTCTAGCACGCCTCATT | GCTGTCCACTTAATGGGAAACT |
LYN | LYN proto-oncogene, Src family tyrosine kinase | NM_001177740.2 | 67 | AGGAGCCCATCTACATCATCA | ATCGCTCTTCAGGAAATCCA |
MAPK3 | Mitogen-activated protein kinase 3 | NM_001110018.1 | 69 | CACCCCTACCTGGAGCAGTA | TGTCGAAGGTGAAAGGTTCC |
MCM6 | Minichromosome maintenance complex component 6 | NM_001046234.1 | 65 | CGTCTCTCTGAAGCGATGG | TTCCTTCACATGTTTAGGCTGA |
MDM2 | MDM2 proto-oncogene | NM_001099107.1 | 73 | CCTCAGCGAAGAAGGACAAG | CGCCTGCCTGATACACAGTA |
MMP9 | Matrix metallopeptidase 9 | NM_174744.2 | 59 | GAGGGTAAGGTGCTGCTGTT | CTGTGTCTTCACGTCGAACC |
NR5A1 | Nuclear receptor subfamily 5 group A member 1 | NM_174403.2 | 70 | TACCGTCAGATTCAGCATGG | GTGGTCAGCTCCACCTCCT |
PAK2 | p21 (RAC1) activated kinase 2 | XM_024984244.1 | 70 | GGAGAGCCTCCATACCTCAA | TCTGGGGTTCCATTAGTTGC |
PEAK1 | Pseudopodium enriched atypical kinase 1 | XM_024982035.1 | 69 | CCTGAATCCCTGTAGTGCAA | ATGCTTGGGAGGTATCATGG |
PGRMC2 | Progesterone receptor membrane component 2 | NM_001099060.1 | 66 | TGTTCGAGAATGGGAAATGC | CCCTGGTTTTAGGAGTCTGC |
PRDX2 | Peroxiredoxin 2 | NM_174763.2 | 62 | ATTATGGCGTGCTGAAGGAA | TGCCGTCGATGACAAAGAG |
PRKAA1 | Protein kinase AMP-activated catalytic subunit alpha 1 | NM_001109802.2 | 60 | TTGTGGCTCACCCAACTATG | TGGACCAGCATACAATCTTCC |
RAI14 | Retinoic acid induced 14 | XM_005221621.4 | 62 | CAGCAGCAGGTCAAACAGC | CACTTCCTGGTGTTGTTTCTTG |
RBM3 | RNA binding motif protein 3 | NM_001303463.1 | 64 | TGGATATGGAAGGTCCAGAGA | CCCCTGAGTAGCGGTCATAA |
SCN7A | Sodium voltage-gated channel alpha subunit 7 | XM_010802033.3 | 77 | TGCCAATTTCCACAAGCATA | CGATACTGTTTCTTCTGTTTCACTG |
SF1 | Splicing factor 1 | NM_001081614.1 | 65 | TACCTGGGAAGTACGCCTGT | CGGCATCATACCTTTTCCTT |
SLC26A2 | Solute carrier family 26 member 2 | NM_001040525.1 | 61 | TGGCAGCACTGTAACCTTTG | CCACTTGAAAGAAGCCCATT |
SNAP91 | Synaptosome associated protein 91 | NM_001105378.1 | 70 | GAGGCCACCCTTTGGAGT | TCTGAGAGGCAGGTGTAGGG |
SNX22 | Sorting nexin 22 | XM_005211652.4 | 61 | AGGGCTTGGAGGCCTATATC | TAGTTCCTTGGGCACATCCT |
SRC | SRC proto-oncogene, non-receptor tyrosine kinase | NM_001110804.2 | 69 | CTGGCTCGACTCATTGAAGA | CTGTCCACTTGATGGGGAAT |
TANC1 | Tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 | XM_024980437.1 | 60 | GTCTCGCTGCCGAAGAAA | GGCCTTGGAAGCAAATTCT |
TFRC | Transferrin receptor | NM_001206577.1 | 72 | AATCCCAGCGGTCTCTTTCT | ATAGGTGTCCATGGGAGTGC |
TNIK | TRAF2 and NCK interacting kinase | XM_002684922.5 | 66 | GTGCTCCAATGGGGAGAAAT | CCCAGCCCATTATCTGATTG |
TP53 | Tumor protein p53 | NM_174201.2 | 62 | CCTCTCCACAGCCAAAGAAG | ACCCACGGATCTGAAGAGTG |
TTYH1 | Tweety family member 1 | NM_001077015.1 | 78 | GGCACTGCTACATTGTCGTG | TCCTTCCAGGGTGTCTTCAC |
YES1 | YES proto-oncogene 1, Src family tyrosine kinase | NM_001101060.1 | 79 | TGGCTTAGCAAGGTTAATTGAAG | CAGGAGCTGTCCACTTGATTG |
Role 1 | Transcript Gene Symbol | IVM Temp (°C) | 0 hIVM | Direct Impact—41 °C | Delayed Impact—41 °C | First Affected hIVM | Pooled SEM | hIVM × IVM Temp p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
2 hIVM | 4 hIVM | 6 hIVM | 10 hIVM 2 | 24 hIVM 2 | ||||||||||
Progesterone production and/or signaling | FDX1 | 38.5 | 31,014 | 36,906 B | 38,258 B | 29,145 D | 49,090 A | 30,548 CD | 2 | 1066 | <0.0001 | |||
41.0 | 31,061 CD | 31,948 CD | 35,837 B | 29,414 D | 32,457 C | 1046 | ||||||||
FDXR | 38.5 | 19,012 | 18,666 A | 18,829 A | 15,001 B | 9210 D | 8690 DE | 2 | 641 | <0.0001 | ||||
41.0 | 15,887 B | 14,265 B | 11,882 C | 12,406 C | 7325 E | 629 | ||||||||
HSD3B7 | 38.5 | 23,899 | 20,030 DE | 16,954 EF | 22,002 CD | 13,857 F | 25,145 AB | 2 | 1105 | <0.0001 | ||||
41.0 | 23,778 ABC | 22,299 BCD | 14,800 F | 24,505 ABC | 26,541 A | 1084 | ||||||||
HSP90AB1 | 38.5 | 19,277 | 25,502 B | 24,980 B | 19,445 DE | 31,211 A | 20,030 DE | 2 | 762 | <0.0001 | ||||
41.0 | 20,473 DE | 21,218 CD | 22,607 C | 19,056 E | 20,944 CDE | 748 | ||||||||
HSP90B1 | 38.5 | 23,708 | 36,256 B | 37,361 B | 28,990 CD | 47,348 A | 26,655 D | 2 | 1783 | <0.0001 | ||||
41.0 | 29,643 CD | 32,889 BC | 34,825 B | 26,638 D | 27,526 D | 1750 | ||||||||
PGRMC2 | 38.5 | 24,783 | 32,263 B | 24,023 DE | 24,079 DE | 39,159 A | 24,315 DE | 2 | 1110 | <0.0001 | ||||
41.0 | 27,529 C | 26,625 CD | 28,392 C | 21,418 E | 23,603 DE | 1090 | ||||||||
Cellular signaling | BDKRB1 | 38.5 | 162 | 5884 D | 7973 D | 23,533 AB | 16,566 C | 13,999 C | 4 | 1404 | <0.0001 | |||
41.0 | 4763 D | 14,058 C | 20,479 B | 26,552 A | 14,269 C | 1384 | ||||||||
IL6R | 38.5 | 16,582 | 15,944 A | 10,993 BC | 14,016 AB | 5789 D | 5191 D | 6 | 1249 | <0.0001 | ||||
41.0 | 15,492 A | 14,070 AB | 9792 C | 15,762 A | 4442 D | 1226 | ||||||||
MAPK3 | 38.5 | 17,830 | 11,943 BC | 13,841 B | 10,709 BC | 6097 DE | 20,264 A | 6 | 1243 | <0.0001 | ||||
41.0 | 9008 CD | 10,236 BC | 4823 E | 18,981 A | 18,133 A | 1220 | ||||||||
MMP9 | 38.5 | 176 | 7606 D | 11,332 D | 19,787 BC | 29,568 A | 22,617 B | 4 | 1723 | <0.0001 | ||||
41.0 | 8165 D | 19,109 BC | 23,086 B | 21,046 BC | 16,782 C | 1692 | ||||||||
PRKAA1 | 38.5 | 37,760 | 35,582 C | 37,618 BC | 36,713 BC | 32,688 D | 38,875 AB | 6 | 1079 | <0.0001 | ||||
41.0 | 35,700 C | 37,383 BC | 31,995 D | 38,953 AB | 41,258 A | 1060 | ||||||||
β-catenin complex | ESR2 | 38.5 | 21,355 | 18,069 CD | 13,559 EF | 18,130 CD | 10,365 F | 21,473 AB | 4 | 1245 | <0.0001 | |||
41.0 | 20,216 ABC | 22,468 A | 15,440 DE | 18,653 BC | 21,174 ABC | 1225 | ||||||||
SF1 | 38.5 | 22,248 | 21,450 CD | 25,698 A | 20,685 D | 25,154 AB | 22,285 CD | 4 | 794 | 0.0002 | ||||
41.0 | 21,781 CD | 22,659 CD | 23,441 ABC | 20,859 D | 23,282 BC | 779 | ||||||||
TNIK | 38.5 | 8676 | 9361 C | 11,149 C | 22,815 AB | 25,642 A | 11,532 C | 4 | 1155 | <0.0001 | ||||
41.0 | 8423 C | 20,683 B | 22,000 B | 23,513 AB | 11,112 C | 1133 | ||||||||
Cell cycle | ARHGAP6 | 38.5 | 18,331 | 14,194 AB | 11,134 C | 14,578 AB | 5488 E | 12,221 BC | 4 | 901 | <0.0001 | |||
41.0 | 14,097 AB | 15,863 A | 8271 D | 13,123 BC | 13,621 ABC | 884 | ||||||||
ARHGAP31 | 38.5 | 20,552 | 14,009 B | 15,930 B | 19,949 A | 15,498 B | 20,399 A | 2 | 1168 | <0.0001 | ||||
41.0 | 20,971 A | 21,512 A | 15,282 B | 20,582 A | 19,919 A | 1146 | ||||||||
BANP | 38.5 | 13,469 | 11,478 C | 7153 D | 12,495 BC | 12,693 BC | 13,982 AB | 4 | 782 | 0.001 | ||||
41.0 | 12,157 BC | 12,186 BC | 15,965 A | 11,912 BC | 13,264 BC | 767 | ||||||||
MCM6 | 38.5 | 31,056 | 36,647 B | 37,376 B | 29,007 F | 48,505 A | 31,138 DEF | 2 | 975 | <0.0001 | ||||
41.0 | 30,353 DEF | 31,894 DE | 35,428 BC | 29,870 EF | 32,884 CD | 957 | ||||||||
MDM2 | 38.5 | 24,352 | 27,166 BC | 29,707 A | 24,297 D | 29,670 A | 24,385 D | 2 | 708 | <0.0001 | ||||
41.0 | 24,483 D | 23,951 D | 27,708 AB | 23,573 D | 25,395 CD | 695 | ||||||||
NR5A1 | 38.5 | 28,435 | 17,431 DE | 15,953 E | 22,877 CD | 9508 F | 30,282 AB | 2 | 2079 | <0.0001 | ||||
41.0 | 27,667 BC | 23,627 C | 11,861 EF | 26,127 BC | 34,189 A | 2040 | ||||||||
PAK2 | 38.5 | 25,343 | 31,463 B | 29,649 BC | 25,106 D | 42,966 A | 25,673 D | 2 | 1062 | <0.0001 | ||||
41.0 | 25,848 D | 26,542 CD | 30,117 B | 24,334 D | 27,044 CD | 1042 | ||||||||
TP53 | 38.5 | 23,042 | 20,643 BCD | 13,140 F | 18,920 CDE | 14,524 F | 23,761 AB | 4 | 1176 | 0.0006 | ||||
41.0 | 21,137 BCD | 18,268 DE | 16,406 EF | 21,726 ABC | 24,536 A | 1155 | ||||||||
Cumulus expansion | FSHR | 38.5 | 24,828 | 28,364 B | 29,031 AB | 22,211 CDE | 31,375 A | 20,167 E | 2 | 969 | <0.0001 | |||
41.0 | 23,195 CD | 22,326 CDE | 24,716 C | 20,966 DE | 21,674 DE | 951 | ||||||||
INHBB | 38.5 | 21,649 | 12,845 D | 18,161 C | 25,061 AB | 11,789 D | 24,157 AB | 2 | 1282 | <0.0001 | ||||
41.0 | 26,341 AB | 23,189 B | 13,551 D | 22,898 B | 27,003 A | 1258 | ||||||||
PRDX2 | 38.5 | 19,085 | 22,069 BC | 17,356 E | 19,722 CDE | 36,038 A | 21,472 CD | 2 | 926 | <0.0001 | ||||
41.0 | 19,294 DE | 18,524 E | 24,320 B | 21,495 CD | 21,108 CD | 909 |
hIVM First Impacted by 41 °C | Transcript Gene Symbol | IVM Temp (°C) | 0 hIVM | Direct Impact—41 °C | Delayed Impact—41 °C | Pooled SEM | hIVM × IVM Temp p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
2 hIVM | 4 hIVM | 6 hIVM | 10 hIVM 1 | 24 hIVM 1 | |||||||||
2 | SRC | 38.5 | 8976 | 8945 CD | 6742 DE | 12,058 BC | 4491 E | 8489 CD | 1382 | 0.0001 | |||
41.0 | 15,994 A | 14,250 AB | 7105 DE | 9584 CD | 8902 CD | 1356 | |||||||
4 | FYN | 38.5 | 44,884 | 48,207 CD | 39,394 F | 48,992 CD | 70,059 A | 44,866 DE | 1787 | <0.0001 | |||
41.0 | 49,540 CD | 50,928 C | 57,706 B | 49,554 CD | 40,928 EF | 1754 | |||||||
4 | LCK | 38.5 | 1777 | 2340 D | 3652 C | 5652 AB | 6157 A | 4542 BC | 490 | 0.0008 | |||
41.0 | 1835 D | 5537 AB | 5726 AB | 4090 C | 3616 C | 483 | |||||||
6 | FGR | 38.5 | 3498 | 5199 AB | 3369 DEF | 6109 A | 2597 F | 2712 EF | 462 | 0.005 | |||
41.0 | 5021 ABC | 3920 CDE | 4388 BCD | 4385 BCD | 2526 F | 454 | |||||||
10 | LYN | 38.5 | 4529 | 4079 B | 3676 BC | 6067 A | 1877 C | 4881 AB | 748 | 0.0008 | |||
41.0 | 4165 AB | 5155 AB | 4515 AB | 6120 A | 3697 BC | 735 | |||||||
10 | YES1 | 38.5 | 17,446 | 20,015 B | 15,985 D | 17,959 BCD | 23,810 A | 19,558 BC | 902 | 0.02 | |||
41.0 | 19,081 BC | 17,146 CD | 20,443 B | 20,456 B | 19,798 B | 885 |
Transcript Gene Symbol | IVM Temp (°C) | 0 hIVM | Direct Impact—41 °C | Delayed Impact—41 °C | First hIVM Affected by IVM Temp | Pooled SEM | hIVM × IVM Temp p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
2 hIVM | 4 hIVM | 6 hIVM | 10 hIVM 1 | 24 hIVM 1 | |||||||||
CCDC25 | 38.5 | 31,308 | 33,850 D | 40,611 B | 33,038 DE | 49,178 A | 32,556 DEF | 2 | 1064 | <0.0001 | |||
41.0 | 29,014 G | 32,379 DEF | 37,339 C | 30,641 EFG | 29,749 FG | 1044 | |||||||
CTSB | 38.5 | 25,243 | 22,336 B | 12,916 C | 24,597 AB | 27,109 A | 26,467 A | 4 | 1368 | <0.0001 | |||
41.0 | 25,336 AB | 26,263 A | 27,537 A | 24,296 AB | 26,826 A | 1342 | |||||||
ETFA | 38.5 | 26,445 | 29,886 BC | 34,166 A | 27,454 CD | 30,806 B | 27,216 CD | 2 | 1004 | 0.01 | |||
41.0 | 26,773 D | 26,835 D | 27,252 CD | 26,340 D | 25,133 D | 985 | |||||||
HTATIP2 | 38.5 | 22,469 | 22,176 AB | 12,638 E | 18,476 CD | 17,754 CD | 23,739 A | 4 | 971 | 0.0002 | |||
41.0 | 19,850 BC | 18,717 CD | 16,999 D | 18,541 CD | 22,116 AB | 954 | |||||||
PEAK1 | 38.5 | 18,058 | 13,853 E | 25,209 A | 17,703 C | 11,974 E | 20,053 BC | 4 | 1253 | <0.0001 | |||
41.0 | 14,560 DE | 17,381 CD | 12,373 E | 19,041 C | 23,167 AB | 1233 | |||||||
RBM3 | 38.5 | 32,657 | 40,004 B | 40,142 B | 31,047 C | 51,722 A | 31,677 C | 2 | 1337 | <0.0001 | |||
41.0 | 31,926 C | 34,069 C | 37,955 B | 31,554 C | 33,707 C | 1312 | |||||||
SCN7A | 38.5 | 340 | 1000 C | 2702 B | 4398 A | 1787 BC | 1012 C | 4 | 416 | 0.03 | |||
41.0 | 1136 C | 4925 A | 4334 A | 2864 B | 1098 C | 408 | |||||||
SLC26A2 | 38.5 | 26,849 | 24,262 B | 19,633 C | 27,371 A | 15,778 D | 28,389 A | 2 | 913 | <0.0001 | |||
41.0 | 29,649 A | 27,540 A | 24,940 B | 28,017 A | 28,961 A | 898 | |||||||
SNX22 | 38.5 | 20,829 | 16,065 AB | 13,351 BC | 18,141 A | 8793 D | 13,042 C | 6 | 1138 | <0.0001 | |||
41.0 | 14,610 BC | 15,116 BC | 13,859 BC | 18,427 A | 13,647 BC | 1118 | |||||||
TANC1 | 38.5 | 15,236 | 15,258 AB | 8533 CD | 9930 C | 6228 D | 13,946 B | 6 | 1005 | <0.0001 | |||
41.0 | 15,930 AB | 10,257 C | 5684 D | 18,056 A | 16,462 AB | 986 | |||||||
TTYH1 | 38.5 | 27,976 | 27,610 B | 30,916 A | 24,524 CDEF | 22,724 F | 22,895 EF | 4 | 876 | 0.0005 | |||
41.0 | 26,493 BC | 25,236 BCDE | 26,101 BCD | 23,859 DEF | 24,693 CDEF | 860 |
hIVM | Transcripts First Impacted by Exposure to 41 °C (#) 1 | Transcripts of Higher Abundance (#) | Transcripts of Lower Abundance (#) | Cumulative Proportion Affected (%) 2 | Transcripts (Higher or Lower Abundance) 3 |
---|---|---|---|---|---|
2 | 19 | 6 | 13 | 19/43 (44.1) | ARHGAP31 ↑, CCDC25 ↓, ETFA ↓, FDX1 ↓, FDXR ↓, FSHR ↓, HSD3B7 ↑, HSP90AB1 ↓, HSP90B1 ↓, INHBB ↑, MDM2 ↓, MCM6 ↓, NR5A1 ↑, PAK2 ↓, PGRMC2 ↓, PRDX2 ↓, RBM3 ↓, SLC26A2 ↑, SRC ↑ |
4 | 15 | 12 | 3 | 34/43 (79.1) | ARHGAP6 ↑, BANP ↑, BDKRB1 ↑, CTSB ↑, ESR2 ↑, FYN ↑, HTATIP2 ↑, LCK ↑, MMP9 ↑, PEAK1 ↓, SCN7A ↑, SF1 ↓, TNIK ↑, TP53 ↑, TTYH1 ↓ |
6 | 6 | 0 | 6 | 40/43 (93.0) | FGR ↓, IL6R ↓, MAPK3 ↓, PRKAA1 ↓, SNX22 ↓, TANC1 ↓ |
10 | 3 | 2 | 1 | 43/43 (100) | CAV1 ↑ 4, LYN ↑, YES1 ↓ |
24 | 0 | 0 | 0 | - | None |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Klabnik, J.L.; Beever, J.E.; Payton, R.R.; Lamour, K.H.; Schrick, F.N.; Edwards, J.L. A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature. Animals 2025, 15, 517. https://doi.org/10.3390/ani15040517
Klabnik JL, Beever JE, Payton RR, Lamour KH, Schrick FN, Edwards JL. A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature. Animals. 2025; 15(4):517. https://doi.org/10.3390/ani15040517
Chicago/Turabian StyleKlabnik, Jessica L., Jonathan E. Beever, Rebecca R. Payton, Kurt H. Lamour, F. Neal Schrick, and J. Lannett Edwards. 2025. "A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature" Animals 15, no. 4: 517. https://doi.org/10.3390/ani15040517
APA StyleKlabnik, J. L., Beever, J. E., Payton, R. R., Lamour, K. H., Schrick, F. N., & Edwards, J. L. (2025). A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature. Animals, 15(4), 517. https://doi.org/10.3390/ani15040517