FASN, SCD, and PLAG1 Gene Polymorphism and Association with Carcass Traits and Fatty Acid Profile in Hanwoo Cattle
by
, , , ,
Jia Yu
1,†,
Sajida Naseem
2,†,
Sungkwon Park
3,
Sunjin Hur
4,
Yoonbin Choi
1,
Teahyung Lee
1,
Xiangzi Li
2,* and
Seongho Choi
1,* 1
Department of Animal Science, Chungbuk National University, Cheongju 28644, Republic of Korea
2
Engineering Research Center of North-East Cold Region Beef Cattle Science & Technology Innovation Ministry of Education, Department of Animal Science, Yanbian University, Yanji 133002, China
3
Department of Food Science and Biotechnology, Sejong University, Seoul 05006, Republic of Korea
4
Department of Animal Science and Technology, Chung-Ang University, Anseong 17546, Republic of Korea
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2025, 15(6), 897; https://doi.org/10.3390/ani15060897
Submission received: 27 January 2025
/
Revised: 18 March 2025
/
Accepted: 19 March 2025
/
Published: 20 March 2025
(This article belongs to the Section Animal Genetics and Genomics)
Simple Summary
This study was designed to explore the single nucleotide polymorphisms (SNPs) of Stearoyl-CoA desaturase (SCD), Fatty acid synthase (FASN), and pleomorphic adenoma gene 1 (PLAG1) genes and their relation to meat quality, carcass weight, marbling score, yield grade, backfat thickness, and fatty acid composition in Hanwoo steers. The results showed that G allele, T allele, and G allele frequency was higher in FASN, SCD, and PLAG1 genes, respectively. Statistical analysis revealed that the AA genotype of FASN gene, the TT genotype of SCD gene, and the CC genotype of PLAG1 gene were significantly associated with fatty acid composition in meat and adipose tissue. Genotypes of PLAG1 variably related to carcass weight, marbling score, yield grade, and backfat thickness. Our results suggest that these SNPs are effective for marker-assisted breeding for the improvement of meat quality and fatty acid composition in Hanwoo cattle.
Abstract
Genetic polymorphisms have a great impact on enhancing quantitative traits in cattle. In this study, Fatty acid synthase (FASN) g. 16024 (A>G), Stearoyl-CoA desaturase (SCD) g. 10329 (C>T), and pleomorphic adenoma gene (PLAG1) g. 25003338 (C>G) genotypic and allelic polymorphisms were evaluated, along with their associations with fatty acid composition, adipogenic gene expression, and carcass characteristics (carcass weight, yield grade, backfat thickness, and marbling score) in Hanwoo steers. A total of 128 Hanwoo steers were selected for this study and the Polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) method was used to identify polymorphism of these genes. The AG genotype and G allele in FASN g. 16024 (A>G), CT genotype and T allele in SCD g. 10329 (C>T), and GG genotype and G allele in PLAG1 g. 25003338 (C>G) showed higher frequency and positively correlated with carcass traits, yield, and quality grades. Fatty acid composition results indicate that C18:3n-6, C20:1, and C20:2n-6 were significantly higher in the AA genotype of FASN gene, C14:1 and C18:3n-6 in the CC genotype, and C16:1 in the TT genotype of SCD gene. C12:0, C14:0, C16:1, C18:0, and C20:0 were higher in the CC genotype of PLAG1 gene. Furthermore, RT-qPCR analysis of adipogenesis-related genes (AMP-activated protein kinase-α (AMPKα), Carnitine palmitoyl transferase-1β (CPT1), G-coupled protein receptor-43 (GPR43), and SCD) across different SNP genotypes suggests a systemic interaction between genetic factors and adipogenesis in beef cattle. This study emphasizes the significance of FASN g. 16024 (A>G), SCD g. 10329 (C>T), and PLAG1 g. 25003338 (C>G) SNPs for genetic selection to enhance beef quality and elucidate lipid metabolic pathways in Hanwoo cattle.
1. Introduction
Quality grades of meat products in the commercial beef industry have significant importance. The color of meat, fat firmness, tenderness, and juiciness are important attributes consumers consider [1,2]. In Korean society, consumers generally prefer high-quality Hanwoo beef, especially for home dining and social gatherings such as hosting friends and family. This preference has contributed to a food culture that emphasizes premium ingredients. As a result, there is a strong demand for high-grade beef, particularly for traditional dishes like Korean barbecue. The market price of 1++ grade Hanwoo beef is approximately 15,500 KRW per 100 g, with higher restaurant prices due to service costs and demand. This reflects the premium on high-quality beef, where consumer willingness to pay is shaped by perceived quality and availability. Such economic factors highlight the importance of genetic selection for improving beef quality.
Numerous SNPs were found and linked to quantitative features when genome sequencing in domestic animals became available [3]. Researchers can utilize newly discovered genetic correlations to create more effective plans to increase or prevent desired characteristics in the target population [4]. Moreover, as consumers become increasingly aware of the relationship between diet and health, the fatty acid composition of meat has gained attention. SNPs in lipid metabolism-related genes, such as FASN, SCD, and PLAG1, have been associated with variations in fatty acid profiles in cattle [5,6]. These genetic variations influence key processes like fatty acid synthesis and desaturation, which can affect meat quality traits such as marbling and unsaturated fatty acid content [4,7]. However, the extent to which SNP variations alone can significantly modulate fatty acid composition within the same species remains a topic of discussion. While some studies suggest a strong genetic influence, others highlight the role of environmental factors, such as diet and feeding regimens, in determining fatty acid profiles [8]. Further research integrating genetic, nutritional, and management strategies is essential to fully understand the interplay between SNP variations and lipid metabolism pathways in beef cattle.
Multiple investigations have been conducted to identify significant correlations between QTLs and SNP markers to identify genotypic polymorphisms that are crucial for improving the yield of cattle [9]. Fatty acid synthase (FASN) was responsible for carcass traits in various cattle breeds, for marbling and fatty acid composition [10]. There are multiple SNP sites on FASN located on BTA 19 that are significantly associated with C14:0, C18:1 n-9, and other monounsaturated fatty acids (MUFAs) [11,12]. The FASN g. 16024 G>A mutation of Japanese black cattle has a significant impact on the fatty acid composition of backfat, intermuscular fat, and intramuscular fat, which is related to the ratio of C18:0 and C18:1 [13].
The SCD (Stearoyl-CoA desaturase) gene located on chromosome 26 is associated with more than one fatty acid trait in American Angus cattle [14]. The SCD g. 10329 C>T single nucleotide polymorphism in Korean steers is associated with the oleic acid, monounsaturated fatty acid content, and marbling of beef [15]. Japanese Black SCD genotypes showed relation with fatty acid composition and beef quality [16]. Genome-wide association analysis of Korean cattle showed that PLAG1 (pleomorphic adenoma gene 1), located on cattle BTA 14, is related to carcass weight [17]. Previous studies have shown that PLAG1 g. 25003338 C>G can be a functional candidate gene for trait association and genetic drift [18]. In a study on Nellore cattle, it was pointed out that PLAG1 g. 25003338 C>G is the main pleiotropic gene for birth weight, weaning weight, and weight at one year of age. PLAG1 may affect accessory genes involved in regulating carcass traits [19]. Recent studies indicate that PLAG1 not only regulates growth traits but also plays a role in lipid metabolism. It influences IGF-1 signaling, which affects adipogenesis and fatty acid metabolism [20]. Variants of PLAG1 have been associated with subcutaneous and intramuscular fat deposition, impacting beef quality and fatty acid composition [21]. These findings suggest that PLAG1 may modulate key genes involved in lipid regulation, further supporting its relevance in beef production.
Although FASN and SCD are known to influence fatty acid synthesis and desaturation, the specific impact of single-site polymorphisms on adipogenic gene expression remains unclear [15]. Likewise, the role of PLAG1 in lipid metabolism beyond its function in growth regulation has not been fully explored. This study aims to bridge this gap by comprehensively examining the relationship between FASN, SCD, and PLAG1 polymorphisms and carcass traits, adipogenic gene expression, and lipid metabolism in Hanwoo cattle. These findings will provide deeper insights into the genetic regulation of fat composition and contribute to selective breeding strategies for high-quality beef production.
2. Materials and Methods
2.1. Animals, Phenotypic Data, and Sample Collection
In this study, 128 Hanwoo cattle were used, belonging to Chungju National Agricultural Cooperative Federation, Republic of Korea. All animals used in this study were sourced from a single farm, where they were raised under uniform feeding conditions and dietary composition. The sample tissues were obtained from Farm Story Hannaeong Bio & Food Co., Ltd. (Chungbuk, Republic of Korea). For genomic DNA extraction, sampling was conducted in the pre-cooled room after the cattle were slaughtered. For extraction of genomic DNA, muscle tissue was collected from the ‘Round’ part of the carcass. The collected samples were immediately immersed in liquid nitrogen and transferred to the laboratory within 2 h. For fatty acid extraction, fat tissue was collected from the back fat. Backfat thickness, carcass weight, yield grade, and marbling score were included in carcass traits. The marbling score was numbered as 1 = trace to 9 = very abundant, according to Korean Beef Marbling Standard [22].
2.2. Genomic DNA Extraction and Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP)
DNA was extracted from samples by using the Wizard® HMW DNA Extraction Kit (Cat. # A2920, Promega, Madison, WI, USA). RFLP assay was conducted utilizing bovine muscle tissue samples to analyze the genotype.
The polymerase chain reaction (PCR) was carried out in three steps using the Solg™Taq DNA Polymerase kit (STD16-R250, SolGent Co., Ltd., Seoul, Republic of Korea). The PCR cycling conditions included an initial denaturation for 15 s at 95 °C, followed by 30 min at 95 °C, then annealing for 30 s at 52 °C for FASN-g.16024, 30 s at 52 °C for SCD g. 10329 (C>T), and 30 s at 53 °C for PLAG1 g. 25003338 (C>G). This was succeeded by an extension for 40 s at 72 °C and a final extension for 5 min at 72 °C, over 35–40 cycles. Primer sequences are listed in Table 1. Post-PCR, a 1% agarose gel electrophoresis was used to verify DNA amplification.
Upon observing DNA bands on the electrophoresis gel, RFLP analysis was conducted to confirm DNA amplification. For RFLP, restriction enzymes from New England Biolabs (Ipswich, MA, USA) were utilized, specifically Hha I for FASN g. 16024 (A>G), Fau I for SCD g. 10329 (C>T), and Hph I for PLAG1 g. 25003338 (C>G) (Table 1). The RFLP reaction mixture was thoroughly mixed and incubated overnight at 37 °C. Subsequently, electrophoresis was performed on a 3% agarose gel to analyze genotypes based on band fragmentation patterns.
2.3. Total RNA Extraction and RT-qPCR
Total RNA was isolated from muscle samples using the Trizol reagent by Thermo Fisher Scientific (Invitrogen, Waltham, MA, USA). The quality and quantity of the extracted RNA were assessed with a NanoDrop ND-1000 spectrophotometer (2000C, Thermo Fisher Scientific). All RNA samples displayed purity ratios (A260/A280) exceeding 1.80~2.0. For cDNA synthesis, 1 μg of total RNA was reverse-transcribed using AccuPower® CycleScript™RT PreMix (dN6) from Bioneer, Daejeon, Republic of Korea.
Real-time polymerase chain reaction (RT-PCR) was then conducted using AccuPower® 2× GreenStar™qPCR Master Mix (Bioneer, Daejeon, Republic of Korea) on a StepOnePlus™Real-Time PCR System from Applied Biosystems™ (Thermo Fisher Scientific, Foster City, CA, USA). RT-PCR was performed according to the protocol provided by the manufacturer. The housekeeping gene RPS9 served as the reference. Key genes including AMPK-α, CPT1, GPR4, and SCD were selected to analyze adipogenic and lipogenic gene expression levels (Table 2). The RT-qPCR thermocycling conditions consisted of an initial preheating at 95 °C for 15 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing at 60 °C for 1 min, concluding with a melting curve analysis ranging from 60 °C to 95 °C. Relative gene expression levels were quantified using the 2−ΔΔCt method [23], enabling a thorough assessment of gene expression changes.
2.4. Fatty Acid Analysis
To determine the fatty acid composition, we utilized 2 g of muscle tissue and 1 g of adipose tissue, each sample mixed with Folch solution (chloroform: methanol in a 2:1 volume ratio). C13:0 was added to each sample, serving as an internal standard. After the lipids were extracted, the saponification of lipids was achieved by using 0.5 M KOH in methanol. BF3 was used for methyl esterification of fatty acids.
Gas chromatographic analysis was performed using an HP8890 system (Agilent, Santa Clara, CA, USA). The column used was an SPTM-2560 fused silica capillary column (Supelco, 100 m × 0.25 mm × 0.2 μL film thickness, Sigma-Aldrich, St. Louis, MO, USA). The injector and FID temperatures were set at 270 °C and 300 °C, respectively. The oven temperature was initially held at 150 °C for 10 min, then increased by 2 °C per minute to 220 °C, and maintained at 220 °C for a further 10 min. Column flow rate and split ratio were maintained at 10 cm/min and 100:1, respectively. Fatty acid identification was facilitated by adding a standard mixture (LRAC7954, Sigma-Aldrich, St. Louis, MO, USA), with C13:0 fatty acid (Sigma-Aldrich, St. Louis, MO, USA) used as the internal standard for precise quantification.
2.5. Statistical Analysis
At least three biological replicates were used for each experimental analysis. Statistical analyses were performed using SPSS 23 (IBM, Armonk, NY, USA). The chi-square test was used to assess Hardy–Weinberg equilibrium (HWE) for genotype distributions. One-way analysis of variance (ANOVA) with multiple comparisons was used to evaluate the effects of genotype on carcass traits and relative gene expression. A General Linear Model (GLM) was applied to assess the effects of genotype on fatty acid composition in muscle and adipose tissues. p-values from the GLM model represent the overall genotype effect. When p < 0.05, Duncan’s multiple range test was conducted for post-hoc pairwise comparisons. In cases where the overall genotype effect was not significant (p > 0.05), localized differences between specific genotype groups may still be detected due to within-group variability. Data are presented as mean ± standard error of the mean (SEM), and statistical significance was set at p < 0.05.
3. Results
3.1. Genotype Frequencies and Allele Frequencies with Carcass Traits in the Hanwoo Steer
3.1.1. Analysis of Genotype and Allele Frequencies in Hanwoo Steers
The FASN g. 16024 (A>G), SCD g. 10329 (C>T), PLAG1 g. 25003338 (C>G) polymorphism of Hanwoo detected in PCR-RFLP fragments is shown in Figure 1. The genotype and allele frequencies in Hanwoo steers were systematically compared, as detailed in Table 3. The genotype distributions were tested for Hardy–Weinberg equilibrium (HWE) using a chi-square (χ2) test. The results (p > 0.05) indicate no significant deviation from HWE, confirming that the sample population is in genetic equilibrium. Genotypic and allele frequencies showed that FASN-AG (41.7%) and G allele (58.8%), SCD-CT (54.5%) and T allele (60.6%), and PLAG1-GG (51.5%) and G allele (71.2%) were predominant, while homozygous AA, CC, and CC genotypes were less frequent. The higher frequency of FASN-AG and G allele suggests a potential selection advantage for fatty acid synthesis and marbling traits, as FASN is a key enzyme in de novo lipogenesis. The predominance of SCD-CT and T allele aligns with SCD’s role in promoting monounsaturated fatty acid (MUFA) synthesis, which is beneficial for beef tenderness and flavor. The prevalence of PLAG1-GG and G allele may indicate its role in growth-related pathways, potentially influencing lipid deposition and carcass traits. These findings suggest that certain genotypes may contribute to desirable beef quality traits, reinforcing their potential use as markers in selective breeding programs.
3.1.2. Correlation Between Genotypes/Alleles and Beef Quality Grades
An examination of beef quality grades revealed that the 1++ grade was more frequently associated with Hanwoo steers possessing the FASN-AG genotype and G allele, SCD-CT genotype and T allele, and PLAG1 genotype GG and G allele. Furthermore, these specific genotypes and alleles correlated with higher yield grades, indicating a positive relationship between these genotypes/alleles and superior carcass traits (Table 3). Upon aggregating marbling scores of 7, 8, and 9, genotypes and alleles associated with high marbling scores exhibited greater consistency with the observed quality grades and yield grades. These findings suggest the potential to predict the quality and yield grades of Hanwoo beef by analyzing the presence of specific alleles or genotypes.
3.1.3. Differential Impact of FASN, SCD, and PLAG1 Genotypes on Carcass Traits
Comparative analysis of carcass traits, including carcass weight, marbling score, yield grade, and backfat thickness, showed no significant differences across FASN and SCD genotypes (Figure 2). However, the analysis of the PLAG1 genotype yielded significant findings. Hanwoo steers carrying the G allele, particularly those with CG and GG genotypes, exhibited superior results regarding carcass weight, marbling score, and backfat thickness, with statistical significance (p < 0.05). In contrast, the CC genotype was found to have a significantly higher sum of yield grades compared to CG and GG types, presenting an inverse relationship in terms of yield grade performance.
3.2. Fatty Acid Composition of Different Genotypes in Hanwoo Steers
According to Table 4, the influence of the FASN g. 16024 SNP is more pronounced in adipose tissue than in muscle tissue. In muscle tissue, a significant increase in unsaturated fatty acid C18:3n-6 was observed in the AA and AG genotypes compared to the GG genotype (p < 0.05). In adipose tissue, both saturated and unsaturated fatty acids were impacted, with higher levels of saturated fatty acid C12:0 and total saturated fatty acids in genotypes containing allele G (p < 0.05). Additionally, the AA genotype exhibited the highest levels of long-chain unsaturated fatty acids C20:1 (p < 0.05).
The impact of the SCD g. 10329 SNP was evident in the medium-chain unsaturated fatty acid C14:1 content, which was higher in the CC genotype and C allele (p < 0.05) (Table 5) in both muscle and adipose tissue. However, an inverse pattern was observed in the unsaturated to saturated fatty acids ratio and total saturated fatty acids were higher in TT genotype. Genotypes containing T allele had higher saturated fatty acid content (p < 0.05), but a lower ratio of unsaturated to saturated fatty acids (p < 0.05).
In the context of PLAG1 genotypes, the SNP impact was more significant in adipose tissue than in muscle tissue. Medium-chain saturated fatty acids C12:0, C14:0, and total saturated fatty acids were higher in C allele containing genotypes (p < 0.05) in adipose tissue. Unsaturated fatty acids C18:1, C18:3, C20:1, and total monounsaturated fatty acids were elevated in genotypes containing the G allele (p < 0.05). On the other side, medium-chain saturated fatty acids C14:0 and monounsaturated fatty acid C16:1 were elevated in muscle tissue for C allele -containing genotypes (p < 0.05) (Table 6).
An analysis was conducted to determine the influence of genotype and quality grade and their interaction with fatty acid content in muscle and adipose tissue. Results indicated that for FASN g. 16024 and SCD g. 10329, the interaction between genotype and quality grade on fatty acid content was insignificant (Table 7, Table 8 and Table 9). However, there was a correlation with long-chain unsaturated fatty acid content in the case of PLAG1 g. 25003338 C>G: the influence of genotype, quality grade, and their interactions on muscle tissue were more pronounced, affecting both medium- and long-chain saturated and unsaturated fatty acids, including C16:0, C16:1, C18:1, and C18:2, as well as total saturated and unsaturated fatty acids. The effects of the PLAG1 g. 25003338 SNP on fatty acids are multifaceted, influencing a range of saturated and unsaturated fatty acids in muscle and adipose tissues.
3.3. Relative Gene Expression of Different Genotypes in Hanwoo Steer
The RT-qPCR analysis was conducted to check the expression of adipogenic genes AMPKα, CPT1, GPR43, and SCD, which are integral for lipid metabolism. The analysis revealed that the expression differences of AMPKα among the genotypes at three polymorphic sites were not substantial. AMPKα, CPT1, and GPR43 demonstrated similar expression patterns across the FASN genotypes. Specifically, the expression levels of CPT1 and GPR43 in FASN-AG were lower than in the AA and GG genotypes. Conversely, the SCD gene, implicated in the desaturation of fatty acids, exhibited the highest expression level in the GG genotype (p < 0.05) (Figure 3), while the expression levels of AMPKα and CPT1 were elevated in SCD CT and TT genotypes; however, the differences were not statistically significant. GPR43 showed a significantly higher expression in TT than other genotypes (p < 0.001). Interestingly, the highest expression of the SCD gene was noted in the CT genotype (p < 0.01), though no discernible difference was found between the CC and TT genotypes. Furthermore, the expression levels of AMPKα and CPT1 were higher in PLAG1 GG and CG genotypes, respectively, than in the CC type. The expression level of SCD mirrored this pattern, being higher in genotypes containing G allele; contrarily to other genes, the GPR43 expression was higher in the PLAG1 CC genotype (p < 0.01).
The study’s findings indicate a complex interaction between various genotypes and the expression levels of genes involved in adipogenic processes and lipid metabolism. This suggests a genetic influence on the metabolic pathways regulated by these genes, with potential implications for understanding lipid metabolism in different genotypes.
4. Discussion
Although animals were raised under standardized feeding and environmental conditions, the extended sampling period and reliance on slaughterhouse collection may introduce some variability. However, given that all animals came from the same farm with uniform feeding management, the impact of such variability is expected to be minimal.
4.1. Genotype Frequencies and Allele Frequencies with Carcass Traits
Quantitative traits (e.g., carcass traits, body size, yield grade, and marbling score) are controlled by multiple genes with various genetic loci, which all have a minor amount of impact on overall variations in traits. In this study, the frequency of A allele of FASN (g.16024G>A) (0.412) was higher than that observed in Dutch Holstein cattle (0.11) [24], and Fleckvieh bulls (0.225) [25], while lower than in Japanese Black cattle (0.85) observed by Matsuhashi [26]. The GG genotype frequency was lower in this study (0.380) as compared to Fleckvieh bulls (0.599) [25]. The CC, CT, and TT genotype frequency of SCD g. 10329 C>T was reported as 0.222, 0.444, and 0.333 respectively in Korean native cattle [27], which was quite variable to our study. Various breeds of cattle have been studied for PLAG1 gene polymorphism such as Angus cattle, Hanwoo, Simmental, and Chinese cattle [21,27,28,29]. PLAG1 g. 25003338 C>G, studied for the first time in this research, showed higher allele G frequency (0.712) than allele C; however, G allele frequency was also higher in PLAG1 c.795A>G than A allele in Bali cattle [30]. Our work and previous studies of polymorphism for different genes suggest that genotypes and allelic frequencies have been specific to distinct cattle breeds.
Furthermore, we identified a significant correlation between specific SNP genotypes in FASN, SCD, and PLAG1 genes and the carcass traits of Hanwoo steers. Notably, the increased frequency of FASN-AG and G allele, SCD-CT, and T allele, along with PLAG1 GG type and G allele, indicates a genetic predisposition towards desirable carcass traits. This observation aligns with prior studies by Chu et al. [31] and Gao et al. [32], which have documented the impact of FASN and SCD genes on body traits, fat deposition, and fatty acid composition in Qinchuan cattle. Additionally, the role of the PLAG1 gene in growth and body size regulation, as explored by Utsunomiya et al. [18] and Fink et al. [33], supports our findings.
The prevalence of beef grade 1++ in Hanwoo steers possessing these genotypes and alleles highlights the practical implications of our research. It reinforces the hypothesis that certain genotypes contribute to higher quality and yield grades in beef production. It suggests potential for utilizing genetic selection and breeding strategies to enhance beef quality in Hanwoo cattle.
Furthermore, the association between high marbling scores and the FASN-AG, SCD-CT, and PLAG1-GG genotypes is noteworthy, especially considering the importance of marbling in beef quality assessment. This correlation indicates that these genetic markers might be reliable predictors of marbling potential, a crucial factor in meat quality.
Regarding carcass traits, no significant variances were observed between the FASN and SCD genotypes; however, the PLAG1 genotype showed remarkable differences. The superior performance of the CG and GG types over the CC type in carcass weight, marbling score, and backfat thickness (p < 0.05) is consistent with the known functions of PLAG1 in growth regulation [34]. However, the inverse relationship in yield grade, where CC types excelled over CG and GG types, points to a more intricate genetic interplay, meriting further exploration.
In conclusion, the insights gained from this study are invaluable for genetic selection in Hanwoo cattle. Identifying genotypes correlating with higher quality and yield grades can significantly enhance breeding programs to optimize carcass traits. Employing SNP genotyping as a tool in selective breeding can transform the Hanwoo beef industry by enabling more precise genetic selection based on specific carcass characteristics.
4.2. Fatty Acid Composition of Different Genotypes
This study delves into the impact of SNP genotypes, specifically FASN g. 16024 (A>G), SCD g. 10329 (C>T), and PLAG1 g. 25003338 (C>G), on the fatty acid composition of beef, uncovering several critical insights. The FASN and SCD genes, crucial for fatty acid synthesis and desaturation, respectively, strongly correlate with the beef fatty acid profile. These findings are supported by previous studies [35,36], which demonstrates a genetic predisposition affecting both saturated and unsaturated fatty acid content, thereby directly influencing the nutritional value of beef [37]. In the fatty acid results, certain differences approached significance (p < 0.10), suggesting potential genotype-related trends in fatty acid composition and adipogenic gene expression. While these results do not indicate conclusive statistical differences, they provide insight into possible genetic influences that warrant further investigation with larger sample sizes.
This study revealed notable correlations between specific SNP genotypes within these genes and the levels of saturated fatty acids (SFAs) and monounsaturated fatty acids (MUFAs) in beef. Bartoň [25] reported FASN (g.16024G>A) and FASN (g.17924A>G) association with atherogenic index and concentrations of C14:0, C16:0, and C18:1 n-9 fatty acids in subcutaneous and muscle fat of Fleckvieh bulls. Kim et al. [38]’s research showed a positive relation of this gene with C18:1, and negative association with muscle saturated fatty acids of Hanwoo steers, which are quite similar to this study’s results, as both saturated (C12:0) and unsaturated fatty acid in adipose and muscle tissue were affected, respectively. Previous studies on Hanwoo steers showed that SCD SNPs g.10329 C>T and g.14047 C>T interaction have a significant effect on C18:1 and MUFAs, and SCD g.10329 C>T associated with total MUFA content [39,40] in muscle tissue; contrarily, in this study, C14:1 was significantly increased by the CC genotype of SCD g.10329 (C>T) in muscle tissue. Variants in the FASN gene have been linked to increased SFA levels in adipose tissue, while certain SNPs in the SCD gene correlate with elevated MUFA content, this aligns with studies suggesting that genetic factors significantly impact the composition of beef fat [41]. This study emphasizes the importance of the ratio of saturated to unsaturated fatty acids in beef, a critical aspect of nutrition and health. The genotypic variations observed in the SCD and FASN genes have influence on fatty acids ratio, which has significant implications for the breeding strategies to produce beef with a healthier fatty acid profile. As an n-6 polyunsaturated fatty acid (PUFA), γC18:3 serves as a precursor for dihomo-γ-linolenic acid (DGLA) and arachidonic acid (AA) via desaturation and elongation pathways [42]. Differences in C18:3n-6 levels may result from genetic polymorphisms in FASN and SCD, which regulate fatty acid synthesis and desaturation [43]. In terms of meat quality, n-6 PUFAs, including C18:3n-6, affect marbling, tenderness, and oxidative stability. While higher PUFA levels enhance tenderness and juiciness, they also increase lipid oxidation, impacting shelf life and flavor stability [44,45]. In Hanwoo cattle, optimizing PUFA content and oxidative resistance is crucial for meat palatability and consumer acceptance. Although further research is needed, C18:3n-6 may contribute to improved beef flavor and nutritional value, supporting its relevance in selective breeding strategies.
Though the PLAG1 gene primarily associated with growth traits and carcass characteristics, its indirect influence on fatty acid profile is also noteworthy [16,46]. PLAG1 polymorphism showed a relation with palmitoleic acid and Eicosenoic acid in Japanese Black cattle and Hanwoo cattle, respectively [47,48]. Specific genotypes of PLAG1 might affect the distribution and amount of intramuscular fat, subsequently altering beef’s SFA and MUFA content.
This study underscores the potential of SNP-based genetic selection in optimizing the fatty acid composition of beef. However, it also highlights the complexity of genetic and environmental interactions in determining beef quality. Future research should, therefore, extend beyond genetic factors to encompass external influences, such as diet and farming practices, to holistically understand and improve beef quality.
4.3. Relative Expression of Adipogenic Genes of Different Genotypes in Hanwoo Steer
This study provides valuable perception on the influence of SNP genotypes in FASN, SCD, and PLAG1 genes on adipogenic gene expression and their consequent impact on lipid metabolism in beef cattle. The observed variations in gene expression patterns among these genotypes are crucial for understanding how genetic factors contribute to beef quality, particularly fat content and lipid composition.
The significant differences in AMPKα and CPT1 expression among FASN genotypes suggest a genotype-dependent regulation of lipid metabolism pathways. Given that AMPKα inhibits fatty acid synthesis and promotes β-oxidation, its lower expression in FASN-AG genotypes may facilitate greater lipid accumulation, contributing to higher intramuscular fat (IMF) levels [49]. CPT1 promotes the β-oxidation of fatty acids by catalyzing the formation of long-chain acylcarnitines and is an important mediator of fatty acid oxidation (FAO) [50]. The lower expression levels of AMPKα and CPT1 in the FASN-AG genotype compared to AA and the higher levels in GG compared to AG types suggest a genotype-dependent modulation of fatty acid metabolism pathways. Previous studies in beef cattle have shown a negative correlation between AMPKα expression and IMF content, reinforcing the role of AMPKα in fat metabolism regulation [51]. GPR43, a short-chain fatty acid receptor, also exhibited expression variation across different genotypes. The observed trend shows that genotypes containing G allele demonstrate higher GPR43 expression. The link between GPR43 expression and intramuscular fat deposition remains underexplored in cattle, but studies in other livestock species indicate that GPR43 activation enhances adipogenic pathways [52]. This suggests that GPR43 corresponds with the established role of short-chain fatty acids in energy metabolism and adipogenesis [53]. SCD expression was highest in the GG genotype, supporting its role as a key regulator of monounsaturated fatty acid (MUFA) synthesis. SCD converts saturated fatty acids (C18:0) into MUFAs (C18:1), which are crucial for marbling, tenderness, and oxidative stability [32]. The association between SCD polymorphisms and increased MUFA content has been reported in multiple cattle breeds, further reinforcing SCD’s role as a genetic marker for meat quality improvement [54]. Such variations might influence the fatty acid profile and energy utilization in muscle tissues.
A key finding of this study is the significant variation in SCD gene expression across different genotypes, particularly its highest expression in SCD-GG genotypes. SCD catalyzes the conversion of saturated fatty acids (SFAs) into monounsaturated fatty acids (MUFAs), such as oleic acid (C18:1). Elevated SCD expression directly increases the proportion of MUFAs, which are associated with enhanced marbling, improved tenderness, and better oxidative stability in beef [54]. The significant variation in GPR43 and SCD expression in T-containing genotypes further supports the idea that SCD polymorphisms influence lipid metabolism by altering the fatty acid profile. The correlation between higher SCD expression and increased unsaturated fatty acid content has been well documented in cattle [55]. Given that C18:1 is a major determinant of beef flavor and consumer preference, the association between SCD genotype and increased MUFA content highlights its potential use as a genetic marker for selective breeding programs aimed at improving meat quality. Furthermore, while the differences in AMPKα and CPT1 expression between SCD CC and CT genotypes were not statistically significant, their modulation suggests a potential link between lipid oxidation and fatty acid synthesis in muscle tissues, which warrants further investigation.
Studies in Nellore cattle have identified PLAG1 polymorphisms as significant contributors to carcass weight and fat deposition, highlighting its potential impact on IMF content and beef quality [18]. Compared to CC types, the PLAG1 CG and GG genotypes showed higher expression levels of AMPKα, CPT1, and SCD, linking the PLAG1 genotype to lipid metabolism [34,47]. PLAG1 functions as a transcription factor that regulates genes involved in growth, metabolism, and adipogenesis. One of its key mechanisms is through the insulin-like growth factor (IGF) signaling pathway, where it upregulates IGF-2, leading to IGF-1 receptor activation [56]. This pathway has been implicated in modulating AMPKα activity, which in turn regulates fatty acid metabolism by inhibiting lipogenesis and promoting fatty acid oxidation [57]. The higher AMPKα expression in PLAG1 GG genotypes suggests that PLAG1 may influence lipid metabolism by altering energy balance and adipogenic signaling. Since AMPKα suppresses fatty acid synthesis while enhancing β-oxidation, its increased expression in these genotypes could contribute to variations in fat deposition and beef quality traits. Similarly, the upregulation of CPT1 and SCD in PLAG1 CG and GG genotypes further supports the role of PLAG1 in lipid mobilization and fatty acid desaturation, processes essential for intramuscular fat composition and marbling development in beef cattle.
This study’s findings reveal a complex interaction between genetic factors and adipogenic gene expression in beef cattle. The variations in expression levels of AMPKα, CPT1, GPR43, and SCD across different SNP genotypes underscore the potential of using genetic information to predict and influence fat composition and metabolism in beef production. However, it is crucial to integrate these genetic influences with environmental and dietary factors for a comprehensive understanding of beef quality traits. Future research should combine genetic, nutritional, and management strategies to optimize beef quality and cater to consumer preferences. Additionally, the identification of favorable SNPs in FASN, SCD, and PLAG1 can serve as a basis for marker-assisted selection (MAS) and crossbreeding strategies in Hanwoo cattle. Incorporating these genetic markers into breeding programs could enhance traceability and quality control in beef production, supporting precision livestock farming.
5. Conclusions
This study investigated the effects of FASN g.16024 (A>G), SCD g.10329 (C>T), and PLAG1 g.25003338 (C>G) SNPs on carcass traits and fatty acid composition in Hanwoo cattle. The primary findings indicate that specific genotypes (FASN-AG, SCD-CT, and PLAG1-GG) were more prevalent in the population and were positively associated with superior carcass quality and yield grades. These SNPs significantly influenced the fatty acid profile, affecting both saturated and unsaturated fatty acids, which suggests their potential role in lipid metabolism and beef quality improvement. Additionally, variations in the expression of adipogenic genes (AMPKα, CPT1, GPR43, and SCD) were observed among different genotypes, indicating a possible genetic influence on lipid metabolism and adipogenesis. These findings offer valuable insights into the genetic regulation of lipid metabolism and beef quality, emphasizing the potential of FASN, SCD, and PLAG1 SNPs as selective breeding markers. Integrating these genetic variations into breeding programs could enhance intramuscular fat composition, marbling, and overall meat quality, contributing to the optimization of Hanwoo beef production. However, while these results advance our understanding of the molecular mechanisms of fat deposition, further functional validation is necessary to confirm their biological significance. However, the small sample size (n = 128) and uncontrolled environmental factors may limit the results’ generalizability. Despite these constraints, this study provides valuable insights for genetic selection and beef quality improvement in Hanwoo cattle.
Author Contributions
J.Y., S.N.: Methodology, Data curation, Investigation, Writing—review and editing, Writing—original draft. Y.C., S.P., T.L.: Methodology, Data Curation, Investigation. S.H., S.C.: Software, Investigation. X.L., T.L., S.C.: Conceptualization, Project administration, Writing—review and editing. S.C., X.L.: Writing—review and editing, Funding acquisition. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Korea Institute for Animal Products Quality Evaluation and the National Research Foundation in Korea (grant number: NRF-2018R1D1A3B07048219).
Institutional Review Board Statement
Animal experiments were performed strictly following the guidance for the care and use of laboratory animals by the Laboratory Animal Research Center (LARC) IACUC members at Chungbuk National University, Korea.
Informed Consent Statement
Not applicable.
Data Availability Statement
Data will be made available on reasonable request.
Conflicts of Interest
The authors declare no conflicts of interest.
Abbreviations
The following abbreviations are used in this manuscript:
| SNP | Single Nucleotide Polymorphism |
| QTL | Quantitative Trait Locus |
| FASN | Fatty Acid Synthase |
| SCD | Stearoyl-CoA Desaturase |
| PLAG1 | Pleomorphic Adenoma gene 1 |
| RPS9 | Ribosomal protein S9 |
| AMPK-α | AMP-activated protein kinase-α |
| CPT1β | Carnitine Palmitoyl Transferase-1β |
| GPR43 | G-coupled protein receptor-43 |
| PCR-RFLP | Polymerase chain reaction–restriction fragment length polymorphism |
| PCR | Polymerase Chain Reaction |
| BF3 | Boron trifluoride |
| KOH | Potassium hydroxide |
| FID | Fréchet inception distance |
| GLM | General Linear Model |
| HWE | Hardy–Weinberg Equilibrium |
| DMRT | Duncan’s Multiple Range test |
| SEM | Standard Error Mean |
| RT-qPCR | Real-time polymerase chain reaction |
| SFA | Saturated fatty acid |
| MUFA | Monounsaturated fatty acid |
References
- Choi, Y.; Davis, M.E.; Chung, H. Effects of Genetic Variants in the Promoter Region of the Bovine Adiponectin (ADIPOQ) Gene on Marbling of Hanwoo Beef Cattle. Meat Sci. 2015, 105, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Henchion, M.M.; McCarthy, M.; Resconi, V.C. Beef Quality Attributes: A Systematic Review of Consumer Perspectives. Meat Sci. 2017, 128, 1–7. [Google Scholar] [CrossRef]
- Doyle, J.L.; Berry, D.P.; Veerkamp, R.F.; Carthy, T.R.; Evans, R.D.; Walsh, S.W.; Purfield, D.C. Genomic regions associated with muscularity in beef cattle differ in five contrasting cattle breeds. Genet. Sel. Evol. 2020, 52, 2. [Google Scholar] [CrossRef]
- Romero, J.V.; Olleta, J.L.; Resconi, V.C.; Santolaria, P.; del Mar Campo, M. Genetic Markers Associated with Beef Quality: A Review. Livest. Sci. 2024, 289, 105583. [Google Scholar] [CrossRef]
- Kawaguchi, F.; Tsuchimura, M.; Oyama, K.; Matsuhashi, T.; Maruyama, S.; Mannen, H.; Sasazaki, S. Effect of DNA markers on the fertility traits of Japanese Black cattle for improving beef quantity and quality. Arch. Anim. Breed. 2020, 63, 9–17. [Google Scholar] [CrossRef]
- Mwangi, F.W.; Charmley, E.; Gardiner, C.P.; Malau-Aduli, B.S.; Kinobe, R.T.; Malau-Aduli, A.E. Diet and genetics influence beef cattle performance and meat quality characteristics. Foods 2019, 8, 648. [Google Scholar] [CrossRef] [PubMed]
- Bhuiyan, M.S.; Kim, Y.K.; Kim, H.J.; Lee, D.H.; Lee, S.H.; Yoon, H.B.; Lee, S.H. Genome-Wide Association Study and Prediction of Genomic Breeding Values for Fatty-Acid Composition in Korean Hanwoo Cattle Using a High-Density Single-Nucleotide Polymorphism Array. J. Anim. Sci. 2018, 96, 4063–4075. [Google Scholar] [CrossRef]
- Smith, J.L.; Wilson, M.L.; Nilson, S.M.; Rowan, T.N.; Oldeschulte, D.L.; Schnabel, R.D.; Decker, J.E.; Seabury, C.M. Genome-wide association and genotype by environment interactions for growth traits in US Gelbvieh cattle. BMC Genom. 2019, 20, 926. [Google Scholar] [CrossRef]
- Terry, S.A.; Basarab, J.A.; Guan, L.L.; McAllister, T.A. Strategies to improve the efficiency of beef cattle production. Can. J. Anim. Sci. 2020, 101, 1–19. [Google Scholar] [CrossRef]
- Mwangi, F.W.; Pewan, S.B.; Otto, J.R.; Adegboye, O.A.; Charmley, E.; Gardiner, C.P.; Malau-Aduli, B.S.; Kinobe, R.T.; Malau-Aduli, A.E. Single nucleotide polymorphisms in the fatty acid binding protein 4, fatty acid synthase and stearoyl-CoA desaturase genes influence carcass characteristics of tropical crossbred beef steers. Agriculture 2022, 12, 1171. [Google Scholar] [CrossRef]
- Pećina, M.; Konjačić, M.; Ugarković, N.K.; Ivanković, A. Effect of FASN, SCD, and GH genes on carcass fatness and fatty acid composition of intramuscular lipids in F1 Holstein× beef breeds. Agriculture 2023, 13, 571. [Google Scholar] [CrossRef]
- Zhu, B.; Wang, T.; Niu, Q.; Wang, Z.; Hay, E.H.; Xu, L.; Chen, Y.; Zhang, L.; Gao, X.; Gao, H.; et al. Multiple strategies association revealed functional candidate FASN gene for fatty acid composition in cattle. Commun. Biol. 2025, 8, 208. [Google Scholar] [CrossRef]
- Abe, T.; Saburi, J.; Hasebe, H.; Nakagawa, T.; Misumi, S.; Nade, T.; Nakajima, H.; Shoji, N.; Kobayashi, M.; Kobayashi, E. Novel Mutations of the FASN Gene and Their Effect on Fatty Acid Composition in Japanese Black Beef. Biochem. Genet. 2009, 47, 397–411. [Google Scholar] [CrossRef] [PubMed]
- Dawood, M.; Kramer, L.M.; Shabbir, M.I.; Reecy, J.M. Genome-Wide Association Study for Fatty Acid Composition in American Angus Cattle. Animals 2021, 11, 2424. [Google Scholar] [CrossRef]
- Jin, S.; Lee, S.H.; Lee, D.H.; Manjula, P.; Lee, S.H.; Lee, J.H. Genetic association of DEGS1, ELOVL6, FABP3, FABP4, FASN and SCD genes with fatty acid composition in breast and thigh muscles of Korean native chicken. Anim. Genet. 2020, 51, 344–345. [Google Scholar] [CrossRef]
- Sasago, N.; Abe, T.; Sakuma, H.; Kojima, T.; Uemoto, Y. Genome-wide association study for carcass traits, fatty acid composition, chemical composition, sugar, and the effects of related candidate genes in Japanese Black cattle. Anim. Sci. J. 2017, 88, 33–44. [Google Scholar] [CrossRef]
- Edea, Z.; Jeoung, Y.H.; Shin, S.-S.; Ku, J.; Seo, S.; Kim, I.-H.; Kim, S.-W.; Kim, K.-S. Genome–Wide Association Study of Carcass Weight in Commercial Hanwoo Cattle. Asian-Australas. J. Anim. Sci. 2017, 31, 327–334. [Google Scholar] [CrossRef]
- Utsunomiya, Y.T.; Milanesi, M.; Utsunomiya, A.T.; Torrecilha, R.B.; Kim, E.S.; Costa, M.S.; Aguiar, T.S.; Schroeder, S.; Do Carmo, A.S.; Carvalheiro, R.; et al. A PLAG1 Mutation Contributed to Stature Recovery in Modern Cattle. Sci. Rep. 2017, 7, 17140. [Google Scholar] [CrossRef]
- GT Pereira, A.; Utsunomiya, Y.T.; Milanesi, M.; Torrecilha, R.B.; Carmo, A.S.; Neves, H.H.; Carvalheiro, R.; Ajmone-Marsan, P.; Sonstegard, T.S.; Sölkner, J.; et al. Pleiotropic genes affecting carcass traits in Bos indicus (Nellore) cattle are modulators of growth. PLoS ONE 2016, 11, e0158165. [Google Scholar] [CrossRef]
- Takasuga, A. PLAG1 and NCAPG-LCORL in livestock. Anim. Sci. J. 2016, 87, 159–167. [Google Scholar] [CrossRef]
- Fahira, A.; Noor, R.R.; Jakaria, J. Diversity of SNP C.795A > G PLAG1 Gene and Its Association to Birth Weight of Bali Cattle. J. Ilmu Ternak Dan Vet. 2022, 27, 107–113. [Google Scholar] [CrossRef]
- Ministry of Agriculture, Food and Rural Affairs. Detailed Criteria for Livestock Product Grading, Ministry of Agriculture, Food and Rural Affairs Notice No. 2023-102; MAFRA: Sejong, Republic of Korea, 2023.
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Schennink, A.; Bovenhuis, H.; Léon-Kloosterziel, K.M.; Van Arendonk, J.A.M.; Visker, M.H.P.W. Effect of Polymorphisms in TheFASN, OLR1, PPARGC1A, PRL and STAT5Agenes on Bovine Milk-Fat Composition. Anim. Genet. 2009, 40, 909–916. [Google Scholar] [CrossRef]
- Bartoň, L.; Bureš, D.; Kott, T.; Řehák, D. Associations of Polymorphisms in Bovine DGAT1, FABP4, FASN, and PPARGC1A Genes with Intramuscular Fat Content and the Fatty Acid Composition of Muscle and Subcutaneous Fat in Fleckvieh Bulls. Meat Sci. 2016, 114, 18–23. [Google Scholar] [CrossRef] [PubMed]
- Matsuhashi, T.; Maruyama, S.; Uemoto, Y.; Kobayashi, N.; Mannen, H.; Abe, T.; Sakaguchi, S.; Kobayashi, E. Effects of Bovine Fatty Acid Synthase, Stearoyl-Coenzyme a Desaturase, Sterol Regulatory Element-Binding Protein 1, and Growth Hormone Gene Polymorphisms on Fatty Acid Composition and Carcass Traits in Japanese Black Cattle1. J. Anim. Sci. 2011, 89, 12–22. [Google Scholar] [CrossRef]
- Taye, M.; Yoon, J.; Dessie, T.; Cho, S.; Oh, S.J.; Lee, H.K.; Kim, H. Deciphering signature of selection affecting beef quality traits in Angus cattle. Genes Genom. 2018, 40, 63–75. [Google Scholar] [CrossRef] [PubMed]
- Seo, D.; Lee, D.H.; Jin, S.; Won, J.I.; Lim, D.; Park, M.; Kim, T.H.; Lee, H.K.; Kim, S.; Choi, I.; et al. Long-term artificial selection of Hanwoo (Korean) cattle left genetic signatures for the breeding traits and has altered the genomic structure. Sci. Rep. 2022, 12, 6438. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Xu, L.; Chen, Y.; Zhang, L.; Gao, H.; Zhu, B.; Niu, H.; Zhang, W.; Xia, J.; Gao, X.; et al. Genome-Wide Association Study Reveals the PLAG1 Gene for Knuckle, Biceps and Shank Weight in Simmental Beef Cattle. PLoS ONE 2016, 11, e0168316. [Google Scholar] [CrossRef]
- Zhou, Z.; Huang, B.; Lai, Z.; Li, S.; Wu, F.; Qu, K.; Jia, Y.; Hou, J.; Liu, J.; Lei, C.; et al. The Distribution Characteristics of a 19-Bp Indel of the PLAG1 Gene in Chinese Cattle. Animals 2019, 9, 1082. [Google Scholar] [CrossRef]
- Chu, M.; Wu, X.Y.; Guo, X.; Pei, J.; Jiao, F.; Fang, H.T.; Liang, C.N.; Ding, X.Z.; Bao, P.J.; Yan, P. Association between Single-Nucleotide Polymorphisms of Fatty Acid Synthase Gene and Meat Quality Traits in Datong Yak (Bos grunniens). Genet. Mol. Res. 2015, 14, 2617–2625. [Google Scholar] [CrossRef]
- Gao, Y.Y.; Cheng, G.; Cheng, Z.X.; Bao, C.; Yamada, T.; Cao, G.F.; Bao, S.Q.; Schreurs, N.M.; Zan, L.S.; Tong, B. Association of Variants in FABP4, FASN, SCD, SREBP1 and TCAP Genes with Intramuscular Fat, Carcass Traits and Body Size in Chinese Qinchuan Cattle. Meat Sci. 2022, 192, 108882. [Google Scholar] [CrossRef]
- Fink, T.; Tiplady, K.; Lopdell, T.; Johnson, T.; Snell, R.G.; Spelman, R.J.; Davis, S.R.; Littlejohn, M.D. Functional Confirmation of PLAG1 as the Candidate Causative Gene Underlying Major Pleiotropic Effects on Body Weight and Milk Characteristics. Sci. Rep. 2017, 7, 44793. [Google Scholar] [CrossRef]
- Kawaguchi, F.; Kigoshi, H.; Nakajima, A.; Matsumoto, Y.; Uemoto, Y.; Fukushima, M.; Yoshida, E.; Iwamoto, E.; Akiyama, T.; Kohama, N.; et al. Pool-Based Genome-Wide Association Study Identified Novel Candidate Regions on BTA9 and 14 for Oleic Acid Percentage in Japanese Black Cattle. Anim. Sci. J. Nihon Chikusan Gakkaiho 2018, 89, 1060–1066. [Google Scholar] [CrossRef] [PubMed]
- Sasazaki, S. Development of DNA Markers for Improvement of Meat Quality in a Japanese Black Cattle Population in Hyogo Prefecture. Anim. Sci. J. 2021, 92, e13663. [Google Scholar] [CrossRef]
- Yokota, S.; Sugita, H.; Ardiyanti, A.; Shoji, N.; Nakajima, H.; Hosono, M.; Otomo, Y.; Suda, Y.; Katoh, K.; Suzuki, K. Contributions of FASN and SCD Gene Polymorphisms on Fatty Acid Composition in Muscle from Japanese Black Cattle. Anim. Genet. 2012, 43, 790–792. [Google Scholar] [CrossRef]
- Otto, J.R.; Mwangi, F.W.; Pewan, S.B.; Adegboye, O.A.; Malau-Aduli, A.E. Lipogenic gene single nucleotide polymorphic DNA markers associated with intramuscular fat, fat melting point, and health-beneficial omega-3 long-chain polyunsaturated fatty acids in Australian pasture-based Bowen Genetics Forest Pastoral Angus, Hereford, and Wagyu beef cattle. Genes 2022, 13, 1411. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.J.; Sharma, A.; Lee, S.H.; Lee, D.H.; Lim, D.J.; Cho, Y.M.; Yang, B.S.; Lee, S.H. Genetic Association of PLAG1, SCD, CYP7B1 and FASN SNPs and Their Effects on Carcass Weight, Intramuscular Fat and Fatty Acid Composition in Hanwoo Steers (Korean Cattle). Anim. Genet. 2017, 48, 251–252. [Google Scholar] [CrossRef]
- Oh, D.; Jin, M.; Lee, Y.; Ha, J.; Kim, B.; Yeo, J.; Lee, J. Identification of Stearoyl-CoA Desaturase (SCD) Gene Interactions in Korean Native Cattle Based on the Multifactor-Dimensionality Reduction Method. Asian-Australas. J. Anim. Sci. 2013, 26, 1218–1228. [Google Scholar] [CrossRef]
- Oh, D.; Lee, Y.; La, B.; Yeo, J.; Chung, E.; Kim, Y.; Lee, C. Fatty Acid Composition of Beef Is Associated with Exonic Nucleotide Variants of the Gene Encoding FASN. Mol. Biol. Rep. 2011, 39, 4083–4090. [Google Scholar] [CrossRef]
- Sevane, N.; Levéziel, H.; Nute, G.R.; Sañudo, C.; Valentini, A.; Williams, J.; Dunner, S. Phenotypic and Genotypic Background Underlying Variations in Fatty Acid Composition and Sensory Parameters in European Bovine Breeds. J. Anim. Sci. Biotechnol. 2014, 5, 20. [Google Scholar] [CrossRef]
- Saini, R.K.; Keum, Y.S. Omega-3 and omega-6 polyunsaturated fatty acids: Dietary sources, metabolism, and significance—A review. Life Sci. 2018, 203, 255–267. [Google Scholar] [CrossRef] [PubMed]
- Gökçe, G. The effect of SCD and FASN gene polymorphisms on milk fatty acid composition in Holstein breed. Food Sci. Anim. Resour. 2024. [Google Scholar] [CrossRef]
- Arshad, M.S.; Sohaib, M.; Ahmad, R.S.; Nadeem, M.T.; Imran, A.; Arshad, M.U.; Kwon, J.H.; Amjad, Z. Ruminant meat flavor influenced by different factors with special reference to fatty acids. Lipids Health Dis. 2018, 17, 223. [Google Scholar] [CrossRef] [PubMed]
- Dinh TT, N.; To, K.V.; Schilling, M.W. Fatty acid composition of meat animals as flavor precursors. Meat Muscle Biol. 2021, 5, 1–16. [Google Scholar] [CrossRef]
- Zhong, J.-L.; Xu, J.-W.; Wang, J.; Wen, Y.-F.; Niu, H.; Zheng, L.; He, H.; Peng, K.; He, P.; Shi, S.-Y.; et al. A Novel SNP of PLAG1 Gene and Its Association with Growth Traits in Chinese Cattle. Gene 2019, 689, 166–171. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Miao, J.; Song, Y.; Zhang, W.; Xu, L.; Chen, Y.; Zhang, L.; Gao, H.; Zhu, B.; Li, J.; et al. Genome-Wide Association Study Identifies the PLAG1-OXR1 Region on BTA14 for Carcass Meat Yield in Cattle. Physiol. Genom. 2019, 51, 137–144. [Google Scholar] [CrossRef]
- Kim, H.; Park, S.; Kim, B.; Kim, M.; Lee, T.H.; Yu, J.; Park, I.S.; Hur, S.J.; Li, X.Z.; Choi, S.H. Effect of Glucose and Lysine Supplementation on Myogenic and Adipogenic Gene Expression in Muscle Satellite Cells Isolated from Hanwoo with Different Genotypes of PLAG1: Implications for Cell-Based Food Production. Curr. Res. Food Sci. 2024, 9, 100879. [Google Scholar] [CrossRef]
- Fang, C.; Pan, J.; Qu, N.; Lei, Y.; Han, J.; Zhang, J.; Han, D. The AMPK pathway in fatty liver disease. Front. Physiol. 2022, 13, 970292. [Google Scholar] [CrossRef]
- Wang, J.; Xiang, H.; Lu, Y.; Wu, T.; Ji, G. The Role and Therapeutic Implication of CPTs in Fatty Acid Oxidation and Cancers Progression. Am. J. Cancer Res. 2021, 11, 2477–2494. [Google Scholar] [PubMed Central]
- Yao, C.; Pang, D.; Lu, C.; Xu, A.; Huang, P.; Ouyang, H.; Yu, H. Data mining and validation of AMPK pathway as a novel candidate role affecting intramuscular fat content in pigs. Animals 2019, 9, 137. [Google Scholar] [CrossRef]
- Lee, D.H.; Kim, M.T.; Han, J.H. GPR41 and GPR43: From development to metabolic regulation. Biomed. Pharmacother. 2024, 175, 116735. [Google Scholar] [CrossRef]
- Durand, G.; Charrier, P.; Bes, S.; Bernard, L.; Lamothe, V.; Gruffat, D.; Bonnet, M. Gene expression of free fatty acids-sensing G protein-coupled receptors in beef cattle. J. Anim. Sci. 2024, 102, skae114. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Fang, X.; Lu, X.; Liu, Y.; Li, Y.; Bai, X.; Ding, X.; Yang, R. Polymorphisms of the SCD1 Gene and Its Association Analysis with Carcass, Meat Quality, Adipogenic Traits, Fatty Acid Composition, and Milk Production Traits in Cattle. Animals 2024, 14, 1759. [Google Scholar] [CrossRef] [PubMed]
- Gamarra, D.; Aldai, N.; Arakawa, A.; Barron, L.J.; López-Oceja, A.; de Pancorbo, M.M.; Taniguchi, M. Distinct correlations between lipogenic gene expression and fatty acid composition of subcutaneous fat among cattle breeds. BMC Vet. Res. 2018, 14, 167. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Wu, M.; Zhao, H.; Fan, L.; Zhang, Y.; Yuan, T.; He, S.; Wang, P.; Zhang, Y.; Sun, X.; et al. The PLAG1 mRNA expression analysis among genetic variants and relevance to growth traits in Chinese cattle. Anim. Biotechnol. 2020, 31, 504–511. [Google Scholar] [CrossRef]
- Aghanoori, M.R.; Smith, D.R.; Shariati-Ievari, S.; Ajisebutu, A.; Nguyen, A.; Desmond, F.; Jesus, C.H.; Zhou, X.; Calcutt, N.A.; Aliani, M.; et al. Insulin-like growth factor-1 activates AMPK to augment mitochondrial function and correct neuronal metabolism in sensory neurons in type 1 diabetes. Mol. Metab. 2019, 20, 149–165. [Google Scholar] [CrossRef]
Figure 1.
Illustration of FASN g. 16024 (A>G), SCD g. 10329 (C>T), PLAG1 g. 25003338 (C>G) genotypes on the agarose gel. 100 bp ladder (Cat. No. SDL42-B500, SolGent™ 100 bpPlus DNA Ladder, SolGent Co., Ltd., Seoul, Republic of Korea).
Figure 1.
Illustration of FASN g. 16024 (A>G), SCD g. 10329 (C>T), PLAG1 g. 25003338 (C>G) genotypes on the agarose gel. 100 bp ladder (Cat. No. SDL42-B500, SolGent™ 100 bpPlus DNA Ladder, SolGent Co., Ltd., Seoul, Republic of Korea).
Figure 2.
Association of carcass weight, marbling score, and yield grade with genotype of FASN g. 16024, SCD g. 10329, and PLAG1 g. 25003338. Yield Grade A = 3, Grade B = 2, Grade C = 1. Marbling score: 1 = trace, 9 = very abundant. Yield grade: A (> 62.52), B (60.40–62.52), C (<60.40). (Yield grade thresholds are based on the livestock grading criteria issued by the Ministry of Agriculture, Food and Rural Affairs (MAFRA), Republic of Korea; Notification No. 2020-112). a, b: Mean in the same line with different superscripts significantly differed (p < 0.05).
Figure 2.
Association of carcass weight, marbling score, and yield grade with genotype of FASN g. 16024, SCD g. 10329, and PLAG1 g. 25003338. Yield Grade A = 3, Grade B = 2, Grade C = 1. Marbling score: 1 = trace, 9 = very abundant. Yield grade: A (> 62.52), B (60.40–62.52), C (<60.40). (Yield grade thresholds are based on the livestock grading criteria issued by the Ministry of Agriculture, Food and Rural Affairs (MAFRA), Republic of Korea; Notification No. 2020-112). a, b: Mean in the same line with different superscripts significantly differed (p < 0.05).
Figure 3.
Relative gene expression of AMPK, GPR43, CPT1, and SCD in muscle tissue of Hanwoo steer. The results were expressed as means ± SEM (n = 3). The asterisks indicate a significant difference between results (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Figure 3.
Relative gene expression of AMPK, GPR43, CPT1, and SCD in muscle tissue of Hanwoo steer. The results were expressed as means ± SEM (n = 3). The asterisks indicate a significant difference between results (* p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).
Table 1.
Primer sequences of FASN g. 16024 G>A, SCD g. 10329 C>T, and PLAG1 g. 25003338 C>G.
| Gene | Primer Sequence (5′ to 3′) | Size (bp) and Amplified Region | Annealing Temp | Restriction Enzyme |
|---|---|---|---|---|
| FASN NC_037346.1 | F: CTACCAAGCCAGGCAGGTC | 337 (Exon 34) | 52 °C | HhaI |
| R: GCCATTGTACTTGGGCTTGT | ||||
| SCD NC_037353.1 | F: TCAGGTAGGTCTCAGCGTC | 494 (Exon 5) | 52 °C | FauI |
| R: CATTGTCATTTTTCACCCTTT | ||||
| PLAG1 NC_037341.1 | F: CAA GGG CTC AAC GTA GG | 374 (3′UTR) | 53 °C | HphI |
| R: TGTTTCAAGTGCCATTAGAGG |
Table 2.
Forward and reverse primers for real-time quantitative PCR for specific gene mRNA.
| Gene | Gene ID | Sequence (5′ to 3′) |
|---|---|---|
| RPS9 | DT860044 | F: GAGCTGGGTTTGTCGCAAAA |
| R: GGTCGAGGCGGGACTTCT | ||
| AMPK-α | NM_001109802 | F: ACCATTCTTGGTTGCTGAAACTC |
| R: CACCTTGGTGTTTGGATTTCTG | ||
| CPT1β | NM_001034349 | F: ACACATCTACCTGTCCGTGATCA |
| R: CCCCTGAGGATGCCATTCT | ||
| GPR43 | FJ_562212 | F: GGCTTTCCCCGTGCAGTA |
| R: ATCAGAGCAGCGATCACTCCAT | ||
| SCD | AB075020 | F: TGCCCACCACAAGTTTTCAG |
| R: GCCAACCCACGTGAGAGAAG |
Table 3.
Genotype frequencies and allele frequencies with carcass traits in Hanwoo steer.
| FASN g. 16024 G>A | χ2 | SCD g. 10329 C>T | χ2 | PLAG1 g. 25003338 C>G | χ2 | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Genotype | Allele | Genotype | Allele | Genotype | Allele | |||||||||||||
| AA (n = 22) | AG (n = 45) | GG (n = 41) | A | G | CC (n = 12) | CT (n = 54) | TT (n = 33) | C | T | CC (n = 9) | CG (n = 39) | GG (n = 51) | C | G | ||||
| 0.204 | 0.417 | 0.380 | 0.412 | 0.588 | 0.347 | 0.121 | 0.545 | 0.333 | 0.394 | 0.606 | 0.367 | 0.091 | 0.394 | 0.515 | 0.288 | 0.712 | 0.927 | |
| Quality Grade | ||||||||||||||||||
| 1++ | 0.102 | 0.176 | 0.130 | 0.190 | 0.218 | 0.040 | 0.232 | 0.131 | 0.157 | 0.247 | 0.020 | 0.162 | 0.232 | 0.101 | 0.313 | |||
| 1+ | 0.065 | 0.120 | 0.167 | 0.125 | 0.227 | 0.040 | 0.192 | 0.131 | 0.136 | 0.227 | 0.051 | 0.162 | 0.172 | 0.131 | 0.253 | |||
| 1 | 0.028 | 0.083 | 0.074 | 0.069 | 0.116 | 0.040 | 0.091 | 0.051 | 0.086 | 0.096 | 0.000 | 0.061 | 0.091 | 0.030 | 0.121 | |||
| 2 | 0.009 | 0.037 | 0.009 | 0.028 | 0.028 | 0.000 | 0.030 | 0.020 | 0.015 | 0.035 | 0.020 | 0.010 | 0.020 | 0.025 | 0.025 | |||
| Yield Grade | ||||||||||||||||||
| A | 0.056 | 0.065 | 0.065 | 0.088 | 0.097 | 0.030 | 0.101 | 0.091 | 0.081 | 0.141 | 0.051 | 0.071 | 0.091 | 0.086 | 0.126 | |||
| B | 0.120 | 0.269 | 0.231 | 0.255 | 0.366 | 0.061 | 0.323 | 0.192 | 0.222 | 0.354 | 0.040 | 0.242 | 0.323 | 0.162 | 0.444 | |||
| C | 0.028 | 0.083 | 0.083 | 0.069 | 0.125 | 0.030 | 0.121 | 0.051 | 0.091 | 0.111 | 0.000 | 0.081 | 0.101 | 0.040 | 0.141 | |||
Yield index formula for steers: [11.06398 − 1.25149 × Backfat thickness (mm) + 0.28293 × Ribeye area (cm2) + 0.54768 × Carcass cold weight (kg)] ÷ Carcass cold weight (kg) × 100. A > 62.52, 62.52 > B > 60.40, C > 60.40.
Table 4.
Muscle tissue and adipose tissue fatty acid composition (mg/100 mL) of FASN g. 16024 G>A in Hanwoo steer.
Table 4.
Muscle tissue and adipose tissue fatty acid composition (mg/100 mL) of FASN g. 16024 G>A in Hanwoo steer.
| Muscle Tissue | p-Value | Adipose Tissue | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| AA | AG | GG | AA | AG | GG | |||
| Decanoic acid (C10:0) | 4.35 ± 2.39 | 3.58 ± 3.16 | 2.66 ± 3.42 | 0.22 | 0.62 ± 1.86 | 1.47 ± 2.46 | 0.85 ± 2.03 | 0.564 |
| Lauric acid (C12:0) | 0.07 ± 0.03 | 0.06 ± 0.04 | 0.06 ± 0.04 | 0.354 | 0.12 ± 0.03 ab | 0.13 ± 0.03 a | 0.10 ± 0.03 b | 0.018 |
| Myristic acid (C14:0) | 2.27 ± 0.32 | 2.40 ± 0.56 | 2.20 ± 0.50 | 0.302 | 3.11 ± 0.32 | 3.66 ± 0.64 | 3.63 ± 0.93 | 0.163 |
| Myristoleic acid (C14:1) | 0.61 ± 0.23 | 0.66 ± 0.27 | 0.57 ± 0.24 | 0.354 | 2.36 ± 0.54 | 2.20 ± 0.69 | 2.40 ± 1.07 | 0.765 |
| Palmitic acid (C16:0) | 26.07 ± 1.62 | 26.74 ± 1.99 | 27.01 ± 1.44 | 0.225 | 23.36 ± 1.27 | 24.32 ± 2.11 | 24.49 ± 1.87 | 0.323 |
| Palmitoleic acid (C16:1) | 4.08 ± 0.58 | 4.15 ± 0.89 | 3.96 ± 0.75 | 0.653 | 7.79 ± 1.53 | 7.74 ± 1.37 | 8.45 ± 1.67 | 0.330 |
| Stearic acid (C18:0) | 9.37 ± 1.19 | 9.76 ± 1.24 | 9.89 ± 1.29 | 0.427 | 5.98 ± 1.55 | 6.68 ± 1.49 | 6.30 ± 1.19 | 0.438 |
| Oleic acid (C18:1) | 45.55 ± 1.87 | 44.69 ± 2.72 | 45.16 ± 2.99 | 0.595 | 50.21 ± 1.66 | 47.79 ± 3.95 | 47.86 ± 3.79 | 0.208 |
| Linoleic (C18:2n-6) | 3.86 ± 1.22 | 4.02 ± 1.89 | 4.40 ± 1.40 | 0.483 | 2.68 ± 0.34 | 2.55 ± 0.41 | 2.59 ± 0.47 | 0.771 |
| γ-Linoleic (C18:3n-6) | 0.09 ± 0.04 a | 0.08 ± 0.07 a | 0.04 ± 0.05 b | 0.013 | 0.21 ± 0.04 | 0.19 ± 0.03 | 0.19 ± 0.03 | 0.151 |
| Linolenic (C18:3n-3) | 0.13 ± 0.02 | 0.11 ± 0.07 | 0.22 ± 0.51 | 0.482 | 0.16 ± 0.02 | 0.15 ± 0.03 | 0.15 ± 0.03 | 0.530 |
| Arachidic acid (C20:0) | 0.03 ± 0.03 | 0.03 ± 0.03 | 0.02 ± 0.03 | 0.249 | 0.04 ± 0.04 | 0.05 ± 0.04 | 0.03 ± 0.04 | 0.466 |
| Heneicosanoic acid (C20:1) | 0.30 ± 0.08 | 0.25 ± 0.1 | 0.26 ± 0.09 | 0.34 | 0.53 ± 0.15 a | 0.42 ± 0.14 b | 0.39 ± 0.13 b | 0.037 |
| Eicosatrienoic acid (C20:2n-6) | 0.02 ± 0.05 | 0.01 ± 0.03 | 0.02 ± 0.04 | 0.618 | 0.02 ± 0.04 a | 0.00 ± 0.00 b | 0.00 ± 0.02 ab | 0.079 |
| C20:3n-6 | 0.48 ± 0.26 | 0.56 ± 0.36 | 0.60 ± 0.25 | 0.416 | 0.20 ± 0.06 | 0.21 ± 0.04 | 0.16 ± 0.07 | 0.063 |
| C20:4n-6 | 0.96 ± 0.58 | 1.09 ± 0.84 | 1.22 ± 0.61 | 0.493 | 0.06 ± 0.06 | 0.06 ± 0.05 | 0.04 ± 0.05 | 0.428 |
| Total SFAs (1) | 43.03 ± 2.96 | 43.50 ± 3.61 | 42.70 ± 3.31 | 0.669 | 34.21 ± 2.20 b | 37.27 ± 4.37 a | 36.35 ± 3.38 ab | 0.131 |
| Total MUFAs (2) | 51.19 ± 2.24 | 50.40 ± 2.90 | 50.61 ± 2.74 | 0.656 | 61.76 ± 1.99 | 58.92 ± 4.39 | 59.87 ± 3.16 | 0.158 |
| Total PUFAs (3) | 5.55 ± 2.00 | 5.87 ± 2.98 | 6.50 ± 2.19 | 0.426 | 3.34 ± 0.46 | 3.15 ± 0.45 | 3.14 ± 0.52 | 0.565 |
| UFAs/SFAs (4) | 1.33 ± 0.16 | 1.31 ± 0.19 | 1.35 ± 0.18 | 0.661 | 1.91 ± 0.18 a | 1.70 ± 0.30 b | 1.76 ± 0.25 ab | 0.147 |
| ω3/ω6 | 0.03 ± 0.01 | 0.02 ± 0.02 | 0.03 ± 0.07 | 0.695 | 0.05 ± 0.01 | 0.05 ± 0.01 | 0.05 ± 0.01 | 0.488 |
(1) SFAs: saturated fatty acids. (2) MUFAs: monounsaturated fatty acids. (3) PUFAs: polyunsaturated fatty acids. (4) UFAs: unsaturated fatty acids. a, b: Mean in the same line with different superscripts significantly differed (p < 0.05).
Table 5.
Muscle tissue and adipose tissue fatty acid composition (mg/100 mL) of SCD g. 10329 (C>T) in Hanwoo steer.
Table 5.
Muscle tissue and adipose tissue fatty acid composition (mg/100 mL) of SCD g. 10329 (C>T) in Hanwoo steer.
| Muscle Tissue | p-Value | Adipose Tissue | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| CC | CT | TT | CC | CT | TT | |||
| Decanoic acid (C10:0) | 2.25 ± 3.12 | 3.05 ± 3.12 | 4.05 ± 3.51 | 0.363 | 0.8 ± 2.11 | 1 ± 2.13 | 1.3 ± 2.37 | 0.882 |
| Lauric acid (C12:0) | 0.06 ± 0.03 | 0.06 ± 0.05 | 0.06 ± 0.05 | 0.97 | 0.11 ± 0.03 | 0.12 ± 0.03 | 0.11 ± 0.04 | 0.726 |
| Myristic acid (C14:0) | 2.09 ± 0.27 | 2.26 ± 0.53 | 2.33 ± 0.53 | 0.53 | 3.12 ± 0.66 | 3.58 ± 0.67 | 3.65 ± 0.85 | 0.279 |
| Myristoleic acid (C14:1) | 0.77 ± 0.18 a | 0.65 ± 0.32 ab | 0.51 ± 0.27 b | 0.086 | 2.61 ± 0.9 a | 2.56 ± 0.9 a | 1.85 ± 0.56 b | 0.047 |
| Palmitic acid (C16:0) | 26.59 ± 1.45 | 26.74 ± 1.57 | 26.42 ± 1.68 | 0.768 | 23.54 ± 1.76 | 24.33 ± 1.52 | 24.01 ± 1.94 | 0.562 |
| Palmitoleic acid (C16:1) | 3.9 ± 0.44 | 4.1 ± 0.99 | 4.12 ± 0.83 | 0.834 | 6.89 ± 1.67 b | 8.58 ± 1.33 a | 8.07 ± 1.02 a | 0.019 |
| Stearic acid (C18:0) | 9.15 ± 0.78 | 9.62 ± 1.39 | 10.11 ± 1.52 | 0.217 | 6.69 ± 1.61 | 5.88 ± 0.9 | 6.43 ± 0.87 | 0.14 |
| Oleic acid (C18:1) | 46.4 ± 2.7 | 45.26 ± 2.81 | 44.66 ± 2.59 | 0.324 | 49.78 ± 2.92 | 48 ± 3.36 | 48.68 ± 4.16 | 0.513 |
| Linoleic (C18:2n-6) | 4.46 ± 1.62 | 4.26 ± 1.58 | 3.95 ± 1.67 | 0.703 | 2.75 ± 0.44 | 2.57 ± 0.41 | 2.57 ± 0.51 | 0.629 |
| γ-Linoleic (C18:3n-6) | 0.07 ± 0.06 | 0.07 ± 0.07 | 0.08 ± 0.05 | 0.869 | 0.22 ± 0.03 a | 0.2 ± 0.03 ab | 0.18 ± 0.03 b | 0.041 |
| Linolenic (C18:3n-3) | 0.15 ± 0.04 | 0.2 ± 0.47 | 0.1 ± 0.06 | 0.627 | 0.15 ± 0.03 | 0.15 ± 0.03 | 0.14 ± 0.02 | 0.432 |
| Arachidic acid (C20:0) | 0.02 ± 0.03 | 0.02 ± 0.03 | 0.03 ± 0.03 | 0.564 | 0.04 ± 0.04 | 0.03 ± 0.03 | 0.05 ± 0.04 | 0.195 |
| Heneicosanoic acid (C20:1) | 0.3 ± 0.08 | 0.27 ± 0.09 | 0.24 ± 0.09 | 0.282 | 0.48 ± 0.14 | 0.41 ± 0.13 | 0.44 ± 0.16 | 0.555 |
| Eicosatrienoic acid (C20:2n-6) | 0 ± 0 | 0.02 ± 0.04 | 0.03 ± 0.04 | 0.234 | 0.01 ± 0.03 | 0 ± 0 | 0.01 ± 0.03 | 0.28 |
| C20:3n-6 | 0.65 ± 0.3 | 0.58 ± 0.28 | 0.5 ± 0.34 | 0.471 | 0.2 ± 0.03 | 0.19 ± 0.07 | 0.18 ± 0.07 | 0.839 |
| C20:4n-6 | 1.29 ± 0.64 | 1.17 ± 0.69 | 1 ± 0.82 | 0.566 | 0.04 ± 0.06 | 0.05 ± 0.05 | 0.06 ± 0.05 | 0.648 |
| Total SFAs (1) | 41.07 ± 2.17 b | 42.59 ± 3.36 ab | 43.98 ± 2.95 a | 0.077 | 35.39 ± 2.56 | 35.85 ± 3.11 | 36.44 ± 3.57 | 0.77 |
| Total MUFAs (2) | 52.08 ± 2.51 | 50.91 ± 2.7 | 50.17 ± 2.51 | 0.225 | 60.6 ± 2.82 | 60.32 ± 2.95 | 59.82 ± 3.44 | 0.849 |
| Total PUFAs (3) | 6.62 ± 2.48 | 6.29 ± 2.52 | 5.66 ± 2.69 | 0.587 | 3.36 ± 0.48 | 3.16 ± 0.48 | 3.13 ± 0.55 | 0.585 |
| UFAs/SFAs (4) | 1.44 ± 0.13 a | 1.36 ± 0.18 ab | 1.28 ± 0.15 b | 0.075 | 1.82 ± 0.18 | 1.79 ± 0.23 | 1.75 ± 0.27 | 0.831 |
| ω3/ω6 | 0.03 ± 0.01 | 0.03 ± 0.07 | 0.02 ± 0.01 | 0.723 | 0.05 ± 0 | 0.05 ± 0.01 | 0.05 ± 0 | 0.269 |
(1) SFAs: saturated fatty acids. (2) MUFAs: monounsaturated fatty acids. (3) PUFAs: polyunsaturated fatty acids. (4) UFAs: unsaturated fatty acids. a, b: Mean in the same line with different superscripts significantly differed (p < 0.05).
Table 6.
Muscle tissue and adipose tissue fatty acid composition (mg/100 mL) of PLAG1 g. 25003338 (C>G) in Hanwoo steer.
Table 6.
Muscle tissue and adipose tissue fatty acid composition (mg/100 mL) of PLAG1 g. 25003338 (C>G) in Hanwoo steer.
| Muscle Tissue | p-Value | Adipose Tissue | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| CC | CG | GG | CC | CG | GG | |||
| Decanoic acid (C10:0) | 4.9 ± 2.83 | 2.71 ± 3.31 | 3.31 ± 3.14 | 0.351 | 2.13 ± 2.95 | 1.09 ± 2.17 | 0.93 ± 2.13 | 0.553 |
| Lauric acid (C12:0) | 0.09 ± 0.02 | 0.06 ± 0.04 | 0.06 ± 0.04 | 0.202 | 0.16 ± 0.03 a | 0.12 ± 0.03 b | 0.1 ± 0.02 b | 0.001 |
| Myristic acid (C14:0) | 2.71 ± 0.64 a | 2.33 ± 0.54 ab | 2.14 ± 0.42 b | 0.04 | 4.47 ± 0.88 a | 3.6 ± 0.89 b | 3.37 ± 0.5 b | 0.01 |
| Myristoleic acid (C14:1) | 0.75 ± 0.24 | 0.65 ± 0.27 | 0.55 ± 0.24 | 0.118 | 2.47 ± 1.13 | 2.08 ± 0.93 | 2.4 ± 0.72 | 0.483 |
| Palmitic acid (C16:0) | 25.71 ± 2.67 | 26.75 ± 1.84 | 26.7 ± 1.39 | 0.441 | 25.74 ± 2.64 | 24.31 ± 2.28 | 24.03 ± 1.29 | 0.174 |
| Palmitoleic acid (C16:1) | 4.66 ± 1.04 a | 4.13 ± 0.84 ab | 3.9 ± 0.74 b | 0.121 | 7.81 ± 1.86 | 7.58 ± 1.54 | 8.33 ± 1.2 | 0.267 |
| Stearic acid (C18:0) | 9.48 ± 1.28 | 9.9 ± 1.3 | 9.76 ± 1.3 | 0.776 | 7.85 ± 1.71 a | 6.68 ± 1.16 b | 5.91 ± 0.88 b | 0.002 |
| Oleic acid (C18:1) | 44.5 ± 3.24 | 44.94 ± 3.17 | 45.57 ± 2.29 | 0.556 | 43.47 ± 4.32 b | 48.63 ± 4.01 a | 48.86 ± 2.61 a | 0.007 |
| Linoleic (C18:2n-6) | 3.54 ± 1.27 | 4.46 ± 1.81 | 4.12 ± 1.44 | 0.444 | 2.57 ± 0.19 | 2.52 ± 0.46 | 2.65 ± 0.45 | 0.674 |
| γ-Linoleic (C18:3n-6) | 0.07 ± 0.07 | 0.07 ± 0.07 | 0.06 ± 0.05 | 0.753 | 0.17 ± 0.05 b | 0.2 ± 0.03 a | 0.19 ± 0.03 ab | 0.153 |
| Linolenic (C18:3n-3) | 0.16 ± 0.04 | 0.1 ± 0.07 | 0.21 ± 0.48 | 0.47 | 0.16 ± 0.03 | 0.15 ± 0.03 | 0.15 ± 0.02 | 0.454 |
| Arachidic acid (C20:0) | 0.03 ± 0.03 | 0.02 ± 0.03 | 0.02 ± 0.03 | 0.766 | 0.07 ± 0.01 a | 0.04 ± 0.04 b | 0.03 ± 0.03 b | 0.072 |
| Heneicosanoic acid (C20:1) | 0.27 ± 0.11 | 0.23 ± 0.13 | 0.28 ± 0.06 | 0.148 | 0.3 ± 0.16 b | 0.46 ± 0.16 a | 0.42 ± 0.12 ab | 0.087 |
| Eicosatrienoic acid (C20:2n-6) | 0.01 ± 0.02 | 0.02 ± 0.04 | 0.02 ± 0.04 | 0.837 | 0 ± 0 | 0.01 ± 0.02 | 0 ± 0.02 | 0.809 |
| C20:3n-6 | 0.44 ± 0.16 | 0.59 ± 0.34 | 0.56 ± 0.28 | 0.6 | 0.18 ± 0.11 | 0.19 ± 0.07 | 0.19 ± 0.04 | 0.925 |
| C20:4n-6 | 0.83 ± 0.44 | 1.21 ± 0.82 | 1.1 ± 0.65 | 0.533 | 0.05 ± 0.06 | 0.04 ± 0.05 | 0.05 ± 0.05 | 0.723 |
| Total SFAs (1) | 43.8 ± 2.88 | 42.74 ± 3.44 | 42.81 ± 3.38 | 0.806 | 41.49 ± 4.61 a | 36.82 ± 3.13 b | 35.28 ± 2.61 b | 0.001 |
| Total MUFAs (2) | 50.85 ± 3.17 | 50.63 ± 3.03 | 50.92 ± 2.42 | 0.916 | 54.78 ± 4.58 b | 59.52 ± 3.09 a | 60.81 ± 2.57 a | 0.001 |
| Total PUFAs (3) | 5.05 ± 1.8 | 6.44 ± 2.84 | 6.06 ± 2.37 | 0.517 | 3.12 ± 0.29 | 3.1 ± 0.52 | 3.23 ± 0.49 | 0.698 |
| UFAs/SFAs (4) | 1.29 ± 0.16 | 1.35 ± 0.18 | 1.35 ± 0.18 | 0.764 | 1.42 ± 0.29 b | 1.72 ± 0.23 a | 1.83 ± 0.2 a | 0.002 |
| ω3/ω6 | 0.03 ± 0.01 | 0.02 ± 0.01 | 0.04 ± 0.07 | 0.41 | 0.05 ± 0.01 | 0.05 ± 0.01 | 0.05 ± 0.01 | 0.323 |
(1) SFAs: saturated fatty acids. (2) MUFAs: monounsaturated fatty acids. (3) PUFAs: polyunsaturated fatty acids. (4) UFAs: unsaturated fatty acids. a, b: Mean in the same line with different superscripts significantly differed (p < 0.05).
Table 7.
Effects of FASN g. 16024 G>A genotype and quality grade on fatty acid composition in Hanwoo steer.
Table 7.
Effects of FASN g. 16024 G>A genotype and quality grade on fatty acid composition in Hanwoo steer.
| Muscle Tissue | Adipose Tissue | |||||
|---|---|---|---|---|---|---|
| Genotype (G) | Quality Grade (Q) | G×Q | Genotype (G) | Quality Grade (Q) | G×Q | |
| Decanoic acid (C10:0) | N.S. | N.S. | N.S. | N.S. | * | N.S. |
| Lauric acid (C12:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Myristic acid (C14:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Myristoleic acid (C14:1) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Palmitic acid (C16:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Palmitoleic acid (C16:1) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Stearic acid (C18:0) | N.S. | N.S. | * | N.S. | N.S. | N.S. |
| Oleic acid (C18:1) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Linoleic (C18:2n-6) | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| γ-Linoleic (C18:3n-6) | * | * | N.S. | N.S. | N.S. | N.S. |
| Linolenic (C18:3n-3) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Arachidic acid (C20:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Heneicosanoic acid (C20:1) | * | N.S. | N.S. | N.S. | N.S. | N.S. |
| Eicosatrienoic acid (C20:2n-6) | N.S. | N.S. | N.S. | * | * | * |
| C20:3n-6 | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| C20:4n-6 | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| Total SFAs (1) | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| Total MUFAs (2) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Total PUFAs (3) | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| UFAs/SFAs (4) | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| ω3/ω6 | N.S. | N.S. | N.S. | * | N.S. | N.S. |
(1) SFAs: saturated fatty acids. (2) MUFAs: monounsaturated fatty acids. (3) PUFAs: polyunsaturated fatty acids. (4) UFAs: unsaturated fatty acids. N.S.: Non-significant. * p < 0.05.
Table 8.
Effects of SCD g. 10329 C>T genotype and quality grade on fatty acid composition in Hanwoo steer.
Table 8.
Effects of SCD g. 10329 C>T genotype and quality grade on fatty acid composition in Hanwoo steer.
| Muscle Tissue | Adipose Tissue | |||||
|---|---|---|---|---|---|---|
| Genotype (G) | Quality Grade (Q) | G×Q | Genotype (G) | Quality Grade (Q) | G×Q | |
| Decanoic acid (C10:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Lauric acid (C12:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Myristic acid (C14:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Myristoleic acid (C14:1) | N.S. | N.S. | N.S. | * | N.S. | N.S. |
| Palmitic acid (C16:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Palmitoleic acid (C16:1) | N.S. | N.S. | N.S. | * | N.S. | N.S. |
| Stearic acid (C18:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Oleic acid (C18:1) | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| Linoleic (C18:2n-6) | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| γ-Linoleic (C18:3n-6) | N.S. | N.S. | N.S. | * | N.S. | N.S. |
| Linolenic (C18:3n-3) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Arachidic acid (C20:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Heneicosanoic acid (C20:1) | * | N.S. | * | N.S. | N.S. | N.S. |
| Eicosatrienoic acid (C20:2n-6) | N.S. | N.S. | N.S. | N.S. | *** | N.S. |
| C20:3n-6 | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| C20:4n-6 | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Total SFAs (1) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Total MUFAs (2) | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| Total PUFAs (3) | N.S. | * | N.S. | N.S. | N.S. | N.S. |
| UFAs/SFAs (4) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| ω3/ω6 | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
(1) SFAs: saturated fatty acids. (2) MUFAs: monounsaturated fatty acids. (3) PUFAs: polyunsaturated fatty acids. (4) UFAs: unsaturated fatty acids. N.S.: Non-significant. * p < 0.05. *** p < 0.0001.
Table 9.
Effects of PLAG1 g. 25003338 C>G genotype and quality grade on fatty acid composition in Hanwoo steer.
Table 9.
Effects of PLAG1 g. 25003338 C>G genotype and quality grade on fatty acid composition in Hanwoo steer.
| Muscle Tissue | Adipose Tissue | |||||
|---|---|---|---|---|---|---|
| Genotype (G) | Quality Grade (Q) | G×Q | Genotype (G) | Quality Grade (Q) | G×Q | |
| Decanoic acid (C10:0) | N.S. | * | N.S. | N.S. | * | N.S. |
| Lauric acid (C12:0) | * | N.S. | N.S. | * | N.S. | N.S. |
| Myristic acid (C14:0) | * | N.S. | N.S. | * | N.S. | N.S. |
| Myristoleic acid (C14:1) | * | N.S. | N.S. | N.S. | N.S. | N.S. |
| Palmitic acid (C16:0) | *** | * | *** | N.S. | N.S. | N.S. |
| Palmitoleic acid (C16:1) | ** | * | * | N.S. | N.S. | N.S. |
| Stearic acid (C18:0) | N.S. | N.S. | N.S. | * | N.S. | N.S. |
| Oleic acid (C18:1) | *** | N.S. | *** | * | N.S. | N.S. |
| Linoleic (C18:2n-6) | N.S. | N.S. | * | N.S. | N.S. | N.S. |
| γ-Linoleic (C18:3n-6) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Linolenic (C18:3n-3) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Arachidic acid (C20:0) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Heneicosanoic acid (C20:1) | * | N.S. | N.S. | N.S. | N.S. | N.S. |
| Eicosatrienoic acid (C20:2n-6) | N.S. | N.S. | N.S. | N.S. | ** | N.S. |
| C20:3n-6 | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| C20:4n-6 | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| Total SFAs (1) | ** | * | *** | * | N.S. | N.S. |
| Total MUFAs (2) | *** | N.S. | *** | * | N.S. | N.S. |
| Total PUFAs (3) | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
| UFAs/SFAs (4) | *** | *** | *** | * | N.S. | N.S. |
| ω3/ω6 | N.S. | N.S. | N.S. | N.S. | N.S. | N.S. |
(1) SFAs: saturated fatty acids. (2) MUFAs: monounsaturated fatty acids. (3) PUFAs: polyunsaturated fatty acids. (4) UFAs: unsaturated fatty acids. N.S.: Non-significant. * p < 0.05. ** p < 0.001. *** p < 0.0001.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Yu, J.; Naseem, S.; Park, S.; Hur, S.; Choi, Y.; Lee, T.; Li, X.; Choi, S. FASN, SCD, and PLAG1 Gene Polymorphism and Association with Carcass Traits and Fatty Acid Profile in Hanwoo Cattle. Animals 2025, 15, 897. https://doi.org/10.3390/ani15060897
AMA Style
Yu J, Naseem S, Park S, Hur S, Choi Y, Lee T, Li X, Choi S. FASN, SCD, and PLAG1 Gene Polymorphism and Association with Carcass Traits and Fatty Acid Profile in Hanwoo Cattle. Animals. 2025; 15(6):897. https://doi.org/10.3390/ani15060897
Chicago/Turabian StyleYu, Jia, Sajida Naseem, Sungkwon Park, Sunjin Hur, Yoonbin Choi, Teahyung Lee, Xiangzi Li, and Seongho Choi. 2025. "FASN, SCD, and PLAG1 Gene Polymorphism and Association with Carcass Traits and Fatty Acid Profile in Hanwoo Cattle" Animals 15, no. 6: 897. https://doi.org/10.3390/ani15060897
APA StyleYu, J., Naseem, S., Park, S., Hur, S., Choi, Y., Lee, T., Li, X., & Choi, S. (2025). FASN, SCD, and PLAG1 Gene Polymorphism and Association with Carcass Traits and Fatty Acid Profile in Hanwoo Cattle. Animals, 15(6), 897. https://doi.org/10.3390/ani15060897
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
