Soluble Expression of Small Antibody Fragments against PD-L1 Using Escherichia coli with High Yield and Purity
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Gene Construction
2.3. Expression and Purification of Antibody Fragments
2.4. Enzyme-Linked Immunosorbent Assay
3. Results
3.1. Antibody Fragment-Expressing Plasmids
3.2. Expression and Purification of Antibody Fragments
3.3. Confirmation of Antigen-Binding Efficiency
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Akinleye, A.; Rasool, Z. Immune checkpoint inhibitors of PD-L1 as cancer therapeutics. J. Hematol. Oncol. 2019, 12, 92. [Google Scholar] [CrossRef] [Green Version]
- Butte, M.J.; Keir, M.E.; Phamduy, T.B.; Sharpe, A.H.; Freeman, G.J. Programmed death-1 ligand 1 interacts specifically with the B7-1 costimulatory molecule to inhibit T cell responses. Immunity 2007, 27, 111–122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peterson, E.; Owens, S.M.; Henry, R.L. Monoclonal antibody form and function: Manufacturing the right antibodies for treating drug abuse. AAPS J. 2006, 8, E383–E390. [Google Scholar] [CrossRef] [Green Version]
- Chames, P.; Van Regenmortel, M.; Weiss, E.; Baty, D. Therapeutic antibodies: Successes, limitations and hopes for the future. Br. J. Pharmacol. 2009, 157, 220–233. [Google Scholar] [CrossRef]
- Beckman, R.A.; Weiner, L.M.; Davis, H.M. Antibody constructs in cancer therapy: Protein engineering strategies to improve exposure in solid tumors. Cancer 2007, 109, 170–179. [Google Scholar] [CrossRef] [PubMed]
- Yokota, T.; Milenic, D.E.; Whitlow, M.; Schlom, J. Rapid tumor penetration of a single-chain Fv and comparison with other immunoglobulin forms. Cancer Res. 1992, 52, 3402–3408. [Google Scholar]
- Terpe, K. Overview of bacterial expression systems for heterologous protein production: From molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 2006, 72, 211–222. [Google Scholar] [CrossRef] [PubMed]
- Makrides, S.C. Strategies for achieving high-level expression of genes in Escherichia coli. Microbiol. Rev. 1996, 60, 512–538. [Google Scholar] [CrossRef] [PubMed]
- Jeong, H.-J.; Kawamura, T.; Dong, J.; Ueda, H. Q-Bodies from Recombinant Single-Chain Fv Fragment with Better Yield and Expanded Palette of Fluorophores. ACS Sens. 2016, 1, 88–94. [Google Scholar] [CrossRef]
- Drees, J.J.; Augustin, L.B.; Mertensotto, M.J.; Schottel, J.L.; Leonard, A.S.; Saltzman, D.A. Soluble production of a biologically active single-chain antibody against murine PD-L1 in Escherichia coli. Protein Expr. Purif. 2014, 94, 60–66. [Google Scholar] [CrossRef]
- Samaranayake, H.; Wirth, T.; Schenkwein, D.; Räty, J.K.; Ylä-Herttuala, S. Challenges in monoclonal antibody-based therapies. Ann. Med. 2009, 41, 322–331. [Google Scholar] [CrossRef]
- Holliger, P.; Hudson, P.J. Engineered antibody fragments and the rise of single domains. Nat. Biotechnol. 2005, 23, 1126–1136. [Google Scholar] [CrossRef]
- Wu, Y.; Jiang, S.; Ying, T. Single-Domain Antibodies As Therapeutics against Human Viral Diseases. Front. Immunol. 2017, 8, 1802. [Google Scholar] [CrossRef]
- Ying, T.; Chen, W.; Feng, Y.; Wang, Y.; Gong, R.; Dimitrov, D.S. Engineered soluble monomeric IgG1 CH3 domain: Generation, mechanisms of function, and implications for design of biological therapeutics. J. Biol. Chem. 2013, 288, 25154–25164. [Google Scholar] [CrossRef] [Green Version]
- Ying, T.; Ju, T.W.; Wang, Y.; Prabakaran, P.; Dimitrov, D.S. Interactions of IgG1 CH2 and CH3 Domains with FcRn. Front. Immunol. 2014, 5, 146. [Google Scholar] [CrossRef] [Green Version]
- Ying, T.; Wang, Y.; Feng, Y.; Prabakaran, P.; Gong, R.; Wang, L.; Crowder, K.; Dimitrov, D.S. Engineered antibody domains with significantly increased transcytosis and half-life in macaques mediated by FcRn. MAbs 2015, 7, 922–930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ying, T.; Feng, Y.; Wang, Y.; Chen, W.; Dimitrov, D.S. Monomeric IgG1 Fc molecules displaying unique Fc receptor interactions that are exploitable to treat inflammation-mediated diseases. MAbs 2014, 6, 1201–1210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; Ying, T. New Directions for Half-Life Extension of Protein Therapeutics: The Rise of Antibody Fc Domains and Fragments. Curr. Pharm. Biotechnol. 2016, 17, 1348–1352. [Google Scholar] [CrossRef] [PubMed]
- Jespers, L.; Schon, O.; James, L.C.; Veprintsev, D.; Winter, G. Crystal structure of HEL4, a soluble, refoldable human V(H) single domain with a germ-line scaffold. J. Mol. Biol. 2004, 337, 893–903. [Google Scholar] [CrossRef] [PubMed]
- Dudgeon, K.; Rouet, R.; Kokmeijer, I.; Schofield, P.; Stolp, J.; Langley, D.; Stock, D.; Christ, D. General strategy for the generation of human antibody variable domains with increased aggregation resistance. Proc. Natl. Acad. Sci. USA 2012, 109, 10879–10884. [Google Scholar] [CrossRef] [Green Version]
- Bhatwa, A.; Wang, W.; Hassan, Y.I.; Abraham, N.; Li, X.-Z.; Zhou, T. Challenges Associated with the Formation of Recombinant Protein Inclusion Bodies in Escherichia coli and Strategies to Address Them for Industrial Applications. Front. Bioeng. Biotechnol. 2021, 9, 65. [Google Scholar] [CrossRef] [PubMed]
- Leong, S.S.J.; Chen, W.N. Preparing recombinant single chain antibodies. Chem. Eng. Sci. 2008, 63, 1401–1414. [Google Scholar] [CrossRef]
- Guglielmi, L.; Martineau, P. Expression of single-chain Fv fragments in E. coli cytoplasm. Methods Mol. Biol. 2009, 562, 215–224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verma, R.; Boleti, E.; George, A.J. Antibody engineering: Comparison of bacterial, yeast, insect and mammalian expression systems. J. Immunol. Methods 1998, 216, 165–181. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′-3′) |
---|---|
pSQinsertFw55 | ggagatatacatatggctcaaatcg |
pSQinsertRv57 | gtcatcgtcgtccttgtagtc |
CysToSrtCys_Fw | tatacatatgggcggtggaggtggtgctcaaatcgaag |
Infusion_HisToHisFlag-Rv | tgtagtcggatccgccatgatgatgatgatgat |
aPDL1VH_Rv_infusion | tgtagtcggatccgccatgatgatgatgatgatgagaaccccccccagatctagaggactgac |
vectorPCR_NdeI_Rv | gagccatatgtatatctcc |
vectorPCR_BamHI_Fw | atggcggatccgactac |
VH Deletion Fw | aggcggccctgacgttggacgagtcc |
VH Deletion Rv | agggccgcctgggccacggtagc |
Sequence (5′-3′) | |
---|---|
scFv | atgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtggcccaggcggccctgactcagccgtcctcggtgtcagcaaacctgggaggaaccgtcaagatcacctgctccgggggtagtggcagctacggctggtatcagcagaaggcacctggcagtgcccctgtcagtctgatctatgacaacaccaacagaccctcggacatcccttcacgattctccggtgccctatccggctccacagccacattaaccatcactggggtccaagccgaggacgaggctgtctattactgtgggagcagggacagcagtaatgctggttctgtatttggggccgggacaaccctgaccgtcctaggtcagtcctctagatcttccggcggtggtggcagctccggtggtggcggttccgccctgacgttggacgagtccgggggcggcctccagacgcccggaggagcgctcagcctcgtctgcaaggcctccgggttcaccttcagtgaccgtggcatgcactgggtgcgacaggcgcccggcaaggggctggagtgggtcggtgctattagcaggagagggagtaccacaacttacgcacccgcggtgaagggccgtgccaccatcacgagggacaacgggcagagcacagtgaggctgcagctgaacaacctcactgctgaggacaccgccacctacttctgcgccaaaaatgatgattctgtcggtatagtgactacttctactatcgacgcatggggccacgggaccgaagtcatcgtctcctccactagtggccaggccggccagggggggggttctcatcatcatcatcatcatggcggatccgactacaaggacgacgatgacaaa |
VH | atgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtggcccaggcggccctgactcagccgtcctcggtgtcagcaaacctgggaggaaccgtcaagatcacctgctccgggggtagtggcagctacggctggtatcagcagaaggcacctggcagtgcccctgtcagtctgatctatgacaacaccaacagaccctcggacatcccttcacgattctccggtgccctatccggctccacagccacattaaccatcactggggtccaagccgaggacgaggctgtctattactgtgggagcagggacagcagtaatgctggttctgtatttggggccgggacaaccctgaccgtcctaggtcagtcctctagatctggggggggttctcatcatcatcatcatcatggcggatccgactacaaggacgacgatgacaaa |
VL | atggccctgacgttggacgagtccgggggcggcctccagacgcccggaggagcgctcagcctcgtctgcaaggcctccgggttcaccttcagtgaccgtggcatgcactgggtgcgacaggcgcccggcaaggggctggagtgggtcggtgctattagcaggagagggagtaccacaacttacgcacccgcggtgaagggccgtgccaccatcacgagggacaacgggcagagcacagtgaggctgcagctgaacaacctcactgctgaggacaccgccacctacttctgcgccaaaaatgatgattctgtcggtatagtgactacttctactatcgacgcatggggccacgggaccgaagtcatcgtctcctccactagtggccaggccggccagggggggggttctcatcatcatcatcatcatggcggatccgactacaaggacgacgatgacaaa |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, S.-H.; Jeong, H.-J. Soluble Expression of Small Antibody Fragments against PD-L1 Using Escherichia coli with High Yield and Purity. Appl. Sci. 2021, 11, 9149. https://doi.org/10.3390/app11199149
Kim S-H, Jeong H-J. Soluble Expression of Small Antibody Fragments against PD-L1 Using Escherichia coli with High Yield and Purity. Applied Sciences. 2021; 11(19):9149. https://doi.org/10.3390/app11199149
Chicago/Turabian StyleKim, Sun-Hee, and Hee-Jin Jeong. 2021. "Soluble Expression of Small Antibody Fragments against PD-L1 Using Escherichia coli with High Yield and Purity" Applied Sciences 11, no. 19: 9149. https://doi.org/10.3390/app11199149