Next Article in Journal
Evidence of Morphological and Morphometric Differences in the Sella Turcica of Pteronotus mesoamericanus and P. mexicanus
Previous Article in Journal
The Effects of Supplemental Feeding on Methane Emissions from Yak Grazing in the Warm Season
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature

by
Jessica L. Klabnik
1,*,†,
Jonathan E. Beever
1,2,
Rebecca R. Payton
1,
Kurt H. Lamour
3,
F. Neal Schrick
1 and
J. Lannett Edwards
1,*
1
Department of Animal Science, University of Tennessee Institute of Agriculture, Knoxville, TN 37996, USA
2
Department of Large Animal Clinical Sciences, University of Tennessee Institute of Agriculture, Knoxville, TN 37996, USA
3
Department of Entomology and Plant Pathology, University of Tennessee Institute of Agriculture, Knoxville, TN 37996, USA
*
Authors to whom correspondence should be addressed.
Current address: Department of Clinical Sciences, Auburn University, Auburn, AL 36849, USA.
Animals 2025, 15(4), 517; https://doi.org/10.3390/ani15040517
Submission received: 20 December 2024 / Revised: 31 January 2025 / Accepted: 8 February 2025 / Published: 12 February 2025
(This article belongs to the Section Animal Reproduction)

Simple Summary

The body temperature of female cattle increases when they become sexually receptive (i.e., in estrus). Because higher estrus-associated temperatures (HEAT) persist for hours in cattle, direct effects on fertility-important components (i.e., the oocyte and surrounding cumulus cells) are unavoidable and functionally impactful. To test the hypothesis, direct and delayed effects of the physiologically relevant, 41 °C exposure during the early stages of oocyte maturation was evaluated by examining the impact on 47 different targeted transcripts. Most transcripts examined were impacted in the first 2 to 4 h of oocyte maturation. Moreover, the use of multidimensional scaling plots to ‘visualize’ samples provided further evidence that oocytes exposed to an acute elevation in temperature are more advanced at the molecular level during the initial stages of maturation. The consequences and role of the described impacts on the oocyte and its surrounding cumulus cells during maturation are discussed.

Abstract

Elevated body temperature (HEAT) in sexually receptive females is a normal part of the periovulatory microenvironment. The objective was to identify direct (first 6 h) and delayed (4 h or 18 h of recovery) effects at 41 °C exposure during in vitro maturation (IVM) on transcripts involved in steroidogenesis, oocyte maturation, or previously impacted by elevated temperature using targeted RNA-sequencing. Most transcripts (72.3%) were impacted in the first 2 to 4 hIVM. Twelve of the fifteen transcripts first impacted at 4 hIVM had a higher abundance and three had a lower abundance. Direct exposure to 41 °C impacted the transcripts related to progesterone production and signaling, germinal vesicle breakdown, oocyte meiotic progression, transcriptional activity and/or alternative splicing, cell cycle, cumulus expansion, and/or ovulation. Three transcripts demonstrated a delayed impact; changes were not seen until the COCs recovered for 4 h. The use of multidimensional scaling plots to ‘visualize’ samples highlights that oocytes exposed to an acute elevation in temperature are more advanced at the molecular level during the initial stages of maturation. Described efforts represent important steps towards providing a novel insight into the dynamic physiology of the COC in the estrual female bovid, during HEAT and after body temperature returns to baseline.

1. Introduction

Higher estrus-associated temperatures (HEATs) are a hallmark feature in sexually receptive females even when thermoneutral conditions predominate [1]. The maximum level of HEAT typically coincides with the peak of the pivotally important luteinizing hormone (LH) surge [2,3,4], which induces the meiotic resumption and progression of the oocyte resident within the preovulatory follicle (i.e., oocyte maturation) and signifies the end of estrogen dominance, setting the stage for not only the beginning of corpus luteum formation but also ovulation some 26 to 30 h thereafter [5,6]. Although the magnitude and duration of HEAT varies among individual animals, Mills et al. [1] reported that 94% of suckled beef cows at the onset of the breeding season met the clinical definition of hyperthermia (>39.5 °C; [7]). Approximately 49.0% of cows in that study had vaginal temperatures > 40 °C which in some cases persisted up to 6.5 to 10 h, respectively [1]. In some but fewer instances, maximum HEAT exceeded 41.0 °C persisting up to 3.6 h.
When thermoneutral ambient conditions predominate, the level of HEAT and rectal temperature immediately before fixed timed AI have been positively related to fertility. For instance, a higher pregnancy outcome was reported in estrual cows that had rectal temperatures ranging from 38.7 to 40.5 °C immediately before artificial insemination compared to those with rectal temperatures ranging from 37.1 to 38.6 °C (73.5% vs. 60.2%, respectively [8]). When insemination was performed at a fixed time after administration of prostaglandin-F, a 1 °C increase in rectal temperature at the time of artificial insemination increased pregnancy odds 1.9 times [9].
Although the thermogenic component of estrus is short (average of 15.5 h, ranging from 6.2 to 26.2 h [1]) and ends well before ovulation would be expected [5,6], it is beyond intuitive for ovarian and follicle temperatures to become elevated during this pivotal developmentally important time. The temperature of the reproductive tract increases progressively toward the uterine horns [10], where the ovaries lie in the curvature. In pigs, Hunter et al. [11] showed that in instances where ovarian stromal tissue temperature was elevated during proestrus/estrus, the temperature of mature follicles was also elevated.
Regarding the potential to impact the cumulus–oocyte complex directly, exposure to an acute bout of an elevated temperature in vitro affects meiotic progression. Exposure to 41 °C for as few as 4 h promoted germinal vesicle breakdown (GVBD; [12]). The heat-induced hastening of GVBD compared to thermoneutral controls coincided with decreased gap junction permeability between the oocyte and associated cumulus cells [13]. Furthermore, exposure to an acute physiologically relevant temperature increases the progesterone production by COCs [13,14,15]. Interestingly, progesterone supplementation to the culture medium stimulates bovine GVBD [16] and meiotic progression [17].
Impactful outcomes related to elevated temperatures are not limited to in vitro studies. An acute in vivo bout of hyperthermia occurring after a pharmacologically induced surge of LH and induced by heat stress, resulted in changes in the periovulatory follicular fluid proteome (e.g., proinflammatory-mediator bradykinin, negative acute phase protein-transferrin, interleukin 6 [IL6]) [18]. These findings are intriguing because others have shown the ability of these components to potentiate ovulation, affect oocyte–meiotic progression, and are granulosa and or cumulus cell products [19,20,21,22]. The analysis of the transcriptome, via the bulk RNASeq of the cumulus cells [23] that enveloped oocytes while contained within periovulatory follicles of females exhibiting varying degrees of hyperthermia, identified 25 differentially expressed genes (DEGs) that increased or decreased with each 1 °C change in rectal temperature. Cumulus DEGs involved in cell junctions, plasma membrane rafts, and cell-cycle regulation are consistent with marked changes in the interconnectedness and the function of cumulus after the LH surge. Depending on the extent to which impacts are occurring at the junctional level, temperature-related changes in the cumulus may have indirect but impactful consequences on the oocyte as it resumes and undergoes meiotic maturation [13]. However, findings limited to a single time point (individual COCs were aspirated ~16 h after pharmacological induction of the LH surge [23]) well beyond initial stages of meiotic maturation, preclude further inference.
Mindful of what was known but compelled by what remained unknown about shorter exposure times, the overarching aim of the study described herein was to test the hypothesis that an acute bout of a physiologically relevant elevated temperature directly impacts COC-derived transcripts where corresponding protein product(s) may be involved or promote oocyte maturation, cumulus cell connectivity, expansion, and function (e.g., progesterone production). Heat exposure was limited for up to the first 6 h of in vitro maturation (2, 4, or 6 hIVM). To determine the extent to which heat-related consequences during early maturation may be delayed, transcript abundance in COCs was evaluated later in maturation and after recovery at 38.5 °C for 4 h (10 hIVM) or 18 h (24 hIVM). Examining the potential for the delayed impacts of an elevated temperature is important because these may contribute to the normal microenvironment after HEAT dissipates, which is yet to be described.
Targeted RNAseq was utilized to evaluate the transcript abundance. Doing so provided benefits from the dynamic range associated with next-generation sequencing-based quantification while being limited technically and monetarily by bulk RNAseq. Because targeted RNAseq enables the simultaneous investigation of transcripts, 20 of the cumulus derived transcripts identified by Klabnik et al. [23] that increased or decreased per each 1 °C change in rectal temperature were prioritized. Twenty-seven other transcripts previously shown to be impacted after in vitro heat stress exposure but for longer time periods [13,14,15] and known to be involved in oocyte maturation [14,15,23], cumulus expansion [14,23], and cumulus function [13,14,15,23] were also included. Having the opportunity to do so is of utmost importance because HEAT is an expected part of the normal ovarian preovulatory follicle environment in estrual females. It surprising how little is known about the intrinsic components/factors affected in the cumulus oocyte complex as it undergoes meiotic resumption and progression to metaphase II.

2. Materials and Methods

2.1. Collection and In Vitro Maturation of Bovine Cumulus–Oocyte Complexes

No animals were used for this work. This study was completed using an estimated 228 abattoir-derived ovaries provided by Southeastern Provision, LLC (Bean Station TN, USA) that followed humane slaughter practices per USDA guidelines and located within 50 min of campus. Prevalent Bos taurus cattle breeds included Angus, Hereford, Charolais and Holsteins. Ovaries were evaluated in pairs upon the removal of the reproductive tract. The presence of a corpus luteum was preferred but not always present. Ovaries with several antral follicles that were not visually atretic (e.g., clear follicle fluid) were used for this study. Reagents and chemicals were obtained from MilliporeSigma (St. Louis, MO, USA) unless otherwise noted. Cumulus–oocyte complexes from abattoir-derived ovaries were collected during January and February and matured as previously described [24]. Oocyte collection and maturation media were prepared as previously described [25].
Ovarian antral follicles 3 to ~12 mm in size were preferentially targeted/slashed using a sterile scalpel blade. The avoidance of larger follicles with larger fluid volumes obviated concerns with collection medium clotting. The selection of COCs having a tight and compacted cumulus with an evenly granulated ooplasm selects against COCs that may have resumed meiosis in larger follicles in response to an endogenous LH surge. Towards this end, 100% of the visually uniform COCs evaluated to date have an intact germinal vesicle (GV [12,26]; 500+ COCs fixed and stained soon after removal from antral follicles). Using maturation conditions previously described [24], >90% of GV-intact COCs would be expected to progress to metaphase II and undergo other important critical maturation events (e.g., cytoplasmic changes in the oocyte and cumulus expansion [12,13,14,26,27]).
Cumulus–oocyte complexes with compact cumulus vestments and homogenous ooplasm underwent in vitro maturation in polystyrene tubes; Sarstedt AG and Co. Nümbrecht, Germany). Per each oocyte collection day (i.e., experimental replicate), COCs (n = 35 per 0.5 mL maturation medium; experimental unit) were cultured at 38.5 °C (thermoneutral) for 2, 4, 6, 10, or 24 hIVM (Figure 1). To examine the direct impact of a physiologically relevant elevated temperature, COCs were exposed to 41 °C for 2, 4, or 6 hIVM. To examine the possible delayed impacts, COCs were cultured at 41 °C for 6 hIVM and then transferred to 38.5 °C for an additional 4 h (10 hIVM total) or 18 h (24 hIVM total) of recovery. This ultimately resulted in a 2 × 5 factorial treatment arrangement. Whenever sufficient numbers were available (5 of the 6 days of COC collection), a subset of COCs was also processed soon after removal from antral follicles to provide a 0 hIVM group. Incubator temperatures were validated using internal mercury thermometers.
Per each hIVM, COCs were removed from culture, washed in HEPES-TL containing 0.1% polyvinyl alcohol before lysis in extraction buffer (Quick-RNA Kit; Zymo Research, Irvine, CA, USA). Lysates were stored at −80 °C until RNA isolation [15]. This study was replicated on six different occasions and utilized a total of 2275 COCs.

2.2. Total RNA Isolation and cDNA Synthesis

Total RNA was isolated using Quick-RNA Microprep kits (Zymo Research) as per the manufacturer’s instructions. DNAse treatment was performed on column with TURBO DNase (Thermo Fisher Scientific, Waltham, MA, USA). The concentration of RNA was determined using the Qubit RNA High Sensitivity assay (Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA). Two COC pools were removed due to the low concentration of isolated RNA: one that was cultured at 38.5 °C for 4 hIVM and one that was processed at 0 hIVM. Isolated RNA was analyzed using RNA 6000 Nano kit on an Agilent 2100 Bioanalyzer or a standard RNA Screen on an Agilent 4200 TapeStation (Agilent Technologies, Santa Clara, CA, USA). RNA integrity number values ranged from 4.6 to 9.7 (mean ± standard deviation: 8.7 ± 0.1). Isolated total RNA (125 ng per pool of COCs) was converted to cDNA using the High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific) with oligo(dT)18 primers (Thermo Fisher Scientific) before storage at −80 °C.

2.3. Primer Design, Library Preparation, and Targeted Messenger RNA-Sequencing

Primers were designed using approximately 200 bp of sequence from the Bos taurus genome (Reference ARS-UCD1.2 Primary Assembly) with BatchPrimer3 to produce amplicons of 59 to 79 bp in length ([28]; Table 1). Only primer sets confirmed to span the exon–exon junction were utilized. Library preparation was performed on study cDNA in triplicate and sequenced using a Hi-Plex approach [29,30]. Targeted RNA sequencing was performed on an Illumina MiSeq device using a 2 × 150 configuration [31] by Floodlight Genomics (Knoxville, TN, USA). Raw sequence reads were trimmed of identifiers using CLC Genomics Workbench version 9.5.3. The quality of the reads was assessed using FastQC software, Version 0.11.9 [32]. Trimming was performed with SeqPurge [33] and Trimmomatic [34]. The per sequence quality score measured in the Phred quality scale was above 25 on average for all the samples [32]. Reads were then aligned to the Bos taurus transcriptome (ARS-UCD1.2) and counted using Salmon [35]. The trimmed means of the M values method of data normalization was performed using the EdgeR package [36,37,38], resulting in counts per million (CPM). Transcripts were retained for further analysis only if there was >2200 CPM in a minimum of 24 of the technical triplicates. Raw counts were then normalized in EdgeR and RUVr (k = 4) as part of the RUVSeq package [39]. Multidimensional scaling (MDS) plots of CPM reflecting either impacts of acute exposure to 41 °C in early maturation or subsequent recovery were generated with the Glimma package [40]. In the MDS plots, technical triplicates clustered closely together; therefore, the CPM of the technical triplicates for each transcript in each sample were averaged prior to statistical analyses.

2.4. Data and Statistical Analyses

In order to test hypotheses that each transcript may be directly impacted by an acute exposure to 41 °C in early maturation and may or may not recover later during later maturation, abundance (counts per million) of each transcript was analyzed individually as a randomized block design using generalized linear mixed models (PROC GLIMMIX, SAS 9.4, SAS Institute, Cary, NC, USA), blocking on the day of COC collection. Fixed effects per each transcript model included IVM temperature (38.5 and 41.0 °C), hIVM, and the respective interaction (IVM temperature × hIVM). Using this approach allowed for alpha (i.e., Type I Error Rate) to be set at 0.05 [41]. The only transcript data that were not normally distributed per Shapiro Wilk’s was CAV1, which had a unique expression pattern related to hIVM, and shown in results. Therefore, CAV1 data were also analyzed as a 2 × 4 factorial treatment arrangement with eight treatment combinations (2, 4, 6, and 10 hIVM); in this arrangement, data were normal (W = 0.91). Per each transcript, treatment combination differences were determined using Fishers protected least significant differences [42] and are reported as least squares means ± standard error. Average abundance (counts per million) for each transcript in subsets of COCs evaluated at 0 hIVM are provided for visual comparison but were not included in statistical analyses.

3. Results

Multidimensional scaling plots representing each in vitro maturation time and temperature treatment combination and performed in triplicate are provided in Figure 2. Differences in clustering related to time and temperature in early maturation were apparent. Interestingly, and relevant for the first 6 hIVM, samples originating from COCs directly exposed to 41 °C for 4 hIVM overlapped with those matured at 38.5 °C for 6 hIVM (Figure 2A). When allowed to recover at 38.5 °C for 4 h, samples originating from COCs directly exposed to 41 °C for 6 hIVM (10-HS in Figure 2) began to overlap with those matured at 38.5 °C for 6 hIVM (Figure 2B). Samples from COCs directly exposed to 6 h of 41 °C but not allowed any recovery time clustered between those originating from COCs matured at 38.5 °C for 6 and 10 hIVM. By 24 hIVM, however, samples from COCs matured at 38.5 °C (24-TN in Figure 2) versus those that were directly exposed to 41.0 °C for the first 6 hIVM but allowed to recover for a total of 18 h at 38.5 °C (24-HS in Figure 2) clustered with the most overlap (Figure 2B).
The abundance of the majority of individual transcripts (43 out of 47 total examined) differed depending on hIVM and IVM temperature (hIVM * IVM temperature interaction; p ≤ 0.05; Table 2, Table 3 and Table 4). The first hIVM in which IVM temperature impacted transcripts with described roles in progesterone production and/or signaling, cellular signaling, the β-catenin complex, the cell cycle, or cumulus expansion is provided in Table 2. Table 3 includes the first hIVM where IVM temperature impacted abundance of Src Family Kinase transcripts. Whereas Table 4 lists the first hIVM where IVM temperature impacted the abundance of transcripts with less defined roles in the COC but they, or their gene products, were reported by others to have been impacted by heat in cumulus cells, the oocyte, and/or in the follicular fluid. Due to the range of counts per million, CAV1 data were not normally distributed when analyzed as a 2 × 5 factorial treatment arrangement and only hIVM was significant (p < 0.0001; Figure 3). When only the earlier hIVM were included in the model (i.e., 2, 4, 6, and 10 hIVM), data were normal and the interaction was significant (hIVM * IVM temperature p < 0.0001; Figure 3 Inset).
Interestingly, 19 out of the 43 transcripts examined (44.1%) were impacted by 41 °C exposure after only 2 hIVM (6 were of higher abundance versus 13 of lower abundance; Table 5). Of the 15 transcripts with a first noticeable impact at 4 hIVM, 12 were of higher abundance whereas 3 were of lower abundance. Altogether, 34 (79.1%) and 40 (93.0%) out of 43 transcripts were first noticeably impacted by 4 and by 6 hIVM, respectively.
Pertaining to the four other transcripts examined (TFRC, CCDC80, SNAP91, and RAI14); TFRC was impacted by the IVM temperature (p = 0.004) and hIVM (p = 0.007). The only impact on CCDC80 was hIVM (p < 0.0001) but not IVM temperature (p = 0.5). Similarly, SNAP91 was impacted by hIVM (p = 0.0003) but not IVM temperature (p = 0.5). Although RAI14 was present (24,958 to 28,129 CPM), it was not impacted by hIVM (p = 0.4) or IVM temperature (p = 0.9).

4. Discussion

An overarching aim of the novel study described herein was to test the hypothesis that a short, acute bout of a physiologically relevant elevated temperature directly impacts COC-derived transcripts where corresponding protein product(s) may be involved in or affecting cumulus cell connectivity, expansion, and or function (e.g., progesterone production, cell signaling, cell cycle, β-catenin complex or other) which may indirectly or directly promote oocyte maturation. Allowing time for COCs to recover after heat exposure provided the additional opportunity to identify changes, if any, that may contribute to the normal microenvironment in the cow after HEAT dissipates. Deliberate effort to do this study during winter and abruptly expose naïve COCs to short bouts of heat “shock” in vitro, while not perfect, is necessary to gain new knowledge about possible intrinsic physiological events that may be occurring at the level of the cumulus to mediate meiotic resumption and progression of the oocyte, especially in circumstances where developmental outcomes are expected to be favorable.
When COCs were exposed to a short bout of heat in our study, the surrounding cumulus cells were intimately associated with the oocyte, projecting through the zona pellucida and into the oolemma via gap junctions [43]. Intimate connections with the oocyte permit bidirectional exchange of small molecules [44]. Cumulus presence is essential for meiotic resumption and the developmental progression thereafter [45,46]. Even after gap junctional connections breakdown, cumulus cells continue to envelop the oocyte providing critical support [47]. Thus, COCs remained intact before lysis.
Collectively, novel results described herein highlight direct and delayed effects on transcript abundance after short bouts of elevated temperature (i.e., 2, 4, or 6 h) were applied during the beginnings of oocyte maturation (i.e., meiotic resumption through GVBD). Of the 47 transcripts examined, 44 were impacted by heat with direct impacts noticed as early as 2 hIVM (majority of transcripts were affected after a 4 h exposure). Specific to impacts on the 20 in vivo-derived cumulus transcripts identified by Klabnik et al. [23] where abundance increased or decreased per each 1 °C change in rectal temperature of hyperthermic cows, 17 whose protein products are known to be involved in cell junctions, plasma membrane rafts, and cell-cycle regulation and other functions were directly impacted by heat as early as 2 and 4 hIVM.
Cumulus cells are transcriptionally active [48] and likely contribute much of the heat-related findings described herein. Despite having few to no LH receptors initially, cumulus begins to produce progesterone as oocyte maturation progresses [49,50]. In contrast, the transcriptionally quiescent oocyte relies on a depleting pool of maternal RNA and proteins after meiotic resumption [51,52]. Oligo-dT primers were used in our study to ascertain changes in transcript abundance likely to have a functional consequence [53]. The abundance patterns of certain transcripts (e.g., MMP9, CAV1, and IL6R) in COCs in our study were highly repeatable with patterns previously observed in COCs or cumulus cells alone after exposure for 12 h to 41 °C [14,15].
Interestingly, many of the targeted transcripts affected by heat exposure after 2 h were lower in abundance, whereas those affected by heat after 4 h were mostly higher in abundance. To gain a better perspective of these outcomes, COC samples were ‘visualized’ using multidimensional scaling. Remarkably, the targeted ‘transcriptome’ in COCs exposed to 41 °C for 4 h was more like the targeted transcriptome in COCs matured at 38.5 °C for 6 hIVM. The targeted transcriptome in COCs exposed to 41 °C for 6 h was in between that of COCs matured for 6 and 10 h at 38.5 °C. This finding is the first we are aware of to document a heat-induced shift at the transcriptomic level in the COC when considering numerous transcripts simultaneously within the same sample. Although the functional consequences of this molecular signature remain unclear, it is remarkable that the timing of the heat-induced shift in the targeted transcriptome overlaps/fits well with previous observations showing that the direct exposure of COCs to 41 °C for as few as 4 h promoted earlier germinal vesicle breakdown (GVBD; i.e., heat shocked oocytes underwent GVBD sooner and mature faster than thermoneutral controls; [12]). The follow-on efforts of Campen et al. [13] confirmed that the heat-induced hastening of GVBD in vitro coincided with decreased gap junction permeability between the oocyte and associated cumulus cells. Relevant for meiotic progression and subsequent development, in vitro exposure to 41 °C for up to 6 hIVM directly promotes GVBD [12,13,26] without negative impacts on meiotic progression to metaphase II [12,26] or early embryo development after fertilization [15,54,55]. Mindful of this, it is unsurprising that the 24 hIVM samples (COCs exposed to 38.5 °C and 41 °C for the first 6 hIVM but recovered for 18 h) overlapped on the multidimensional scaling plot. Depending on the extent to which HEAT exposure in vivo may be shifting developmentally important processes, additional effort may be needed to investigate insemination timing in circumstances where body temperature elevations are more pronounced and persist for a longer time.
A member of the Src-family kinases, FYN, was differentially expressed in the in vivo-derived cumulus transcripts identified by Klabnik et al. [23] in cows exhibiting varying levels of hyperthermia. This finding was especially intriguing because members of the Src-family have a large degree of functional overlap [56] and may impact meiotic maturation. Follow-on efforts in our study identified four Src-family kinases that were directly impacted by exposure to 41 °C (SRC, FYN, LCK, and FGR). Greater abundance in SRC at 2 hIVM and LCK at 4 hIVM were particularly notable. Although the significance of these findings remain unclear, others have shown that non-specific Src-family kinase inhibitors reduce GVBD (rats: [57]; mice: [57,58]; porcine: [59]). Src induces GVBD by binding to the progesterone receptor in Xenopus oocytes [60], whereas FYN has been shown to promote GVBD in mice [61].
Progesterone production by the cumulus cells increases as in vitro oocyte maturation progresses [13,14] and levels are higher after heat exposure [13,14,62]. Heat-induced increases in progesterone production may be related to changes in transcript abundance [13,14,15]. Interestingly, samples exposed to heat had a lower abundance of FDX1 and FDXR but a higher abundance of HSD3B7 at 2 and 4 hIVM. FDX1 and FDXR encode enzymes that donate electrons, perpetuating catalytic activity, to cytochrome p450 enzymes such as p450scc, which convert cholesterol to pregnenolone in the process of steroidogenesis. Pregnenolone is converted to progesterone by 3-beta-hydroxysteroid dehydrogenase (3βHSD, [63]).
The consequences of exposure to elevated temperature on progesterone signaling remain unclear. Genomic pathways of progesterone signaling rely upon HSP90 protein chaperones [64] in which progesterone binds to its nuclear receptors (PRα and PRβ) to regulate the transcription [65]. Herein, heat exposure altered HSP90AB1 and HSP90B1 transcript abundance throughout maturation which may impact progesterone signaling via traditional pathways. It was recently reported that heifers with a negative fertility breeding value had an increased expression of HSP90B1 in COCs collected near estrus [66]. However, progesterone signaling may also occur through non-genomic, membrane-bound progesterone receptors (PGRMC1 and PGRMC2; [65]); PGRMC2 transcript levels were impacted throughout oocyte maturation by heat beginning at 2 hIVM. Collectively, results suggest a role of progesterone and its downstream events in changes to COC physiology observed during IVM and in vivo maturation after short-term heat exposure.
It is possible that MMP9 was impacted by increased progesterone production by COCs exposed to physiologically relevant elevated temperature [13,14,15] as transcript abundance was lower in recovering COCs despite an initial higher abundance at 4 hIVM at 41 °C. Progesterone was inversely related to MMP9 levels in COCs exposed to 41 °C for 12 h [62] and suppressed MMP9 secretion in other cell types (cervical fibroblasts: [67]; placental cells: [68]). Rispoli et al. [14] reported similar findings regarding COCs that recovered from a 12 h exposure to 41 °C in early maturation. Decreased MMP9 coincided with a decreased secretion of the proMMP9 enzyme, which negatively impacted embryo development in bovines [14] and humans [69]. However, developmental competence was not rescued by the supplementation of the human proMMP9 [62].
Interleukin 6 (IL6) is promoted by progesterone production and may regulate COC function, cumulus expansion, and oocyte developmental competence [21]. In the current study, IL6R decreased over time, consistent with the outcomes from Rowinski et al. [15]. The binding of IL6 to its receptor can induce the JAK-STAT pathways [21] and CCDC80 increases the phosphorylation of STAT3 [70]. Interestingly, CCDC80 had a similar pattern of expression to IL6R (i.e., decreased through the first 10 hIVM), despite not being affected by temperature. The decline in CCDC80 may be functionally important as CCDC80 is positively regulated by estrogen in the uterus and mammary gland [71], estrogen declines in the follicle after the LH surge [72], and the addition of estrogen during in vitro maturation inhibited bovine oocyte nuclear maturation [73].
Another pathway that can be induced by IL6 is ERK1/2 signaling [21], which may be involved in gap junction communication and progesterone production [74,75,76]. The proportion of active ERK1/2 in cumulus cells increased in early maturation [13]. This was not reflected in the levels of MAPK3 transcripts (i.e., the gene encoding ERK2) within COCs in the current study, which were relatively stable during early maturation with heat-induced reductions at 6 hIVM. Alternatively, AMPK may also affect gap junction communication through the control of protein synthesis and progesterone production [50,77]; the gene encoding AMPK (PRKAA1) had a lower abundance under the exposure to 41 °C at 6 hIVM in the current study. Campen et al. [13] reported that AMPK peaked at 6 hIVM in COCs under thermoneutral conditions and culture at 41 °C tended to a lower active AMPK. This further supports the notion that a decline in AMPK, which may have a role in accelerated meiotic progression [50], could be due to elevated temperature.
The upregulation of TNIK in samples exposed to 41 °C for 4 h in the current study coincides with the timing of the earlier expression of IL6 and its signal transducer [15]. Others have reported that IL6 promoted the interaction of the TNIK/β-catenin/TCF4 complex (multiple myeloma cells: [78]); transcriptional activity of the β-catenin/TCF4 complex is promoted by TNIK [79] and inhibited by SF1, which induces an alternative splicing activity [80]. The timing of TNIK’s higher abundance coincides with a lower level of SF1, suggesting a shift towards earlier transcription. The abundance of SF1 transcripts was higher at 6 h in samples exposed to 41 °C, which suggests changes in alternative splicing during maturation. Furthermore, the estrogen receptor ESR2 may be alternatively spliced by β-catenin to an isoform with dominant negative activity (HeLa cells: [81]). In the current study, ESR2 was present throughout maturation and was of higher abundance when exposed to 41 °C at various hIVM. Prior to the LH surge, estrogen signaling maintains the oocyte in meiotic arrest [82] and the addition of estrogen during in vitro maturation inhibited bovine oocyte nuclear maturation [73]. Altogether, it is possible that that exposure to elevated temperature increases progesterone production [13,15] to promote/accelerate IL6 production [15,21], resulting in altered regulation β-catenin/TCF4 complex activity (through TNIK and SF1) to stimulate transcription and subsequently the alternative splicing of ESR2. The potential alternative splicing of ESR2 to a dominant negative form could possibly then allow for the nuclear maturation of the oocyte, despite the presence of the receptor mRNA throughout maturation.
The unique cell type of the cumulus versus the oocyte when analyzed as a complex creates difficulty in concluding the impacts of exposure to 41 °C during maturation on cell cycle regulation. Transcripts that are generally thought to have a role in cell cycle regulation may be of importance because, while the oocyte is undergoing nuclear maturation (but not DNA replication), the cumulus cells may no longer be mitotically active [83]. The cumulus cell MDM2-p53-NR5A1 pathway was previously described to impact oocyte quality, ovulation, and fertilization [84], where the increased expression of MDM2 and NR5A1 were correlated with positive outcomes. In the current study, MDM2 had lower levels of abundance when exposed to directly elevated temperature at 2 and 4 hIVM which could possibly relate to higher levels of BANP, a stabilizer of p53 [85], at 4 and 6 hIVM. While this could indicate a negative impact on the oocyte, NR5A1 had higher abundance when exposed to 41 °C for the majority of pairwise comparisons, suggesting the opposite. Furthermore, TP53 was only impacted by elevated temperature at 4 hIVM. In contrast, bovine cumulus cell BANP expression was decreased in response to a 12 h heat exposure at 16 h maturation in vivo [23] and at 24 h maturation in vitro [14]. Differences may be attributed to the fact that RNA was extracted from the entire COC in the current study, compared to only cumulus cells in Haraguchi et al. [84], Klabnik et al. [23], and Rispoli et al. [14]. Lower levels of PAK2 when exposed to 41 °C at 2 hIVM in the current study could potentially contribute to the heat-induced hastening of GVBD and progesterone production [13]. PAK2 maintains Xenopus oocyte meiotic arrest [86] and inhibits progesterone production in human granulosa cells [87]. The elevated levels of ARHGAP6 and ARHGAP31 and lower levels of MCM6 in early maturation when exposed to 41 °C may indicate the cessation of cell cyclicity. ARHGAPs inactivate GTPases to halt mitosis and cytoskeletal rearrangement [88]. The helicase complex that contains MCM6 is critical to DNA replication [89]. The complexity of the relationship between cumulus and oocyte as maturation events occur requires further study, independently of the effect of heat.
Three transcripts analyzed in the current study have been reported to positively impact cumulus expansion: FSHR, INHBB, and PRDX2. At the majority of hIVM in the current study, the abundance of FSHR was lower in COCs exposed to 41 °C but INHBB had a higher abundance. Cumulus expansion in bovine oocytes was induced by FSH and higher levels of FSHR were present in better quality COCs [90]. INHBB enabled FSH-induced cumulus cell expansion (mouse: [91]) and its expression increased from GV to MII stage in bovine oocytes [92]. In the current study, when exposed to 41 °C, PRDX2 had a lower abundance at 2 hIVM and after 4 h of recovery (10 hIVM), but higher abundance at 6 hIVM. A cumulus expansion was promoted by PRDX2 in mice [93]. Previously, an acute hyperthermia decreased PRDX2 in bovine cumulus cells ~16 h after a pharmacologically induced LH surge [23]. The abundance of the sulfa-transporter SLC26A2 was higher after exposure to 41 °C in the current study and after acute hyperthermia in bovine cumulus cells [23]. Although a direct role in the COC is unknown, sulfonated proteoglycans are thought to be required for successful COC expansion [94]. While prolonged heat shock reduced cumulus expansion [95], effects of shorter durations of elevated temperature (positive or negative) have not been noted by our laboratory (Edwards, unpublished observation).
Since our study focused on early maturation, it is unsurprising that the majority of targeted transcripts were impacted in the first 6 h. Only three transcripts demonstrated a delayed impact (i.e., first affected during recovery from heat) from exposure to 41 °C in early maturation (LYN, YES1, and CAV1) with differences first noted at 10 hIVM. Our lab previously reported that the elevated temperature decreased CAV1 at 24 hIVM but not at 12 hIVM [14]. Differences may be due to the shorter length of exposure to 41 °C (i.e., 6 h compared to 12 h) or the presence of oocytes (i.e., COC versus cumulus only) in the current study. Nevertheless, both studies demonstrated a similar pattern of expression over time. Although CAV1 precipitates with FSHR [96], its delayed expression suggests that it is not crucial for FSHR signaling in early maturation. The drastic upregulation late in maturation appears to be quite unique and is intriguing, particularly as the role of CAV1 in late maturation or events occurring after ovulation is unknown. Of the 43 transcripts that had a significant temperature by time interaction, only one transcript remained affected by 18 h of recovery (MMP9).

5. Conclusions

Because higher estrus-associated temperatures (HEATs) persist for hours in cattle, direct effects on fertility-important components (i.e., the oocyte and surrounding cumulus cells) are unavoidable and likely functionally impactful. Building off a foundation of knowledge, novel findings described herein highlight both the direct and delayed effects of short bouts of a physiologically relevant elevated temperature (i.e., 2, 4, or 6 h) when applied during the beginnings of oocyte maturation (i.e., meiotic resumption through GVBD). Direct consequences on COCs were noted as early as 2 hIVM and included impacts on transcript abundance whose protein products are known to be involved in cell junctions, plasma membrane rafts, and cell-cycle regulation and other functions that may indirectly or directly impact meiotic resumption and progression. Novel findings documenting a heat-induced shift in targeted transcriptome provide additional support for the heat-shocked COC to be more advanced. Depending on the extent to which HEAT exposure in vivo may be shifting developmentally important processes, additional effort may be needed to investigate insemination timing under circumstances where body temperature elevations are more pronounced and persist for a longer time.

Author Contributions

Conceptualization, J.L.K., R.R.P., F.N.S. and J.L.E.; Data curation, J.L.K.; Formal analysis, J.L.K., J.E.B., R.R.P., K.H.L. and J.L.E.; Funding acquisition, J.L.E.; Investigation, J.L.K., J.E.B., R.R.P., K.H.L. and J.L.E.; Methodology, J.L.K., J.E.B., R.R.P., K.H.L. and J.L.E.; Project administration, J.L.E.; Resources, J.L.E.; Supervision, J.L.E.; Visualization, J.L.K. and J.L.E.; Writing—original draft, J.L.K.; Writing—review and editing, J.L.K., J.E.B., R.R.P., K.H.L., F.N.S. and J.L.E. All authors have read and agreed to the published version of the manuscript.

Funding

This project was supported in part by the Agriculture and Food Research Initiative Competitive Grant No. 2022-67015-36374 (Project Director: J. Lannett Edwards) from the USDA National Institute of Food and Agriculture, the state of Tennessee through University of Tennessee Institute of Agriculture, AgResearch and the Genomics Center for the Advancement of Agriculture, the Department of Animal Science, and the USDA National Institute of Food and Agriculture, Multistate Project Accession No. 7003090; NE2227.

Institutional Review Board Statement

Not applicable—COCs abattoir-derived.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data presented in this study may be available for viewing upon submission of a reasonable request from the co-corresponding author at jlk0066@auburn.edu.

Acknowledgments

Special thanks are extended to James, Pam, and Kelsey Brantley for their generous contributions to our research efforts. We wish to thank Sujata Agarwal (UTIA Genomics Hub) for the use of the CLC Genomics Workbench, Taylor Seay and Matt Huff for technical assistance through their affiliation with the UTIA Genomics Center for Advancement of Agriculture and Joe May at the UT Genomics Core for assistance with RNA quality assessment. Appreciation is also extended to graduate students Megan Mills, Emma Horn, and Lisa Kirsten Senn for assistance with collection of COCs and undergraduate students Adella Lonas and Ella Pollock for assistance with electronic data verification.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
AMPKAMP-activated protein kinase
ARHGAP31Rho GTPase activating protein 31
ARHGAP6Rho GTPase activating protein 6
BANPBTG3 associated nuclear protein
BDKRB1Bradykinin receptor B1
CAV1Caveolin 1
CCDC25Coiled-coil domain containing 25
CCDC80Coiled-coil domain containing 80
COCCumulus–oocyte complex
CPMCounts per million
CTSBCathepsin B
DEGsDifferentially expressed genes
ESR2Estrogen receptor 2
ERKExtracellular signal-regulated kinase
ETFAElectron transfer flavoprotein subunit alpha
FDX1Ferredoxin 1
FDXRFerredoxin reductase
FGRFGR proto-oncogene, Src family tyrosine kinase
FSHRFollicle stimulating hormone receptor
FYNFYN proto-oncogene, Src family tyrosine kinase
GVBDGerminal vesicle breakdown
hHour(s)
HEATHigher estrus-associated temperature
hIVMHours of in vitro maturation
HSHeat shock
HSD3B7Hydroxy-delta-5-steroid dehydrogenase, 3-beta- and steroid delta-isomerase 7
HSP90AB1Heat shock protein 90 alpha family class B member 1
HSP90B1Heat shock protein 90 beta family member 1
HTATIP2HIV-1 Tat interactive protein 2
IL6RInterleukin 6 receptor
INHBBInhibin subunit beta B
LCKLCK proto-oncogene, Src family tyrosine kinase
LHLuetinizing hormone
LYNLYN proto-oncogene, Src family tyrosine kinase
MAPK3Mitogen-activated protein kinase 3
MCM6Minichromosome maintenance complex component 6
MDM2MDM2 proto-oncogene
MMP9Matrix metallopeptidase 9
NR5A1Nuclear receptor subfamily 5 group A member 1
PAK2p21 (RAC1) activated kinase 2
PEAK1Pseudopodium enriched atypical kinase 1
PGRMC2Progesterone receptor membrane component 2
PRDX2Peroxiredoxin 2
PRKAA1Protein kinase AMP-activated catalytic subunit alpha 1
RAI14Retinoic acid induced 14
RBM3RNA binding motif protein 3
SCN7ASodium voltage-gated channel alpha subunit 7
SF1Splicing factor 1
SLC26A2Solute carrier family 26 member 2
SNAP91Synaptosome associated protein 91
SNX22Sorting nexin 22
SRCSRC proto-oncogene, non-receptor tyrosine kinase
TANC1Tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
TFRCTransferrin receptor
TNThermoneutral
TNIKTRAF2 and NCK interacting kinase
TP53Tumor protein p53
TTYH1Tweety family member 1
YES1YES proto-oncogene 1, Src family tyrosine kinase

References

  1. Mills, M.D.; Pollock, A.B.; Batey, I.E.; O’Neil, M.A.; Schrick, F.N.; Payton, R.R.; Moorey, S.E.; Fioravanti, P.; Hipsher, W.; Zoca, S.M.; et al. Magnitude and persistence of higher estrus-associated temperatures in beef heifers and suckled cows. J. Anim. Sci. 2024, 102, skae079. [Google Scholar] [CrossRef]
  2. Higaki, S.; Miura, R.; Suda, T.; Andersson, L.M.; Okada, H.; Zhang, Y.; Itoh, T.; Miwakeichi, F.; Yoshioka, K. Estrous detection by continuous measurements of vaginal temperature and conductivity with supervised machine learning in cattle. Theriogenology 2019, 123, 90–99. [Google Scholar] [CrossRef]
  3. Rajamahendran, R.; Robinson, J.; Desbottes, S.; Walton, J.S. Temporal relationships among estrus, body temperature, milk yield, progesterone and luteinizing hormone levels, and ovulation in dairy cows. Theriogenology 1989, 31, 1173–1182. [Google Scholar] [CrossRef] [PubMed]
  4. Rajamahendran, R.; Taylor, C. Follicular dynamics and temporal relationships among body temperature, oestrus, the surge of luteinizing hormone and ovulation in Holstein heifers treated with norgestomet. J. Reprod. Fertil. 1991, 92, 461–467. [Google Scholar] [CrossRef]
  5. Giordano, J.O.; Edwards, J.L.; Di Croce, F.A.; Roper, D.; Rohrbach, N.R.; Saxton, A.M.; Schuenemann, G.M.; Prado, T.M.; Schrick, F.N. Ovulatory follicle dysfunction in lactating dairy cows after treatment with Folltropin-V at the onset of luteolysis. Theriogenology 2013, 79, 1210–1217. [Google Scholar] [CrossRef] [PubMed]
  6. Saumande, J.; Humblot, P. The variability in the interval between estrus and ovulation in cattle and its determinants. Anim. Reprod. Sci. 2005, 85, 171–182. [Google Scholar] [CrossRef] [PubMed]
  7. Constable, P.D.; Hinchcliff, K.W.; Done, S.H.; Grünberg, W. Clinical Examination and Making a Diagnosis. In Veterinary Medicine, 11th ed.; Constable, P.D., Hinchcliff, K.W., Done, S.H., Grünberg, W., Eds.; W.B. Saunders: Philadelphia, PA, USA, 2017; pp. 1–28. [Google Scholar]
  8. Fallon, G.R. Body temperature and fertilization in the cow. J. Reprod. Fertil. 1962, 3, 116–123. [Google Scholar] [CrossRef] [PubMed]
  9. Liles, H.L.; Schneider, L.G.; Pohler, K.G.; Oliveira Filho, R.V.; Schrick, F.N.; Payton, R.R.; Rhinehart, J.D.; Thompson, K.W.; McLean, K.; Edwards, J.L. Positive relationship of rectal temperature at fixed timed artificial insemination on pregnancy outcomes in beef cattle. J. Anim. Sci. 2022, 100, skac100. [Google Scholar] [CrossRef]
  10. El-Sheikh Ali, H.; Kitahara, G.; Tamura, Y.; Kobayashi, I.; Hemmi, K.; Torisu, S.; Sameshima, H.; Horii, Y.; Zaabel, S.; Kamimura, S. Presence of a temperature gradient among genital tract portions and the thermal changes within these portions over the estrous cycle in beef cows. J. Reprod. Dev. 2013, 59, 59–65. [Google Scholar] [CrossRef] [PubMed]
  11. Hunter, R.H.; Bogh, I.B.; Einer-Jensen, N.; Muller, S.; Greve, T. Pre-ovulatory graafian follicles are cooler than neighbouring stroma in pig ovaries. Hum. Reprod. 2000, 15, 273–283. [Google Scholar] [CrossRef]
  12. Hooper, L.M.; Payton, R.R.; Rispoli, L.A.; Saxton, A.M.; Edwards, J.L. Impact of heat stress on germinal vesicle breakdown and lipolytic changes during in vitro maturation of bovine oocytes. J. Reprod. Dev. 2015, 61, 459–464. [Google Scholar] [CrossRef] [PubMed]
  13. Campen, K.A.; Abbott, C.R.; Rispoli, L.A.; Payton, R.R.; Saxton, A.M.; Edwards, J.L. Heat stress impairs gap junction communication and cumulus function of bovine oocytes. J. Reprod. Dev. 2018, 64, 385–392. [Google Scholar] [CrossRef] [PubMed]
  14. Rispoli, L.A.; Payton, R.R.; Gondro, C.; Saxton, A.M.; Nagle, K.A.; Jenkins, B.W.; Schrick, F.N.; Edwards, J.L. Heat stress effects on the cumulus cells surrounding the bovine oocyte during maturation: Altered matrix metallopeptidase 9 and progesterone production. Reproduction 2013, 146, 193–207. [Google Scholar] [CrossRef] [PubMed]
  15. Rowinski, J.R.; Rispoli, L.A.; Payton, R.R.; Schneider, L.G.; Schrick, F.N.; McLean, K.J.; Edwards, J.L. Impact of an acute heat shock during in vitro maturation on interleukin 6 and its associated receptor component transcripts in bovine cumulus-oocyte complexes. Anim. Reprod. 2020, 17, e20200221. [Google Scholar] [CrossRef]
  16. Siqueira, L.C.; Barreta, M.H.; Gasperin, B.; Bohrer, R.; Santos, J.T.; Buratini, J., Jr.; Oliveira, J.F.; Goncalves, P.B. Angiotensin II, progesterone, and prostaglandins are sequential steps in the pathway to bovine oocyte nuclear maturation. Theriogenology 2012, 77, 1779–1787. [Google Scholar] [CrossRef]
  17. Sirotkin, A.V. Involvement of steroid hormones in bovine oocytes maturation in vitro. J. Steroid Biochem. Mol. Biol. 1992, 41, 855–858. [Google Scholar] [CrossRef]
  18. Rispoli, L.A.; Edwards, J.L.; Pohler, K.G.; Russell, S.; Somiari, R.I.; Payton, R.R.; Schrick, F.N. Heat-induced hyperthermia impacts the follicular fluid proteome of the periovulatory follicle in lactating dairy cows. PLoS ONE 2019, 14, e0227095. [Google Scholar] [CrossRef]
  19. Yoshimura, Y.; Espey, L.; Hosoi, Y.; Adachi, T.; Atlas, S.J.; Ghodgaonkar, R.B.; Dubin, N.H.; Wallach, E.E. The effects of bradykinin on ovulation and prostaglandin production by the perfused rabbit ovary. Endocrinology 1988, 122, 2540–2546. [Google Scholar] [CrossRef] [PubMed]
  20. Hellberg, P.; Larson, L.; Olofsson, J.; Hedin, L.; Brännström, M. Stimulatory effects of bradykinin on the ovulatory process in the in vitro-perfused rat ovary. Biol. Reprod. 1991, 44, 269–274. [Google Scholar] [CrossRef]
  21. Liu, Z.; de Matos, D.G.; Fan, H.Y.; Shimada, M.; Palmer, S.; Richards, J.S. Interleukin-6: An autocrine regulator of the mouse cumulus cell-oocyte complex expansion process. Endocrinology 2009, 150, 3360–3368. [Google Scholar] [CrossRef]
  22. Bromfield, J.J.; Sheldon, I.M. Lipopolysaccharide initiates inflammation in bovine granulosa cells via the TLR4 pathway and perturbs oocyte meiotic progression in vitro. Endocrinology 2011, 152, 5029–5040. [Google Scholar] [CrossRef]
  23. Klabnik, J.L.; Christenson, L.K.; Gunewardena, S.S.; Pohler, K.G.; Rispoli, L.A.; Payton, R.R.; Moorey, S.E.; Schrick, F.N.; Edwards, J.L. Heat-induced increases in body temperature in lactating dairy cows: Impact on the cumulus and granulosa cell transcriptome of the periovulatory follicle. J. Anim. Sci. 2022, 100, skac121. [Google Scholar] [CrossRef]
  24. Lawrence, J.L.; Payton, R.R.; Godkin, J.D.; Saxton, A.M.; Schrick, F.N.; Edwards, J.L. Retinol improves development of bovine oocytes compromised by heat stress during maturation. J. Dairy. Sci. 2004, 87, 2449–2454. [Google Scholar] [CrossRef] [PubMed]
  25. Rispoli, L.A.; Lawrence, J.L.; Payton, R.R.; Saxton, A.M.; Schrock, G.E.; Schrick, F.N.; Middlebrooks, B.W.; Dunlap, J.R.; Parrish, J.J.; Edwards, J.L. Disparate consequences of heat stress exposure during meiotic maturation: Embryo development after chemical activation vs fertilization of bovine oocytes. Reproduction 2011, 142, 831–843. [Google Scholar] [CrossRef] [PubMed]
  26. Edwards, J.L.; Saxton, A.M.; Lawrence, J.L.; Payton, R.R.; Dunlap, J.R. Exposure to a physiologically relevant elevated temperature hastens in vitro maturation in bovine oocytes. J. Dairy. Sci. 2005, 88, 4326–4333. [Google Scholar] [CrossRef] [PubMed]
  27. Payton, R.R.; Rispoli, L.A.; Nagle, K.A.; Gondro, C.; Saxton, A.M.; Voy, B.H.; Edwards, J.L. Mitochondrial-related consequences of heat stress exposure during bovine oocyte maturation persist in early embryo development. J. Reprod. Dev. 2018, 64, 243–251. [Google Scholar] [CrossRef]
  28. You, F.M.; Huo, N.; Gu, Y.Q.; Luo, M.-C.; Ma, Y.; Hane, D.; Lazo, G.R.; Dvorak, J.; Anderson, O.D. BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinform. 2008, 9, 253. [Google Scholar] [CrossRef]
  29. Mihelic, R.; Winter, H.; Powers, J.B.; Das, S.; Lamour, K.; Campagna, S.R.; Voy, B.H. Genes controlling polyunsaturated fatty acid synthesis are developmentally regulated in broiler chicks. Br. Poult. Sci. 2020, 61, 508–517. [Google Scholar] [CrossRef] [PubMed]
  30. Clements, J.; Lamour, K.; Frost, K.; Dwyer, J.; Huseth, A.; Groves, R.L. Targeted RNA sequencing reveals differential patterns of transcript expression in geographically discrete, insecticide resistant populations of Leptinotarsa decemlineata. Pest Manag. Sci. 2021, 77, 3436–3444. [Google Scholar] [CrossRef] [PubMed]
  31. Nguyen-Dumont, T.; Pope, B.J.; Hammet, F.; Southey, M.C.; Park, D.J. A high-plex PCR approach for massively parallel sequencing. BioTechniques 2013, 55, 69–74. [Google Scholar] [CrossRef] [PubMed]
  32. Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 5 May 2022).
  33. Sturm, M.; Schroeder, C.; Bauer, P. SeqPurge: Highly-sensitive adapter trimming for paired-end NGS data. BMC Bioinform. 2016, 17, 208. [Google Scholar] [CrossRef]
  34. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
  35. Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef]
  36. Chen, Y.; Lun, A.T.; Smyth, G.K. From reads to genes to pathways: Differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline. F1000Research 2016, 5, 1438. [Google Scholar] [PubMed]
  37. McCarthy, D.J.; Chen, Y.; Smyth, G.K. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res. 2012, 40, 4288–4297. [Google Scholar] [CrossRef] [PubMed]
  38. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2009, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
  39. Risso, D.; Ngai, J.; Speed, T.P.; Dudoit, S. Normalization of RNA-seq data using factor analysis of control genes or samples. Nat. Biotechnol. 2014, 32, 896–902. [Google Scholar] [CrossRef] [PubMed]
  40. Su, S.; Law, C.W.; Ah-Cann, C.; Asselin-Labat, M.-L.; Blewitt, M.E.; Ritchie, M.E. Glimma: Interactive graphics for gene expression analysis. Bioinformatics 2017, 33, 2050–2052. [Google Scholar] [CrossRef]
  41. Foster, G.C.; Lane, D.; Scott, D.; Hebl, M.; Guerra, R.; Osherson, D.; Zimmer, H. An Introduction to Psychological Statistics; University of Missouri: St. Louis, MO, USA, 2018. [Google Scholar]
  42. Meier, U. A note on the power of Fisher’s least significant difference procedure. Pharm. Stat. 2006, 5, 253–263. [Google Scholar] [CrossRef]
  43. Senbon, S.; Hirao, Y.; Miyano, T. Interactions between the oocyte and surrounding somatic cells in follicular development: Lessons from in vitro culture. J. Reprod. Dev. 2003, 49, 259–269. [Google Scholar] [CrossRef] [PubMed]
  44. Kidder, G.M.; Vanderhyden, B.C. Bidirectional communication between oocytes and follicle cells: Ensuring oocyte developmental competence. Can. J. Physiol. Pharmacol. 2010, 88, 399–413. [Google Scholar] [CrossRef] [PubMed]
  45. Zhang, L.; Jiang, S.; Wozniak, P.J.; Yang, X.; Godke, R.A. Cumulus cell function during bovine oocyte maturation, fertilization, and embryo development in vitro. Mol. Reprod. Dev. 1995, 40, 338–344. [Google Scholar] [CrossRef] [PubMed]
  46. Geshi, M.; Takenouchi, N.; Yamauchi, N.; Nagai, T. Effects of sodium pyruvate in nonserum maturation medium on maturation, fertilization, and subsequent development of bovine oocytes with or without cumulus cells. Biol. Reprod. 2000, 63, 1730–1734. [Google Scholar] [CrossRef] [PubMed]
  47. Hyttel, P.; Xu, K.P.; Smith, S.; Greve, T. Ultrastructure of in-vitro oocyte maturation in cattle. Reproduction 1986, 78, 615–625. [Google Scholar] [CrossRef] [PubMed]
  48. Regassa, A.; Rings, F.; Hoelker, M.; Cinar, U.; Tholen, E.; Looft, C.; Schellander, K.; Tesfaye, D. Transcriptome dynamics and molecular cross-talk between bovine oocyte and its companion cumulus cells. BMC Genom. 2011, 12, 57. [Google Scholar] [CrossRef]
  49. Schoenfelder, M.; Schams, D.; Einspanier, R. Steroidogenesis during in vitro maturation of bovine cumulus oocyte complexes and possible effects of tri-butyltin on granulosa cells. J. Steroid Biochem. Mol. Biol. 2003, 84, 291–300. [Google Scholar] [CrossRef] [PubMed]
  50. Tosca, L.; Uzbekova, S.; Chabrolle, C.; Dupont, J. Possible role of 5′AMP-activated protein kinase in the metformin-mediated arrest of bovine oocytes at the germinal vesicle stage during in vitro maturation. Biol. Reprod. 2007, 77, 452–465. [Google Scholar] [CrossRef]
  51. Hyttel, P.; Fair, T.; Callesen, H.; Greve, T. Oocyte growth, capacitation and final maturation in cattle. Theriogenology 1997, 47, 23–32. [Google Scholar] [CrossRef]
  52. Sirard, M.-A. Factors affecting oocyte and embryo transcriptomes. Reprod. Domest. Anim. 2012, 47, 148–155. [Google Scholar] [CrossRef]
  53. Krischek, C.; Meinecke, B. In vitro maturation of bovine oocytes requires polyadenylation of mRNAs coding proteins for chromatin condensation, spindle assembly, MPF and MAP kinase activation. Anim. Reprod. Sci. 2002, 73, 129–140. [Google Scholar] [CrossRef]
  54. Báez, F.; Camargo, Á.; Reyes, A.L.; Márquez, A.; Paula-Lopes, F.; Viñoles, C. Time-dependent effects of heat shock on the zona pellucida ultrastructure and in vitro developmental competence of bovine oocytes. Reprod. Biol. 2019, 19, 195–203. [Google Scholar] [CrossRef] [PubMed]
  55. Ju, J.C.; Parks, J.E.; Yang, X. Thermotolerance of IVM-derived bovine oocytes and embryos after short-term heat shock. Mol. Reprod. Dev. 1999, 53, 336–340. [Google Scholar] [CrossRef]
  56. Stein, P.L.; Vogel, H.; Soriano, P. Combined deficiencies of Src, Fyn, and Yes tyrosine kinases in mutant mice. Genes Dev. 1994, 8, 1999–2007. [Google Scholar] [CrossRef] [PubMed]
  57. Levi, M.; Maro, B.; Shalgi, R. The involvement of Fyn kinase in resumption of the first meiotic division in mouse oocytes. Cell Cycle 2010, 9, 1577–1589. [Google Scholar] [CrossRef] [PubMed]
  58. Zheng, K.G.; Meng, X.Q.; Yang, Y.; Yu, Y.S.; Liu, D.C.; Li, Y.L. Requirements of Src family kinase during meiotic maturation in mouse oocyte. Mol. Reprod. Dev. 2007, 74, 125–130. [Google Scholar] [CrossRef] [PubMed]
  59. Kheilova, K.; Petr, J.; Zalmanova, T.; Kucerova-Chrpova, V.; Rehak, D. Src family kinases are involved in the meiotic maturation of porcine oocytes. Reprod. Fertil. Dev. 2015, 27, 1097–1105. [Google Scholar] [CrossRef] [PubMed]
  60. Boonyaratanakornkit, V.; Scott, M.P.; Ribon, V.; Sherman, L.; Anderson, S.M.; Maller, J.L.; Miller, W.T.; Edwards, D.P. Progesterone receptor contains a proline-rich motif that directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Mol. Cell 2001, 8, 269–280. [Google Scholar] [CrossRef]
  61. Grossman, H.; Har-Paz, E.; Gindi, N.; Levi, M.; Miller, I.; Nevo, N.; Galiani, D.; Dekel, N.; Shalgi, R. Regulation of GVBD in mouse oocytes by miR-125a-3p and Fyn kinase through modulation of actin filaments. Sci. Rep. 2017, 7, 2238. [Google Scholar] [CrossRef] [PubMed]
  62. Goodwin, M.R.; Rispoli, L.A.; Payton, R.R.; Saxton, A.M.; Edwards, J.L. Developmental consequences of supplementing with matrix metallopeptidase-9 during in vitro maturation of heat-stressed bovine oocytes. J. Reprod. Dev. 2016, 62, 553–560. [Google Scholar] [CrossRef] [PubMed]
  63. Miller, W.L. Steroidogenesis: Unanswered questions. Trends Endocrinol. Metab. 2017, 28, 771–793. [Google Scholar] [CrossRef]
  64. Pratt, W.B. The role of the hsp90-based chaperone system in signal transduction by nuclear receptors and receptors signaling via MAP kinase. Annu. Rev. Pharmacol. Toxicol. 1997, 37, 297–326. [Google Scholar] [CrossRef]
  65. Duffy, D.M.; Ko, C.; Jo, M.; Brannstrom, M.; Curry, T.E., Jr. Ovulation: Parallels with inflammatory processes. Endocr. Rev. 2019, 40, 369–416. [Google Scholar] [CrossRef] [PubMed]
  66. Reed, C.B.; Meier, S.; Murray, L.A.; Burke, C.R.; Pitman, J.L. The microenvironment of ovarian follicles in fertile dairy cows is associated with high oocyte quality. Theriogenology 2022, 177, 195–205. [Google Scholar] [CrossRef]
  67. Imada, K.; Ito, A.; Sato, T.; Namiki, M.; Nagase, H.; Mori, Y. Hormonal regulation of matrix metalloproteinase 9/gelatinase B gene expression in rabbit uterine cervical fibroblasts. Biol. Reprod. 1997, 56, 575–580. [Google Scholar] [CrossRef] [PubMed]
  68. Shimonovitz, S.; Hurwitz, A.; Hochner-Celnikier, D.; Dushnik, M.; Anteby, E.; Yagel, S. Expression of gelatinase B by trophoblast cells: Down-regulation by progesterone. Am. J. Obstet. Gynecol. 1998, 178, 457–461. [Google Scholar] [CrossRef]
  69. Lee, D.-M.; Lee, T.-K.; Song, H.-B.; Kim, C.-H. The expression of matrix metalloproteinase-9 in human follicular fluid is associated with in vitro fertilisation pregnancy. BJOG 2005, 112, 946–951. [Google Scholar] [CrossRef] [PubMed]
  70. O’Leary, E.E.; Mazurkiewicz-Muñoz, A.M.; Argetsinger, L.S.; Maures, T.J.; Huynh, H.T.; Carter-Su, C. Identification of steroid-sensitive gene-1/Ccdc80 as a JAK2-binding protein. Mol. Endocrinol. 2013, 27, 619–634. [Google Scholar] [CrossRef]
  71. Marcantonio, D.; Chalifour, L.E.; Alaoui-Jamali, M.A.; Alpert, L.; Huynh, H.T. Cloning and characterization of a novel gene that is regulated by estrogen and is associated with mammary gland carcinogenesis. Endocrinology 2001, 142, 2409–2418. [Google Scholar] [CrossRef] [PubMed]
  72. Fortune, J.E.; Hansel, W. Concentrations of steroids and gonadotropins in follicular fluid from normal heifers and heifers primed for superovulation. Biol. Reprod. 1985, 32, 1069–1079. [Google Scholar] [CrossRef] [PubMed]
  73. Beker, A.R.C.L.; Colenbrander, B.; Bevers, M.M. Effect of 17β-estradiol on the in vitro maturation of bovine oocytes. Theriogenology 2002, 58, 1663–1673. [Google Scholar] [CrossRef] [PubMed]
  74. Shimada, M.; Hernandez-Gonzalez, I.; Gonzalez-Robayna, I.; Richards, J.S. Paracrine and autocrine regulation of epidermal growth factor-like factors in cumulus oocyte complexes and granulosa cells: Key roles for prostaglandin synthase 2 and progesterone receptor. Mol. Endocrinol. 2006, 20, 1352–1365. [Google Scholar] [CrossRef] [PubMed]
  75. Su, Y.-Q.; Nyegaard, M.; Overgaard, M.T.; Qiao, J.; Giudice, L.C. Participation of mitogen-activated protein kinase in luteinizing hormone-induced differential regulation of steroidogenesis and steroidogenic gene expression in mural and cumulus granulosa cells of mouse preovulatory follicles. Biol. Reprod. 2006, 75, 859–867. [Google Scholar] [CrossRef]
  76. Norris, R.P.; Freudzon, M.; Mehlmann, L.M.; Cowan, A.E.; Simon, A.M.; Paul, D.L.; Lampe, P.D.; Jaffe, L.A. Luteinizing hormone causes MAP kinase-dependent phosphorylation and closure of connexin 43 gap junctions in mouse ovarian follicles: One of two paths to meiotic resumption. Development 2008, 135, 3229–3238. [Google Scholar] [CrossRef]
  77. Santiquet, N.; Sasseville, M.; Laforest, M.; Guillemette, C.; Gilchrist, R.B.; Richard, F.J. Activation of 5′ adenosine monophosphate-activated protein kinase blocks cumulus cell expansion through inhibition of protein synthesis during in vitro maturation in swine. Biol. Reprod. 2014, 91, 51. [Google Scholar] [CrossRef] [PubMed]
  78. Lee, Y.; Jung, J.I.; Park, K.Y.; Kim, S.A.; Kim, J. Synergistic inhibition effect of TNIK inhibitor KY-05009 and receptor tyrosine kinase inhibitor dovitinib on IL-6-induced proliferation and Wnt signaling pathway in human multiple myeloma cells. Oncotarget 2017, 8, 41091–41101. [Google Scholar] [CrossRef] [PubMed]
  79. Mahmoudi, T.; Li, V.S.W.; Ng, S.S.; Taouatas, N.; Vries, R.G.J.; Mohammed, S.; Heck, A.J.; Clevers, H. The kinase TNIK is an essential activator of Wnt target genes. EMBO J. 2009, 28, 3329–3340. [Google Scholar] [CrossRef] [PubMed]
  80. Shitashige, M.; Naishiro, Y.; Idogawa, M.; Honda, K.; Ono, M.; Hirohashi, S.; Yamada, T. Involvement of splicing factor-1 in beta-catenin/T-cell factor-4-mediated gene transactivation and pre-mRNA splicing. Gastroenterology 2007, 132, 1039–1054. [Google Scholar] [CrossRef] [PubMed]
  81. Sato, S.; Idogawa, M.; Honda, K.; Fujii, G.; Kawashima, H.; Takekuma, K.; Hoshika, A.; Hirohashi, S.; Yamada, T. Beta-catenin interacts with the FUS proto-oncogene product and regulates pre-mRNA splicing. Gastroenterology 2005, 129, 1225–1236. [Google Scholar] [CrossRef]
  82. Liu, W.; Xin, Q.; Wang, X.; Wang, S.; Wang, H.; Zhang, W.; Yang, Y.; Zhang, Y.; Zhang, Z.; Wang, C.; et al. Estrogen receptors in granulosa cells govern meiotic resumption of pre-ovulatory oocytes in mammals. Cell Death Dis. 2017, 8, e2662. [Google Scholar] [CrossRef] [PubMed]
  83. Vanderfiyden, B.C.; Telfer, E.E.; Eppig, J.J. Mouse oocytes promote proliferation of granulosa cells from preantral and antral follicles in vitro. Biol. Reprod. 1992, 46, 1196–1204. [Google Scholar] [CrossRef] [PubMed]
  84. Haraguchi, H.; Hirota, Y.; Saito-Fujita, T.; Tanaka, T.; Shimizu-Hirota, R.; Harada, M.; Akaeda, S.; Hiraoka, T.; Matsuo, M.; Matsumoto, L.; et al. Mdm2-p53-SF1 pathway in ovarian granulosa cells directs ovulation and fertilization by conditioning oocyte quality. FASEB J. 2019, 33, 2610–2620. [Google Scholar] [CrossRef]
  85. Kaul, R.; Mukherjee, S.; Ahmed, F.; Bhat, M.K.; Chhipa, R.; Galande, S.; Chattopadhyay, S. Direct interaction with and activation of p53 by SMAR1 retards cell-cycle progression at G2/M phase and delays tumor growth in mice. Int. J. Cancer 2003, 103, 606–615. [Google Scholar] [CrossRef]
  86. Cau, J.; Faure, S.; Vigneron, S.; Labbé, J.C.; Delsert, C.; Morin, N. Regulation of Xenopus p21-activated kinase (X-PAK2) by Cdc42 and maturation-promoting factor controls Xenopus oocyte maturation. J. Biol. Chem. 2000, 275, 2367–2375. [Google Scholar] [CrossRef] [PubMed]
  87. Sirotkin, A.V. Effect of two types of stress (heat shock/high temperature and malnutrition/serum deprivation) on porcine ovarian cell functions and their response to hormones. J. Exp. Biol. 2010, 213, 2125–2130. [Google Scholar] [CrossRef] [PubMed]
  88. Bustelo, X.R.; Sauzeau, V.; Berenjeno, I.M. GTP-binding proteins of the Rho/Rac family: Regulation, effectors and functions in vivo. BioEssays 2007, 29, 356–370. [Google Scholar] [CrossRef] [PubMed]
  89. Bochman, M.L.; Schwacha, A. The Mcm complex: Unwinding the mechanism of a replicative helicase. Microbiol. Mol. Biol. Rev. 2009, 73, 652–683. [Google Scholar] [CrossRef] [PubMed]
  90. Calder, M.D.; Caveney, A.N.; Smith, L.C.; Watson, A.J. Responsiveness of bovine cumulus-oocyte-complexes (COC) to porcine and recombinant human FSH, and the effect of COC quality on gonadotropin receptor and Cx43 marker gene mRNAs during maturation in vitro. Reprod. Biol. Endocrinol. 2003, 1, 14. [Google Scholar] [CrossRef]
  91. Dragovic, R.A.; Ritter, L.J.; Schulz, S.J.; Amato, F.; Thompson, J.G.; Armstrong, D.T.; Gilchrist, R.B. Oocyte-secreted factor activation of SMAD 2/3 signaling enables initiation of mouse cumulus cell expansion. Biol. Reprod. 2007, 76, 848–857. [Google Scholar] [CrossRef]
  92. Leal, C.L.V.; Mamo, S.; Fair, T.; Lonergan, P. Gene expression in bovine oocytes and cumulus cells after meiotic inhibition with the cyclin-dependent kinase inhibitor butyrolactone I. Reprod. Domest. Anim. 2012, 47, 615–624. [Google Scholar] [CrossRef]
  93. Jang, Y.-J.; Kim, J.-S.; Yun, P.-R.; Seo, Y.-W.; Lee, T.-H.; Park, J.-I.; Chun, S.-Y. Involvement of peroxiredoxin 2 in cumulus expansion and oocyte maturation in mice. Reprod. Fertil. Dev. 2020, 32, 783–791. [Google Scholar] [CrossRef]
  94. Camaioni, A.; Salustri, A.; Yanagishita, M.; Hascall, V.C. Proteoglycans and proteins in the extracellular matrix of mouse cumulus cell–oocyte complexes. Arch. Biochem. Biophys. 1996, 325, 190–198. [Google Scholar] [CrossRef]
  95. Lenz, R.; Ball, G.; Leibfried, M.; Ax, R.; First, N. In vitro maturation and fertilization of bovine oocytes are temperature-dependent processes. Biol. Reprod. 1983, 29, 173–179. [Google Scholar] [CrossRef]
  96. McKenzie, K.A.; Dias, J.A.; Cohen, B.D. Investigation of human follicle stimulating hormone residency in membrane microdomains. FASEB J. 2009, 23, 880.7. [Google Scholar] [CrossRef]
Figure 1. Study schematic. To examine the direct impact of acute elevated temperature occurring in early maturation, subsets of cumulus–oocyte complexes (COCs; n = 35 COCs per pool) were cultured for 2, 4, or 6 h of in vitro maturation (hIVM) at 41 °C. To examine how COCs recover from an acute exposure to elevated temperature occurring during early maturation (i.e., delayed impact), COCs were cultured at 41 °C for 6 hIVM and then allowed to recover at 38.5 °C for an additional 4 h (10 hIVM total) or 18 h (24 hIVM total). Subsets of COCs were cultured for 2, 4, 6, 10, or 24 hIVM at 38.5 °C for comparison. * Whenever sufficient numbers were present, a subset of COCs was also processed soon after removal from ovary to provide a 0 hIVM group.
Figure 1. Study schematic. To examine the direct impact of acute elevated temperature occurring in early maturation, subsets of cumulus–oocyte complexes (COCs; n = 35 COCs per pool) were cultured for 2, 4, or 6 h of in vitro maturation (hIVM) at 41 °C. To examine how COCs recover from an acute exposure to elevated temperature occurring during early maturation (i.e., delayed impact), COCs were cultured at 41 °C for 6 hIVM and then allowed to recover at 38.5 °C for an additional 4 h (10 hIVM total) or 18 h (24 hIVM total). Subsets of COCs were cultured for 2, 4, 6, 10, or 24 hIVM at 38.5 °C for comparison. * Whenever sufficient numbers were present, a subset of COCs was also processed soon after removal from ovary to provide a 0 hIVM group.
Animals 15 00517 g001
Figure 2. Multidimensional scaling plots highlighting differences in counts per million that resulted from efforts to examine abundance of 47 different targeted transcripts in cumulus–oocyte complexes. (A) COCs were cultured at 38.5 (Thermoneutral-TN) or 41 °C (Heat Shock-HS) for the first 2, 4 or 6 hIVM; 0 hIVM were included as a reference; (B) COCs were matured at 41 °C for 6 hIVM (6-HS) or allowed to recover at 38.5 °C for 4 h (10-HS*) or 18 h (24-HS*), thereafter in comparison to COCs cultured at 38.5 °C for 6, 10, and 24 hIVM (TN).
Figure 2. Multidimensional scaling plots highlighting differences in counts per million that resulted from efforts to examine abundance of 47 different targeted transcripts in cumulus–oocyte complexes. (A) COCs were cultured at 38.5 (Thermoneutral-TN) or 41 °C (Heat Shock-HS) for the first 2, 4 or 6 hIVM; 0 hIVM were included as a reference; (B) COCs were matured at 41 °C for 6 hIVM (6-HS) or allowed to recover at 38.5 °C for 4 h (10-HS*) or 18 h (24-HS*), thereafter in comparison to COCs cultured at 38.5 °C for 6, 10, and 24 hIVM (TN).
Animals 15 00517 g002
Figure 3. Impact of 41.0 °C exposure during the first 6 hIVM on CAV1 count per million (CPM) of cumulus–oocyte complex (COC). COCs were cultured at 41.0 °C for 2, 4, or 6 hIVM (orange bars), or allowed to recover at 38.5 °C for an additional 4 h (10 hIVM) or 18 h (24 hIVM; hashed bars as indicated by 41 °C). Thermoneutral COCs were cultured at 38.5 °C for 2, 4, 6, 10, or 24 hIVM (gray bars). Bars (least squares means ± SEM) with different letters differ significantly for hIVM. Temperature and the interaction of maturation temperature and hIVM was not significant. The inset reflects differences when data were analyzed with only the 2, 4, 6, and 10 hIVM timepoints. Bars with different letters (i.e., A through C) through differ significantly for the interaction of maturation temperature and hIVM. COCs at 0 hIVM were included as a reference.
Figure 3. Impact of 41.0 °C exposure during the first 6 hIVM on CAV1 count per million (CPM) of cumulus–oocyte complex (COC). COCs were cultured at 41.0 °C for 2, 4, or 6 hIVM (orange bars), or allowed to recover at 38.5 °C for an additional 4 h (10 hIVM) or 18 h (24 hIVM; hashed bars as indicated by 41 °C). Thermoneutral COCs were cultured at 38.5 °C for 2, 4, 6, 10, or 24 hIVM (gray bars). Bars (least squares means ± SEM) with different letters differ significantly for hIVM. Temperature and the interaction of maturation temperature and hIVM was not significant. The inset reflects differences when data were analyzed with only the 2, 4, 6, and 10 hIVM timepoints. Bars with different letters (i.e., A through C) through differ significantly for the interaction of maturation temperature and hIVM. COCs at 0 hIVM were included as a reference.
Animals 15 00517 g003
Table 1. Official gene symbols and nomenclature of the primer sequences used for targeted RNA sequencing.
Table 1. Official gene symbols and nomenclature of the primer sequences used for targeted RNA sequencing.
Official Gene SymbolGene NameGenBank Accession NumberAmplicon Length (bp)Forward Primer SequenceReverse Primer Sequence
ARHGAP31Rho GTPase activating protein 31NM_001205810.162CGGGAGTGTATTTGTGAGAGGTTAGCTGGTCGGATGGTAGC
ARHGAP6Rho GTPase activating protein 6NM_001191354.169TGGTGCAGAAAATGATCGAAAGCACTTCATTCTGCAGATCC
BANPBTG3 associated nuclear proteinNM_001075620.167CAGGTCCAGATCCACCAGAACCTGGGCGATGTGTAGG
BDKRB1Bradykinin receptor B1NM_001109999.174TCCCTTTCATTTTGCCTGAGGGCTCTGGTTGAGAGTCTGG
CAV1Caveolin 1NM_174004.379GTCTTCAACCAGCCACGAGCGGATGGGAACAGTGTAGAGA
CCDC25Coiled-coil domain containing 25XM_015472401.272CGGCTCATGTGTACCTTCGCAGTCCATCAGCACCTCCTT
CCDC80Coiled-coil domain containing 80NM_001098982.267CAGCTCTCTGCCCTCAGTGAAAAGCTTCAGAACCGTTATGTG
CTSBCathepsin BNM_174031.278CTACAAAAATGGCCCAGTCGGTGCTGGTACACCCCAGACT
ESR2Estrogen receptor 2NM_174051.359GGACAGGGATGAAGGGAAATGCCAGGAGCATGTCAAAGAT
ETFAElectron transfer flavoprotein subunit αNM_001075822.165CAGCATTTAGCTGGGATGAATGGAGCTTCTGGGTCTTTGT
FDX1Ferredoxin 1NM_181011.266TTGATGGTTTTGGTGCATGTTGCTGTTCAAAGATGAGGTGA
FDXRFerredoxin reductaseNM_174691.168GATGTGCCAGGCCTCTACTGCATGGTGGTGGTGATGACA
FGRFGR proto-oncogene, Src family tyrosine kinaseNM_001098991.176GGAGGGTCATGTTTTGAAGCGCTCCATGTAGGCCATGC
FSHRFollicle stimulating hormone receptorNM_174061.160ATGTTTTCCAGGGAGCCTCTGAACGGATCCTGGTTCTTGA
FYNFYN proto-oncogene, Src family tyrosine kinaseNM_001077972.163CCAGGTTGATCGAGGACAATTCCACTTGATGGGGAACTTG
HSD3B7Hydroxy-delta-5-steroid dehydrogenase, 3-beta- and steroid delta-isomerase 7NM_001034696.168CTAGCTGAGCAGCTCGTCCTACATGTCACTAGGGGCAACC
HSP90AB1Heat shock protein 90 α family class B member 1NM_001079637.169AAGAAATTCTATGAGGCGTTCTCGTCGCCGGTTAGTGGAGTC
HSP90B1Heat shock protein 90 β family member 1NM_174700.277CACCCACTAATCAGAGACATGCAACCACAGCAAGATCTGAAACA
HTATIP2HIV-1 Tat interactive protein 2NM_001040563.171GGGAGCTGATAAGTCAAGCAAAACTCTTCAACTCTAGCTTCCA
IL6RInterleukin 6 receptorNM_001110785.362TCCAAAGATTCTGCAAAAACAAGGGCAGTGGTACCGAAGTAG
INHBBInhibin subunit β BNM_176852.279CGTCTCCGAGATCATCAGCCGTTGGAGATGAAGAAGTACAGG
LCKLCK proto-oncogene, Src family tyrosine kinaseNM_001034334.175TTGGTCTAGCACGCCTCATTGCTGTCCACTTAATGGGAAACT
LYNLYN proto-oncogene, Src family tyrosine kinaseNM_001177740.267AGGAGCCCATCTACATCATCAATCGCTCTTCAGGAAATCCA
MAPK3Mitogen-activated protein kinase 3NM_001110018.169CACCCCTACCTGGAGCAGTATGTCGAAGGTGAAAGGTTCC
MCM6Minichromosome maintenance complex component 6NM_001046234.165CGTCTCTCTGAAGCGATGGTTCCTTCACATGTTTAGGCTGA
MDM2MDM2 proto-oncogeneNM_001099107.173CCTCAGCGAAGAAGGACAAGCGCCTGCCTGATACACAGTA
MMP9Matrix metallopeptidase 9NM_174744.259GAGGGTAAGGTGCTGCTGTTCTGTGTCTTCACGTCGAACC
NR5A1Nuclear receptor subfamily 5 group A member 1NM_174403.270TACCGTCAGATTCAGCATGGGTGGTCAGCTCCACCTCCT
PAK2p21 (RAC1) activated kinase 2XM_024984244.170GGAGAGCCTCCATACCTCAATCTGGGGTTCCATTAGTTGC
PEAK1Pseudopodium enriched atypical kinase 1XM_024982035.169CCTGAATCCCTGTAGTGCAAATGCTTGGGAGGTATCATGG
PGRMC2Progesterone receptor membrane component 2NM_001099060.166TGTTCGAGAATGGGAAATGCCCCTGGTTTTAGGAGTCTGC
PRDX2Peroxiredoxin 2NM_174763.262ATTATGGCGTGCTGAAGGAATGCCGTCGATGACAAAGAG
PRKAA1Protein kinase AMP-activated catalytic subunit alpha 1NM_001109802.260TTGTGGCTCACCCAACTATGTGGACCAGCATACAATCTTCC
RAI14Retinoic acid induced 14XM_005221621.462CAGCAGCAGGTCAAACAGCCACTTCCTGGTGTTGTTTCTTG
RBM3RNA binding motif protein 3NM_001303463.164TGGATATGGAAGGTCCAGAGACCCCTGAGTAGCGGTCATAA
SCN7ASodium voltage-gated channel alpha subunit 7XM_010802033.377TGCCAATTTCCACAAGCATACGATACTGTTTCTTCTGTTTCACTG
SF1Splicing factor 1NM_001081614.165TACCTGGGAAGTACGCCTGTCGGCATCATACCTTTTCCTT
SLC26A2Solute carrier family 26 member 2NM_001040525.161TGGCAGCACTGTAACCTTTGCCACTTGAAAGAAGCCCATT
SNAP91Synaptosome associated protein 91NM_001105378.170GAGGCCACCCTTTGGAGTTCTGAGAGGCAGGTGTAGGG
SNX22Sorting nexin 22XM_005211652.461AGGGCTTGGAGGCCTATATCTAGTTCCTTGGGCACATCCT
SRCSRC proto-oncogene, non-receptor tyrosine kinaseNM_001110804.269CTGGCTCGACTCATTGAAGACTGTCCACTTGATGGGGAAT
TANC1Tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1XM_024980437.160GTCTCGCTGCCGAAGAAAGGCCTTGGAAGCAAATTCT
TFRCTransferrin receptorNM_001206577.172AATCCCAGCGGTCTCTTTCTATAGGTGTCCATGGGAGTGC
TNIKTRAF2 and NCK interacting kinaseXM_002684922.566GTGCTCCAATGGGGAGAAATCCCAGCCCATTATCTGATTG
TP53Tumor protein p53NM_174201.262CCTCTCCACAGCCAAAGAAGACCCACGGATCTGAAGAGTG
TTYH1Tweety family member 1NM_001077015.178GGCACTGCTACATTGTCGTGTCCTTCCAGGGTGTCTTCAC
YES1YES proto-oncogene 1, Src family tyrosine kinaseNM_001101060.179TGGCTTAGCAAGGTTAATTGAAGCAGGAGCTGTCCACTTGATTG
Table 2. Impacts of IVM temperature (38.5 or 41.0 °C) by hIVM on abundance (counts per million) of COC transcripts involved in progesterone production/signaling, cellular signaling, β-catenin complex, cell cycle and cumulus cell expansion: Direct impact of 41.0 °C on first 6 hIVM versus delayed impact occurring after 4 (10 hIVM) or 18 (24 hIVM) h of recovery.
Table 2. Impacts of IVM temperature (38.5 or 41.0 °C) by hIVM on abundance (counts per million) of COC transcripts involved in progesterone production/signaling, cellular signaling, β-catenin complex, cell cycle and cumulus cell expansion: Direct impact of 41.0 °C on first 6 hIVM versus delayed impact occurring after 4 (10 hIVM) or 18 (24 hIVM) h of recovery.
Role 1Transcript
Gene Symbol
IVM Temp (°C)0 hIVM Direct Impact—41 °C Delayed Impact—41 °C First Affected hIVMPooled SEMhIVM × IVM Temp
p-Value
2 hIVM4 hIVM6 hIVM 10 hIVM 224 hIVM 2
Progesterone production and/or signalingFDX138.531,014 36,906 B38,258 B29,145 D 49,090 A30,548 CD 21066<0.0001
41.0 31,061 CD31,948 CD35,837 B 29,414 D32,457 C 1046
FDXR38.519,012 18,666 A18,829 A15,001 B 9210 D8690 DE 2641<0.0001
41.0 15,887 B14,265 B11,882 C 12,406 C7325 E 629
HSD3B738.523,899 20,030 DE16,954 EF22,002 CD 13,857 F25,145 AB 21105<0.0001
41.0 23,778 ABC22,299 BCD14,800 F 24,505 ABC26,541 A 1084
HSP90AB138.519,277 25,502 B24,980 B19,445 DE 31,211 A20,030 DE 2762<0.0001
41.0 20,473 DE21,218 CD22,607 C 19,056 E20,944 CDE 748
HSP90B138.523,708 36,256 B37,361 B28,990 CD 47,348 A26,655 D 21783<0.0001
41.0 29,643 CD32,889 BC34,825 B 26,638 D27,526 D 1750
PGRMC238.524,783 32,263 B24,023 DE24,079 DE 39,159 A24,315 DE 21110<0.0001
41.0 27,529 C26,625 CD28,392 C 21,418 E23,603 DE 1090
Cellular signalingBDKRB138.5162 5884 D7973 D23,533 AB 16,566 C13,999 C 41404<0.0001
41.0 4763 D14,058 C20,479 B 26,552 A14,269 C 1384
IL6R38.516,582 15,944 A10,993 BC14,016 AB 5789 D5191 D 61249<0.0001
41.0 15,492 A14,070 AB9792 C 15,762 A4442 D 1226
MAPK338.517,830 11,943 BC13,841 B10,709 BC 6097 DE20,264 A 61243<0.0001
41.0 9008 CD10,236 BC4823 E 18,981 A18,133 A 1220
MMP938.5176 7606 D11,332 D19,787 BC 29,568 A22,617 B 41723<0.0001
41.0 8165 D19,109 BC23,086 B 21,046 BC16,782 C 1692
PRKAA138.537,760 35,582 C37,618 BC36,713 BC 32,688 D38,875 AB 61079<0.0001
41.0 35,700 C37,383 BC31,995 D 38,953 AB41,258 A 1060
β-catenin complexESR238.521,355 18,069 CD13,559 EF18,130 CD 10,365 F21,473 AB 41245<0.0001
41.0 20,216 ABC22,468 A15,440 DE 18,653 BC21,174 ABC 1225
SF138.522,248 21,450 CD25,698 A20,685 D 25,154 AB22,285 CD 47940.0002
41.0 21,781 CD22,659 CD23,441 ABC 20,859 D23,282 BC 779
TNIK38.58676 9361 C11,149 C22,815 AB 25,642 A11,532 C 41155<0.0001
41.0 8423 C20,683 B22,000 B 23,513 AB11,112 C 1133
Cell cycleARHGAP638.518,331 14,194 AB11,134 C14,578 AB 5488 E12,221 BC 4901<0.0001
41.0 14,097 AB15,863 A8271 D 13,123 BC13,621 ABC 884
ARHGAP3138.520,552 14,009 B15,930 B19,949 A 15,498 B20,399 A 21168<0.0001
41.0 20,971 A21,512 A15,282 B 20,582 A19,919 A 1146
BANP38.513,469 11,478 C7153 D12,495 BC 12,693 BC13,982 AB 47820.001
41.0 12,157 BC12,186 BC15,965 A 11,912 BC13,264 BC 767
MCM638.531,056 36,647 B37,376 B29,007 F 48,505 A31,138 DEF 2975<0.0001
41.0 30,353 DEF31,894 DE35,428 BC 29,870 EF32,884 CD 957
MDM238.524,352 27,166 BC29,707 A24,297 D 29,670 A24,385 D 2708<0.0001
41.0 24,483 D23,951 D27,708 AB 23,573 D25,395 CD 695
NR5A138.528,435 17,431 DE15,953 E22,877 CD 9508 F30,282 AB 22079<0.0001
41.0 27,667 BC23,627 C11,861 EF 26,127 BC34,189 A 2040
PAK238.525,343 31,463 B29,649 BC25,106 D 42,966 A25,673 D 21062<0.0001
41.0 25,848 D26,542 CD30,117 B 24,334 D27,044 CD 1042
TP5338.523,042 20,643 BCD13,140 F18,920 CDE 14,524 F23,761 AB 411760.0006
41.0 21,137 BCD18,268 DE16,406 EF 21,726 ABC24,536 A 1155
Cumulus expansionFSHR38.524,828 28,364 B29,031 AB22,211 CDE 31,375 A20,167 E 2969<0.0001
41.0 23,195 CD22,326 CDE24,716 C 20,966 DE21,674 DE 951
INHBB38.521,649 12,845 D18,161 C25,061 AB 11,789 D24,157 AB 21282<0.0001
41.0 26,341 AB23,189 B13,551 D 22,898 B27,003 A 1258
PRDX238.519,085 22,069 BC17,356 E19,722 CDE 36,038 A21,472 CD 2926<0.0001
41.0 19,294 DE18,524 E24,320 B 21,495 CD21,108 CD 909
Within each transcript, letters A–F indicate counts per million differ within column (IVM temperature) and row (hIVM). 1 The possible general role of each transcript in cumulus–oocyte complexes. 2 41.0 °C was limited to first 6 hIVM followed by 38.5 °C for 4 (10 hIVM) or 18 (24 hIVM) h.
Table 3. Impact of IVM temperature (38.5 or 41.0 °C) by hIVM on Src-Family Kinase transcript abundance (counts per million) in cumulus–oocyte complexes: Direct impact of 41.0 °C on first 6 hIVM versus delayed impact occurring after 4 (10h IVM) or 18 (24 hIVM) h of recovery.
Table 3. Impact of IVM temperature (38.5 or 41.0 °C) by hIVM on Src-Family Kinase transcript abundance (counts per million) in cumulus–oocyte complexes: Direct impact of 41.0 °C on first 6 hIVM versus delayed impact occurring after 4 (10h IVM) or 18 (24 hIVM) h of recovery.
hIVM First Impacted by 41 °CTranscript
Gene Symbol
IVM
Temp
(°C)
0 hIVM Direct Impact—41 °C Delayed Impact—41 °C Pooled SEMhIVM × IVM Temp
p-Value
2 hIVM4 hIVM6 hIVM 10 hIVM 124 hIVM 1
2SRC38.58976 8945 CD6742 DE12,058 BC 4491 E8489 CD 13820.0001
41.0 15,994 A14,250 AB7105 DE 9584 CD8902 CD 1356
4FYN38.544,884 48,207 CD39,394 F48,992 CD 70,059 A44,866 DE 1787<0.0001
41.0 49,540 CD50,928 C57,706 B 49,554 CD40,928 EF 1754
4LCK38.51777 2340 D3652 C5652 AB 6157 A4542 BC 4900.0008
41.0 1835 D5537 AB5726 AB 4090 C3616 C 483
6FGR38.53498 5199 AB3369 DEF6109 A 2597 F2712 EF 4620.005
41.0 5021 ABC3920 CDE4388 BCD 4385 BCD2526 F 454
10LYN38.54529 4079 B3676 BC6067 A 1877 C4881 AB 7480.0008
41.0 4165 AB5155 AB4515 AB 6120 A3697 BC 735
10YES138.517,446 20,015 B15,985 D17,959 BCD 23,810 A19,558 BC 9020.02
41.0 19,081 BC17,146 CD20,443 B 20,456 B19,798 B 885
Within each transcript, letters A–F indicate counts per million differ within column (IVM temperature) and row (hIVM). 1 41.0 °C was limited to first 6 hIVM followed by 38.5 °C for 4 (10 hIVM) or 18 (24 hIVM) h.
Table 4. Impacts of IVM temperature (38.5 or 41.0 °C) by hIVM on abundance (counts per million) of COC transcripts found to be significantly affected by temperature in cumulus, oocyte, and/or follicular fluid in other published studies: Direct impact of 41.0 °C on first 6 hIVM versus delayed impact occurring after 4 (10 hIVM) or 18 (24 hIVM) h of recovery.
Table 4. Impacts of IVM temperature (38.5 or 41.0 °C) by hIVM on abundance (counts per million) of COC transcripts found to be significantly affected by temperature in cumulus, oocyte, and/or follicular fluid in other published studies: Direct impact of 41.0 °C on first 6 hIVM versus delayed impact occurring after 4 (10 hIVM) or 18 (24 hIVM) h of recovery.
Transcript
Gene Symbol
IVM Temp (°C)0 hIVM Direct Impact—41 °C Delayed Impact—41 °C First hIVM Affected by IVM TempPooled SEMhIVM × IVM Temp
p-Value
2 hIVM4 hIVM6 hIVM 10 hIVM 124 hIVM 1
CCDC2538.531,308 33,850 D40,611 B33,038 DE 49,178 A32,556 DEF 21064<0.0001
41.0 29,014 G32,379 DEF37,339 C 30,641 EFG29,749 FG 1044
CTSB38.525,243 22,336 B12,916 C24,597 AB 27,109 A26,467 A 41368<0.0001
41.0 25,336 AB26,263 A27,537 A 24,296 AB26,826 A 1342
ETFA38.526,445 29,886 BC34,166 A27,454 CD 30,806 B27,216 CD 210040.01
41.0 26,773 D26,835 D27,252 CD 26,340 D25,133 D 985
HTATIP238.522,469 22,176 AB12,638 E18,476 CD 17,754 CD23,739 A 49710.0002
41.0 19,850 BC18,717 CD16,999 D 18,541 CD22,116 AB 954
PEAK138.518,058 13,853 E25,209 A17,703 C 11,974 E20,053 BC 41253<0.0001
41.0 14,560 DE17,381 CD12,373 E 19,041 C23,167 AB 1233
RBM338.532,657 40,004 B40,142 B31,047 C 51,722 A31,677 C 21337<0.0001
41.0 31,926 C34,069 C37,955 B 31,554 C33,707 C 1312
SCN7A38.5340 1000 C2702 B4398 A 1787 BC1012 C 44160.03
41.0 1136 C4925 A4334 A 2864 B1098 C 408
SLC26A238.526,849 24,262 B19,633 C27,371 A 15,778 D28,389 A 2913<0.0001
41.0 29,649 A27,540 A24,940 B 28,017 A28,961 A 898
SNX2238.520,829 16,065 AB13,351 BC18,141 A 8793 D13,042 C 61138<0.0001
41.0 14,610 BC15,116 BC13,859 BC 18,427 A13,647 BC 1118
TANC138.515,236 15,258 AB8533 CD9930 C 6228 D13,946 B 61005<0.0001
41.0 15,930 AB10,257 C5684 D 18,056 A16,462 AB 986
TTYH138.527,976 27,610 B30,916 A24,524 CDEF 22,724 F22,895 EF 48760.0005
41.0 26,493 BC25,236 BCDE26,101 BCD 23,859 DEF24,693 CDEF 860
Within each transcript, letters A–G indicate counts per million differ within column (IVM temperature) and row (hIVM). 1 Possible general role of each transcript in cumulus–oocyte complexes. 41.0 °C was limited to first 6 hIVM followed by 38.5 °C for 4 (10 hIVM) or 18 (24 hIVM) h.
Table 5. The earliest time period when 41 °C exposure for a maximum of 6 h first impacted the abundance of 43 different transcripts.
Table 5. The earliest time period when 41 °C exposure for a maximum of 6 h first impacted the abundance of 43 different transcripts.
hIVMTranscripts First Impacted by Exposure to 41 °C (#) 1Transcripts of Higher Abundance (#)Transcripts of Lower Abundance (#)Cumulative Proportion Affected (%) 2Transcripts (Higher or Lower Abundance) 3
21961319/43 (44.1)ARHGAP31, CCDC25 ↓, ETFA, FDX1 ↓, FDXR ↓, FSHR ↓, HSD3B7 ↑, HSP90AB1 ↓, HSP90B1 ↓, INHBB ↑, MDM2 ↓, MCM6, NR5A1 ↑, PAK2, PGRMC2 ↓, PRDX2, RBM3, SLC26A2, SRC
41512334/43 (79.1)ARHGAP6, BANP, BDKRB1 ↑, CTSB ↑, ESR2 ↑, FYN, HTATIP2, LCK ↑, MMP9 ↑, PEAK1, SCN7A, SF1 ↓, TNIK, TP53 ↑, TTYH1
660640/43 (93.0)FGR ↓, IL6R ↓, MAPK3 ↓, PRKAA1 ↓, SNX22 ↓, TANC1
1032143/43 (100)CAV14, LYN ↑, YES1
24000-None
1 The earliest—but not necessarily the only—hour of in vitro maturation (hIVM) in which transcript abundance were significantly different (hIVM × IVM temperature; p < 0.05), 2 The proportion of transcripts affected at the indicated hIVM or earlier, 3 ↑ = higher abundance, ↓ = lower abundance, 4 CAV1 data were analyzed only including 2, 4, 6, and 10 hIVM. Orange colored text: cumulus derived transcripts from Klabnik et al. [23].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Klabnik, J.L.; Beever, J.E.; Payton, R.R.; Lamour, K.H.; Schrick, F.N.; Edwards, J.L. A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature. Animals 2025, 15, 517. https://doi.org/10.3390/ani15040517

AMA Style

Klabnik JL, Beever JE, Payton RR, Lamour KH, Schrick FN, Edwards JL. A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature. Animals. 2025; 15(4):517. https://doi.org/10.3390/ani15040517

Chicago/Turabian Style

Klabnik, Jessica L., Jonathan E. Beever, Rebecca R. Payton, Kurt H. Lamour, F. Neal Schrick, and J. Lannett Edwards. 2025. "A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature" Animals 15, no. 4: 517. https://doi.org/10.3390/ani15040517

APA Style

Klabnik, J. L., Beever, J. E., Payton, R. R., Lamour, K. H., Schrick, F. N., & Edwards, J. L. (2025). A Step Toward Understanding Direct Impacts of a Higher Estrus-Associated Temperature (HEAT): Transcript Level Changes in Cumulus–Oocyte Complexes Directly Exposed to Acute Elevated Temperature. Animals, 15(4), 517. https://doi.org/10.3390/ani15040517

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop