Closely-Spaced Repetitions of CAMTA Trans-Factor Binding Sites in Promoters of Model Plant MEP Pathway Genes
Abstract
:1. Introduction
2. Materials and Methods
Promoter Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jiang, Z.; Gao, W.; Huang, L. Tanshinones, Critical Pharmacological Components in Salvia miltiorrhiza. Front. Pharmacol. 2019, 10, 202. [Google Scholar] [CrossRef] [PubMed]
- Gryszczynska, A.; Opala, B.; Lowicki, Z.; Dreger, M.; Gorska-Paukszta, M.; Szulc, M.; Kaminska, E.; Litwin, E.; Struzik, P.; Dyr, W.; et al. Bioactive compounds determination in the callus and hydroalcoholic extracts from Salvia miltiorrhiza and Salvia przewalskii—Preliminary study on their anti-alcoholic activity effects. Phytochem. Lett. 2015, 11, 399–403. [Google Scholar] [CrossRef]
- Su, C.Y.; Ming, Q.L.; Rahman, K.; Han, T.; Qin, L.P. Salvia miltiorrhiza: Traditional medicinal uses, chemistry and pharmacology. Chin. J. Nat. Med. 2015, 13, 163–182. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Ma, R.; Liu, C.; Liu, H.; Zhu, R.; Guo, S.; Tang, M.; Li, Y.; Niu, J.; Fu, M.; et al. Salvia miltiorrhiza: A potential red light to the development of cardiovascular diseases. Curr. Pharm. Des. 2017, 23, 1077–1097. [Google Scholar] [CrossRef]
- Zhou, L.; Zuo, Z.; Chow, M.S. Danshen: An overview of its chemistry, pharmacology, and clinical use. J. Clin. Pharmacol. 2005, 45, 1345–1389. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Yuan, L.; Li, X.; Chen, S.; Lu, S. Genome-wide identification and characterization of novel genes involved in terpenoid biosynthesis in Salvia miltiorrhiza. J. Exp. Bot. 2012, 63, 2809–2823. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Huang, Q.; Wu, X.; Zhou, Z.; Ding, M.; Shi, M.; Huang, F.; Li, S.; Wang, Y.; Kai, G. Comprehensive transcriptome profiling of Salvia miltiorrhiza for discovery of genes associated with the biosynthesis of tanshinones and phenolic acids. Sci. Rep. 2017, 7, 10554. [Google Scholar] [CrossRef]
- Yang, D.; Du, X.; Liang, X.; Han, R.; Liang, Z.; Liu, Y.; Liu, F.; Zhao, J. Different roles of mevalonate and methylerythritol phosphate pathways in cell growth and tanshinone production in Salvia miltiorrhiza hairy roots. PLoS ONE 2012, 7, e46797. [Google Scholar] [CrossRef]
- Pu, X.; Dong, X.; Li, Q.; Chen, Z.; Liu, L. An update on the function and regulation of methylerythritol phosphate and mevalonate pathways and their evolutionary dynamics. J. Integr. Plant Biol. 2021, 63, 1211–1226. [Google Scholar] [CrossRef]
- Rodríguez-Concepción, M.; Boronat, A. Breaking new ground in the regulation of the early steps of plant isopenoid biosynthesis. Curr. Opin. Plant Biol. 2015, 25, 17–22. [Google Scholar] [CrossRef]
- Xu, C.; Wei, H.; Movahedi, A.; Sun, W.; Ma, X.; Li, D.; Yin, T.; Zhuge, Q. Evaluation, characterization, expression profiling and functional analysis of DXS and DXR genes from Populus trichocarpa. Plant Physiol. Biochem. 2019, 142, 94–105. [Google Scholar] [CrossRef]
- Xu, C.; Li, H.; Gu, C.; Mu, H.; Yue, Y.; Wang, L. Cloning and expression analysis of MEP pathway enzyme-encoding genes in Osmanthus fragrans. Genes 2016, 7, 78. [Google Scholar] [CrossRef]
- Cordoba, E.; Salmi, M.; Leon, P. Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants. J. Exp. Bot. 2009, 60, 2933–2943. [Google Scholar] [CrossRef]
- Hsieh, M.H.; Goodman, H.M. The ArabidopsisIspH homolog is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis. Plant Physiol. 2005, 138, 641–653. [Google Scholar] [CrossRef] [PubMed]
- Kumar, H.; Kumar, S. A functional (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase exhibits diurnal regulation of expression in Stevia rebaudiana (Bertoni). Gene 2013, 527, 332–338. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Xiao, Y.; Di, P.; Yu, X.; Chen, W.; Zhang, L. Molecular cloning and characterization of a 2C methyl-D-erithrytol 2,4-cyclodiphosphate synthase gene from Cephalotaxusharringtonia. Mol. Biol. Rep. 2009, 36, 1749–1756. [Google Scholar] [CrossRef]
- Priest, H.; Filichkin, S.A.; Mockler, T.C. Cis-regulatory elements in plant cell signaling. Curr. Opin. Plant Biol. 2009, 12, 643–649. [Google Scholar] [CrossRef]
- Wang, H.; Cheng, X.; Yin, D.; Chen, D.; Luo, C.; Liu, H.; Huang, C. Advances in the Research on Plant WRKY Transcription Factors Responsive to External Stresses. Curr. Issues Mol. Biol. 2023, 45, 2861–2880. [Google Scholar] [CrossRef] [PubMed]
- Radani, Y.; Li, R.; Korboe, H.M.; Ma, H.; Yang, L. Transcriptional and Post-Translational Regulation of Plant bHLH Transcription Factors during the Response to Environmental Stresses. Plants 2023, 12, 2113. [Google Scholar] [CrossRef]
- Chen, J.; Yang, S.; Fan, B.; Zhu, C.; Chen, Z. The Mediator Complex: A Central Coordinator of Plant Adaptive Responses to Environmental Stresses. Int. J. Mol. Sci. 2022, 23, 6170. [Google Scholar] [CrossRef]
- Leivar, P.; Antolin-Llovera, M.; Ferrero, S.; Closa, M.; Arro, M.; Ferrer, A.; Boronat, A.; Campos, N. Multilevel Control of Arabidopsis 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase by Protein Phosphatase 2A. Plant Cell 2011, 23, 1494–1511. [Google Scholar] [CrossRef]
- Wright, L.P.; Rohwer, J.M.; Ghirardo, A.; Hammerbacher, A.; Ortiz-Alcaide, M.; Raguschke, B.; Schnitzler, J.P.; Gershenzon, J.; Phillips, M.A. Deoxyxylulose 5-phosphate synthase controls flux through the methylerythritol 4-phosphate pathway in Arabidopsis. Plant. Physiol. 2014, 165, 1488–1504. [Google Scholar] [CrossRef]
- Ghirardo, A.; Wright, L.P.; Bi, Z.; Rosenkranz, M.; Pulido, P.; Rodriguez-Concepcion, M.; Niinemets, U.; Bruggemann, N.; Gershenzon, J.; Schnitzler, J.P. Metabolic flux analysis of plastidic isoprenoid biosynthesis in poplar leaves emitting and nonemitting isoprene. Plant Physiol. 2014, 165, 37–51. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Villalon, A.; Gas, E.; Rodriguez-Concepcion, M. Phytoene synthase activity controls the biosynthesis of carotenoids and the supply of their metabolic precursors in dark-grown Arabidopsis seedlings. Plant J. 2009, 60, 424–435. [Google Scholar] [CrossRef] [PubMed]
- Pulido, P.; Toledo-Ortiz, G.; Phillips, M.A.; Wright, L.P.; Rodriguez-Concepcion, M. Arabidopsis J-protein J20 delivers the first enzyme of the plastidial isoprenoid pathway to protein quality control. Plant Cell 2013, 25, 4183–4194. [Google Scholar] [CrossRef] [PubMed]
- Lemos, M.; Xiao, Y.; Bjornson, M.; Wang, J.Z.; Hicks, D.; de Souza, A.; Wang, C.Q.; Yang, P.; Ma, S.; Dinesh-Kumar, S.; et al. The plastidial retrograde signal methyl erythritol cyclopyrophosphate is a regulator of salicylic and jasmonic acid crosstalk. J. Exp. Bot. 2016, 67, 1557–1566. [Google Scholar] [CrossRef]
- Walley, J.; Xiao, Y.; Wang, J.Z.; Baidoo, E.E.; Keasling, J.D.; Shen, Z.; Briggs, S.P.; Dehesh, K. Plastid-produced interorganellar stress signal MEcPP potentiates induction of the unfolded protein response in endoplasmic reticulum. Proc. Natl. Acad. Sci. USA 2015, 112, 6212–6217. [Google Scholar] [CrossRef]
- Xiao, Y.; Savchenko, T.; Baidoo, E.E.K.; Chehab, W.E.; Hayden, D.M.; Tolstikov, V.; Corvin, J.A.; Kliebenstein, D.J.; Keasling, J.D.; Dehesh, K. Retrograde signaling by the plastidial metabolite MEcPP regulates expression of nuclear stress-response genes. Cell 2012, 149, 1525–1535. [Google Scholar] [CrossRef]
- Benn, G.; Bjornson, M.; Ke, H.; De Souza, A.; Balmond, E.I.; Shaw, J.T.; Dehesh, K. Plastidial metabolite MEcPP induces a transcriptionally centered stress-response hub via the transcription factor CAMTA. Proc. Natl. Acad. Sci. USA 2016, 113, 8855–8860. [Google Scholar] [CrossRef]
- Shen, C.; Yang, Y.; Du, L.; Wang, H. Calmodulin-binding transcription activators and perspectives for applications in biotechnology. Appl. Microbiol. Biotechnol. 2015, 99, 10379–10385. [Google Scholar] [CrossRef]
- Walley, J.W.; Coughlan, S.; Hudson, M.E.; Covington, M.F.; Kaspi, R.; Banu, G.; Harmer, S.L.; Dehesh, K. Mechanical stress induces biotic and abiotic stress responses via a novel cis-element. PLoS Genet. 2007, 10, 1800–1812. [Google Scholar] [CrossRef] [PubMed]
- Benn, G.; Wang, C.Q.; Hicks, D.R.; Stein, J.; Guthrie, C.; Dehesh, K. A key general stress response motif is regulated non-uniformly by CAMTA transcription factors. Plant J. 2014, 80, 82–92. [Google Scholar] [CrossRef] [PubMed]
- Amoutzias, G.D.; Robertson, D.L.; Van de Peer, Y.; Oliver, S.G. Choose your partners: Dimerization in eukaryotic transcription factors. Trends Biochem. Sci. 2008, 33, 220–229. [Google Scholar] [CrossRef] [PubMed]
- Freire-Rios, A.; Tanaka, K.; Crespo, I.; van der Wijk, E.; Sizentsova, Y.; Levitsky, V.; Lindhoud, S.; Fontana, M.; Hohlbein, J.; Boer, D.R.; et al. Architecture of DNA elements mediating ARF transcription factor binding and auxin-responsive gene expression in Arabidopsis. Proc. Natl. Acad. Sci. USA 2020, 117, 24557–24566. [Google Scholar] [CrossRef] [PubMed]
- Käppel, S.; Eggeling, R.; Rümpler, F.; Groth, M.; Melzer, R.; Theißen, G. DNA-binding properties of the MADS-domain transcription factor SEPALLATA3 and mutant variants characterized by SELEX-seq. Plant Mol. Biol. 2021, 105, 543–557. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.W.; Kang, N.Y.; Pandey, S.K.; Cho, C.; Lee, S.H.; Kim, J. Dimerization in LBD16 and LBD18 Transcription Factors Is Critical for Lateral Root Formation. Plant Physiol. 2017, 174, 301–311. [Google Scholar] [CrossRef]
- Chen, X.; Neuwald, A.F.; Hilakivi-Clarke, L.; Clarke, R.; Xuan, J. ChIP-GSM: Inferring active transcription factor modules to predict functional regulatory elements. PLoS Comput. Biol. 2021, 17, e1009203. [Google Scholar] [CrossRef]
- Ni, P.; Su, Z. PCRMS: A database of predicted cis-regulatory modules and constituent transcription factor binding sites in genomes. Database 2022, 2022, baac024. [Google Scholar] [CrossRef]
- Gong, P.; Han, J.; Reddig, K.; Li, H.S. A potential dimerization region of dCAMTA is critical for termination of fly visual response. J. Biol. Chem. 2007, 282, 21253–21258. [Google Scholar] [CrossRef]
- Noman, M.; Aysha, J.; Ketehouli, T.; Yang, J.; Du, L.; Wang, F.; Li, H. Calmodulin binding transcription activators: An interplay between calcium signalling and plant stress tolerance. J. Plant Physiol. 2021, 256, 153327. [Google Scholar] [CrossRef]
- Finkler, A.; Ashery-Padan, R.; Fromm, H. CAMTAs: Calmodulin-binding transcription activators from plants to human. FEBS Lett. 2007, 581, 3893–3898. [Google Scholar] [CrossRef] [PubMed]
- Long, C.; Grueter, C.E.; Song, K.; Qin, S.; Qi, X.; Kong, Y.M.; Shelton, J.M.; Richardson, J.A.; Zhang, C.L.; Bassel-Duby, R.; et al. Ataxia and Purkinje cell degeneration in mice lacking the CAMTA1 transcription factor. Proc. Natl. Acad. Sci. USA 2014, 111, 11521–11526. [Google Scholar] [CrossRef] [PubMed]
- Szymczyk, P.; Szymańska, G.; Kuźma, Ł.; Jeleń, A.; Balcerczak, E. Methyl Jasmonate Activates the 2C Methyl-D-erithrytol 2,4-cyclodiphosphate Synthase Gene and Stimulates Tanshinone Accumulation in Salvia miltiorrhiza Solid Callus Cultures. Molecules 2022, 27, 1772. [Google Scholar] [CrossRef]
- Chow, C.N.; Lee, T.Y.; Hung, Y.C.; Li, G.Z.; Tseng, K.C.; Liu, Y.H.; Kuo, P.L.; Zheng, H.Q.; Chang, W.C. PlantPAN3.0: A new and updated resource for reconstructing transcriptional regulatory networks from ChIP-seq experiments in plants. Nucleic Acids Res. 2019, 47, D1155–D1163. [Google Scholar] [CrossRef]
- Keilwagen, J.; Grau, J.; Paponov, I.A.; Posch, S.; Strickert, M.; Grosse, I. De-novo discovery of differentially abundant transcription factor binding sites including their positional preference. PLoS Comput. Biol. 2011, 7, e1001070. [Google Scholar] [CrossRef]
- Yu, C.-P.; Lin, J.-J.; Li, W.-H. Positional distribution of transcription factor binding sites in Arabidopsis thaliana. Sci. Rep. 2016, 6, 25164. [Google Scholar] [CrossRef]
- Kristiansson, E.; Thorsen, M.; Tamás, M.J.; Nerman, O. Evolutionary forces acts on promoter length: Identification of enriched cis-regulatory elements. Mol. Biol. Evol. 2009, 26, 1299–1307. [Google Scholar] [CrossRef]
- Mongélard, G.; Seemann, M.; Boisson, A.M.; Rohmer, M.; Bligny, R.; Rivasseau, C. Measurement of carbon flux through the MEP pathway for isoprenoid synthesis by (31)P-NMR spectroscopy after specific inhibition of 2-C-methyl-d-erythritol 2,4-cyclodiphosphate reductase. Effect of light and temperature. Plant Cell Environ. 2011, 34, 1241–1247. [Google Scholar] [CrossRef]
- Kellogg, E.A. C4 photosynthesis. Curr. Biol. 2013, 23, R594–R599. [Google Scholar] [CrossRef]
- Baldwin, A.S., Jr. The NF-kappa B and I kappa B proteins: New discoveries and insights. Annu. Rev. Immunol. 1996, 14, 649–683. [Google Scholar] [CrossRef] [PubMed]
- Daletos, G.; Katsimpouras, C.; Stephanopoulos, G. Novel Strategies and Platforms for Industrial Isoprenoid Engineering. Trends Biotechnol. 2020, 38, 811–822. [Google Scholar] [CrossRef] [PubMed]
- Kai, G.; Xu, H.; Zhou, C.; Liao, P.; Xiao, J.; Luo, X.; You, L.; Zhang, L. Metabolic engineering tanshinone biosynthetic pathway in Salvia miltiorrhiza hairy root cultures. Metab. Eng. 2011, 13, 319–327. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.J.; Gao, W.; Rong, Q.; Jin, G.; Chu, H.; Liu, W.; Yang, W.; Zhu, Z.; Li, G.; Zhu, G.; et al. Modular pathway engineering of diterpenoid synthases and the mevalonic acid pathway for miltiradiene production. J. Am. Chem. Soc. 2012, 134, 3234–3241. [Google Scholar] [CrossRef]
- Zhou, X.R.; Bhandari, S.; Johnson, B.S.; Kotapati, H.K.; Allen, D.K.; Vanhercke, T.; Bates, P.D. Reorganization of Acyl Flux through the Lipid Metabolic Network in Oil-Accumulating Tobacco Leaves. Plant Physiol. 2020, 182, 739–755. [Google Scholar] [CrossRef] [PubMed]
- Woodhouse, M.R.; Cannon, E.K.; Portwood, J.L., II; Harper, L.C.; Gardiner, J.M.; Schaeffer, M.L.; Andorf, C.M. A pan-genomic approach to genome databases using maize as a model system. BMC Plant Biol. 2021, 21, 385. [Google Scholar] [CrossRef]
- Sando, T.; Takeno, S.; Watanabe, N.; Okumoto, H.; Kuzuyama, T.; Yamashita, A.; Hattori, M.; Ogasawara, N.; Fukusaki, E.; Kobayashi, A. Cloning and characterization of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway genes of a natural-rubber producing plant, Hevea brasiliensis. Biosci. Biotechnol. Biochem. 2008, 72, 2903–2917. [Google Scholar] [CrossRef]
- Veau, B.; Courtois, M.; Oudin, A.; Chénieux, J.C.; Rideau, M.; Clastre, M. Cloning and expression of cDNAs encoding two enzymes of the MEP pathway in Catharanthus roseus. Biochim. Biophys. Acta 2000, 1517, 159–163. [Google Scholar] [CrossRef]
Nr | Sequence of Closely Spaced RSRE Repetitions | Gene ID/Name |
---|---|---|
1 | ACGCGGACCGCAGCCGCGC | Zm00001d051458_T002/MECPS1 |
2 | CCGCGCTACCGTTCCGCGT | Zm00001d051458_T003/MECPS1 |
3 | ACGCGGACCGCAGCCGCGC | Zm00001d051458_T005/MECPS1 |
4 | ACGCGGACCGCAGCCGCGC | Zm00001d051458_T006/MECPS1 |
5 | ACGCGGACCGCAGCCGCGC | Zm00001d051458_T007/MECPS1 |
6 | ACGCGGACCGCAGCCGCGC | Zm00001d051458_T008/MECPS1 |
7 | CCGCGCCACGAATCCGCGC | Zm00001d017608_T001/MECPS2 |
Nr | Sequence of Closely Spaced RSRE Repetitions | Gene ID/Name |
---|---|---|
1 | GCGCGCTGGTGCGCGC | Zm00001d012197_T001/CMS |
2 | GCGCGCTGGTGCGCGC | Zm00001d012197_T005/CMS |
3 | GCGCGCTGGTGCGCGC | Zm00001d012197_T006/CMS |
4 | GCGCGCTGGTGCGCGC | Zm00001d012197_T007/CMS |
5 | CCGCGCGCCAGAGCTCGCGCGC | Os03t0732000-00/HDR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szymczyk, P. Closely-Spaced Repetitions of CAMTA Trans-Factor Binding Sites in Promoters of Model Plant MEP Pathway Genes. Appl. Sci. 2023, 13, 9680. https://doi.org/10.3390/app13179680
Szymczyk P. Closely-Spaced Repetitions of CAMTA Trans-Factor Binding Sites in Promoters of Model Plant MEP Pathway Genes. Applied Sciences. 2023; 13(17):9680. https://doi.org/10.3390/app13179680
Chicago/Turabian StyleSzymczyk, Piotr. 2023. "Closely-Spaced Repetitions of CAMTA Trans-Factor Binding Sites in Promoters of Model Plant MEP Pathway Genes" Applied Sciences 13, no. 17: 9680. https://doi.org/10.3390/app13179680